ID: 1087468392

View in Genome Browser
Species Human (GRCh38)
Location 11:98540104-98540126
Sequence CTCCCCAAGGGGAAATATCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087468388_1087468392 2 Left 1087468388 11:98540079-98540101 CCTTCTGGATTGAAAATGGTATC No data
Right 1087468392 11:98540104-98540126 CTCCCCAAGGGGAAATATCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087468392 Original CRISPR CTCCCCAAGGGGAAATATCG TGG Intergenic
No off target data available for this crispr