ID: 1087476306

View in Genome Browser
Species Human (GRCh38)
Location 11:98639380-98639402
Sequence TGGTTGTGATAAGTTCTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087476306_1087476309 24 Left 1087476306 11:98639380-98639402 CCATGTAGAACTTATCACAACCA No data
Right 1087476309 11:98639427-98639449 CTCCATAAAAACAAAGACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087476306 Original CRISPR TGGTTGTGATAAGTTCTACA TGG (reversed) Intergenic
No off target data available for this crispr