ID: 1087488477

View in Genome Browser
Species Human (GRCh38)
Location 11:98790616-98790638
Sequence GATTGTGGCCATTCATCTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087488477_1087488481 25 Left 1087488477 11:98790616-98790638 CCATTAGATGAATGGCCACAATC No data
Right 1087488481 11:98790664-98790686 CATTTGGATTGTTTACAATTTGG No data
1087488477_1087488483 27 Left 1087488477 11:98790616-98790638 CCATTAGATGAATGGCCACAATC No data
Right 1087488483 11:98790666-98790688 TTTGGATTGTTTACAATTTGGGG No data
1087488477_1087488482 26 Left 1087488477 11:98790616-98790638 CCATTAGATGAATGGCCACAATC No data
Right 1087488482 11:98790665-98790687 ATTTGGATTGTTTACAATTTGGG No data
1087488477_1087488480 9 Left 1087488477 11:98790616-98790638 CCATTAGATGAATGGCCACAATC No data
Right 1087488480 11:98790648-98790670 GTTCACTTGCGATGGTCATTTGG No data
1087488477_1087488479 1 Left 1087488477 11:98790616-98790638 CCATTAGATGAATGGCCACAATC No data
Right 1087488479 11:98790640-98790662 GTTAATTTGTTCACTTGCGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087488477 Original CRISPR GATTGTGGCCATTCATCTAA TGG (reversed) Intergenic
No off target data available for this crispr