ID: 1087491766

View in Genome Browser
Species Human (GRCh38)
Location 11:98837075-98837097
Sequence CTGAGGGTGTGGAGGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087491766_1087491775 -3 Left 1087491766 11:98837075-98837097 CCCTCCACCCTCCACACCCTCAG No data
Right 1087491775 11:98837095-98837117 CAGATAGGCCCCATTGTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087491766 Original CRISPR CTGAGGGTGTGGAGGGTGGA GGG (reversed) Intergenic
No off target data available for this crispr