ID: 1087492135

View in Genome Browser
Species Human (GRCh38)
Location 11:98841926-98841948
Sequence GTCCATTTGGTCTATAGTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087492131_1087492135 11 Left 1087492131 11:98841892-98841914 CCATTAGATGAAATTTTCTGTAA No data
Right 1087492135 11:98841926-98841948 GTCCATTTGGTCTATAGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087492135 Original CRISPR GTCCATTTGGTCTATAGTGT AGG Intergenic
No off target data available for this crispr