ID: 1087504803

View in Genome Browser
Species Human (GRCh38)
Location 11:99005876-99005898
Sequence CTGTAGAAGGTGAGGTGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087504803_1087504808 8 Left 1087504803 11:99005876-99005898 CCTACCCACCTCACCTTCTACAG No data
Right 1087504808 11:99005907-99005929 ATCTCTGCCTGCTCAGCCCCTGG No data
1087504803_1087504809 9 Left 1087504803 11:99005876-99005898 CCTACCCACCTCACCTTCTACAG No data
Right 1087504809 11:99005908-99005930 TCTCTGCCTGCTCAGCCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087504803 Original CRISPR CTGTAGAAGGTGAGGTGGGT AGG (reversed) Intergenic
No off target data available for this crispr