ID: 1087511867

View in Genome Browser
Species Human (GRCh38)
Location 11:99104786-99104808
Sequence CATGGGCACAAATTTAAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 248}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087511867 Original CRISPR CATGGGCACAAATTTAAAGA AGG Intronic
900747538 1:4371444-4371466 CATGGGCAGGTTTTTAAAGAAGG + Intergenic
901272385 1:7962342-7962364 CATGGGCAAAAATTTAAATGTGG - Intronic
903143340 1:21353616-21353638 CGTGGGCACTAATCTAGAGAAGG + Intergenic
905515317 1:38558251-38558273 CATGGCCACTGATTTAATGAGGG - Intergenic
907102740 1:51851523-51851545 CTTGGGCCCAAATCTAAAAATGG - Intronic
907677721 1:56534091-56534113 CATGGGCAAAGATTTAAAATGGG - Intronic
907862352 1:58365743-58365765 CAAGGGCACAAAATTTAAGGAGG + Intronic
907901722 1:58747680-58747702 CATGGGGACAAAATAAAAAAGGG - Intergenic
908811950 1:67990626-67990648 CAAGGTCACAAATTTAAAAGAGG + Intergenic
909926032 1:81439165-81439187 CATGGGCACAGAGTTAAATTTGG - Intronic
910718336 1:90256980-90257002 CCTGGGCCCAAATTCAAAGCAGG - Intergenic
910806140 1:91191318-91191340 CATGGGGACAGAGGTAAAGAGGG - Intergenic
911584270 1:99672452-99672474 CATGTGCACAAATTTATACCTGG + Intronic
911834967 1:102606369-102606391 AATGAGTAGAAATTTAAAGAAGG - Intergenic
911846860 1:102764325-102764347 AATAGGCAAAAATTTAAAGAGGG + Intergenic
914720514 1:150285080-150285102 CGTGGGCAGAAATGAAAAGAAGG - Intronic
916290018 1:163155487-163155509 CAGGTGCACAGATTTAGAGAAGG - Intronic
916364526 1:164009713-164009735 AATAGGCACAAAATTATAGAGGG - Intergenic
916390802 1:164328942-164328964 AATGGGCACTATTTTAAGGAAGG - Intergenic
917543919 1:175942480-175942502 CATGATCTCAAATTTAAAAATGG + Intergenic
918469454 1:184856504-184856526 CATGGGGAAAAATTTTAAGCTGG + Intronic
918760863 1:188405071-188405093 CAAGGCCATAAAATTAAAGAAGG - Intergenic
919380647 1:196856398-196856420 CTTGGGCACAGATGTAGAGAGGG - Intronic
920018957 1:202938957-202938979 CATGGTAAAAACTTTAAAGAGGG - Intergenic
922303415 1:224323556-224323578 GATGGGGACAAAATTAAGGAAGG + Intronic
923902336 1:238340469-238340491 AATGAGAAGAAATTTAAAGAGGG - Intergenic
1063685581 10:8234394-8234416 CATTGGCACAGATTAAAATAAGG - Intergenic
1066522761 10:36241095-36241117 CATGGGCAAAGATTTCATGAAGG - Intergenic
1066684665 10:37969105-37969127 AATGGGCATAATTTTAAAAATGG + Intronic
1067005133 10:42653723-42653745 CATAAGCACAAACATAAAGAAGG + Intergenic
1067794693 10:49312272-49312294 CCTGGGCAGGAATTTAAAAATGG - Intronic
1071126613 10:82343326-82343348 CATAGGCATACATTTAATGAAGG + Intronic
1071141464 10:82514199-82514221 CAAGGGCAAAAATTTACAAATGG - Intronic
1072023598 10:91430745-91430767 CATGGGCTCAAAATAAAAGGAGG - Intronic
1074445235 10:113516187-113516209 GCTGGGCACTAATTTAAAGAGGG - Intergenic
1074844626 10:117386711-117386733 CTTGGGCACAAAATTTAAGAGGG - Intergenic
1075357651 10:121796214-121796236 CAAGGGCACCTATTTCAAGAGGG + Intronic
1075509450 10:123058852-123058874 AATGGGCGCACATTTAAACAAGG - Intergenic
1077736353 11:4795742-4795764 CATGTGCATAAAATAAAAGAAGG - Intronic
1078498006 11:11840137-11840159 CTTGGGCACAAAATTTAAGGGGG + Intergenic
1080872952 11:36252692-36252714 CTTGGGCACAAAATTTAAGGGGG + Intergenic
1081561644 11:44222582-44222604 CATGGGCAAAAATTTAACCTTGG + Intronic
1082258417 11:50058186-50058208 CATGGGGACTAATTAAATGATGG - Intergenic
1082645532 11:55720033-55720055 CATGTGGACGAATTGAAAGATGG + Intergenic
1085304017 11:75475014-75475036 AATGGGCACACAATTAAACATGG + Intronic
1085644139 11:78211996-78212018 CATAGGCAAAGATTTAATGATGG - Intronic
1086148315 11:83580263-83580285 CATGGGCATATATTTTAATAAGG - Intronic
1087511867 11:99104786-99104808 CATGGGCACAAATTTAAAGAAGG + Intronic
1087844022 11:102950923-102950945 CATGGGCATGAACTTGAAGATGG - Intronic
1088115830 11:106311862-106311884 AATGGGCAGAAAATTAGAGAAGG - Intergenic
1088715225 11:112543219-112543241 CTTGGGCACAAAATGTAAGAGGG - Intergenic
1088742537 11:112778754-112778776 CACGGGCACCAAGATAAAGACGG + Intergenic
1090055806 11:123423757-123423779 GATGAACACAAATTTAAACAAGG - Intergenic
1093401705 12:18754074-18754096 CATGTGAACAAATTGAAGGATGG + Intergenic
1093917566 12:24822892-24822914 CATAAGCACTAATTTATAGAGGG + Intronic
1094117720 12:26935707-26935729 AATGCACACAAATTTTAAGAAGG + Intronic
1095426069 12:42075864-42075886 CATGGCCATGAATTTAAAGTAGG + Intergenic
1095648782 12:44582240-44582262 CATGAGCACAAATCTCAAAAGGG - Intronic
1096311544 12:50525400-50525422 ATTGGGCACAATTTAAAAGAGGG + Intronic
1096708334 12:53437398-53437420 CATGGGCAAAGATTTCATGATGG + Intergenic
1097941259 12:65308762-65308784 CTTGGGCCCTAATTTGAAGACGG + Intronic
1098093737 12:66932161-66932183 CCTGGCCACAAATTTGAAAAAGG + Intergenic
1098276271 12:68814748-68814770 TCTGTGCACAAATTTAAAGGTGG - Intronic
1098398022 12:70042824-70042846 TATAGTCACAAATTTAAAGTGGG + Intergenic
1098550936 12:71760682-71760704 CAGGAGCACAGATATAAAGAAGG - Intronic
1100378280 12:94037898-94037920 CATGGGCACAACTCTAATAATGG + Intergenic
1101040762 12:100753198-100753220 GATGAGCCCAAAATTAAAGATGG + Intronic
1101088482 12:101260152-101260174 CATGGGCACATATAAAAAGATGG + Intergenic
1101697322 12:107138865-107138887 AATGGGCAAAAATGTGAAGATGG - Intergenic
1101968179 12:109294877-109294899 CATGGGGACACCTTTAATGAGGG - Intronic
1102801278 12:115736676-115736698 CATGGGCCTAAAATTAAAAAGGG + Intergenic
1107896851 13:44973778-44973800 AATGAGCAGAACTTTAAAGATGG + Intronic
1109644523 13:65236205-65236227 CATAGGCATAAATTTAATGAAGG - Intergenic
1109989563 13:70036712-70036734 AATGAACACAAATTTAAACAAGG - Intronic
1111281370 13:86029402-86029424 CCTGGGCACAAATGTAGGGAGGG - Intergenic
1112817875 13:103294412-103294434 CATGCTCAAGAATTTAAAGAAGG - Intergenic
1114005875 14:18312841-18312863 GATGGATACAAATTGAAAGAAGG - Intergenic
1114386036 14:22256113-22256135 CATGTGCAAAAATGTAAACAAGG - Intergenic
1115209652 14:30952975-30952997 CATTGGCACATTTTTAAAAAGGG - Intronic
1116712262 14:48383405-48383427 CATGTGCACAAATTGAAGGATGG + Intergenic
1117091981 14:52260831-52260853 CAGGGGCACAAAGTTGAATAAGG + Intergenic
1117205950 14:53443844-53443866 CATGGTGACAAAATTAATGAAGG - Intergenic
1117820126 14:59640241-59640263 CATAAGCAGAAATTTAAAAATGG - Intronic
1118831665 14:69439379-69439401 CTTGGGCATAAATTTAACCAAGG + Intronic
1120124434 14:80724157-80724179 CATGTGCTCACAATTAAAGAGGG + Intronic
1120163720 14:81171998-81172020 CATGCTCACATATTTAAAGTGGG + Intergenic
1122563964 14:102638248-102638270 GATGGGAGCAGATTTAAAGAGGG + Intronic
1125074640 15:35599321-35599343 GATGGGCACAAATTCACAGGGGG - Intergenic
1127237104 15:57065954-57065976 AATGGGAACAAAAATAAAGAAGG - Intronic
1127923400 15:63513329-63513351 CAAGGACAAAGATTTAAAGAAGG - Intronic
1128734269 15:70043830-70043852 AATGAGCAGAAATTCAAAGAAGG + Intergenic
1135603450 16:23802483-23802505 CATAGGCACAATTCTAGAGATGG + Intergenic
1135902198 16:26471821-26471843 CATGGGCATAAACTTAACCAAGG + Intergenic
1138202319 16:55099333-55099355 CTTGAGCACAAAGTCAAAGATGG - Intergenic
1140076026 16:71699569-71699591 CATGTGGACAAATTGAAAGATGG - Intronic
1140111877 16:72011816-72011838 CCAGGCCAGAAATTTAAAGAGGG - Intronic
1141842906 16:86585609-86585631 AATGGGCATAAATTAAATGATGG + Intergenic
1143401653 17:6649479-6649501 CATGGGCTGAAATTAAAAGAGGG - Intronic
1144164401 17:12595101-12595123 CATGAGCAAAAATATAAATAAGG - Intergenic
1149434891 17:56625202-56625224 CTTGGGCACAAAATTTAAGGAGG - Intergenic
1150700174 17:67440121-67440143 CTTGGGCTCAAAATTTAAGATGG + Intronic
1150865890 17:68849656-68849678 CATGGGCACAGATTTAAACATGG - Intergenic
1151336795 17:73444620-73444642 CATAGGCACCAATTTACAGATGG + Intronic
1151336811 17:73444708-73444730 CATAGGCACCAGTTTACAGATGG + Intronic
1154035279 18:10795235-10795257 CAAGGGCACATTTTTAATGAAGG + Intronic
1154531608 18:15351360-15351382 GATGGATACAAATTGAAAGAAGG + Intergenic
1155264393 18:24076827-24076849 CTTAGGCACAAAATTAAAGACGG + Intronic
1155909487 18:31492062-31492084 CAAGGGCACAAATTTAAGGCAGG + Intergenic
1157122002 18:44919656-44919678 TATGGGGACAAGCTTAAAGACGG - Intronic
1157399299 18:47373718-47373740 CACGGGCATACACTTAAAGAGGG - Intergenic
1159322417 18:66869653-66869675 CATAGTCACATATTTAAAGTAGG - Intergenic
1159342210 18:67149809-67149831 CTTGGGCACAAAATTAAGGAAGG - Intergenic
1161443217 19:4304257-4304279 CATAGGGACAAATGGAAAGAAGG + Intergenic
1162080724 19:8216076-8216098 CAGGGCTACAATTTTAAAGAGGG - Intronic
1167400815 19:49267441-49267463 CATAGGAACAAATTTAACCAAGG - Intergenic
1168079748 19:54000934-54000956 CATGGGCACACAATCAATGATGG + Intronic
1168224679 19:54986024-54986046 GATGGACAAAAATTTAAACATGG + Intronic
1168335518 19:55595216-55595238 CAGGGGCACAGATCTGAAGAAGG + Intronic
926506466 2:13721944-13721966 CACAGGGACAAATTGAAAGATGG - Intergenic
926977251 2:18527062-18527084 TACAGGCACAAATGTAAAGAAGG + Intergenic
928343595 2:30468923-30468945 CATGGGCACAATTTTAAAAATGG - Intronic
930094481 2:47556531-47556553 CAGGGTCACCAATTTAAAGTTGG + Intronic
935795226 2:106634523-106634545 GAAGGGGAGAAATTTAAAGAAGG - Intergenic
937318368 2:120946459-120946481 CATGAGCTCAATTTAAAAGATGG - Intronic
938530701 2:132182614-132182636 GATGGATACAAATTGAAAGAAGG + Intronic
940849786 2:158677093-158677115 GGTGGGCACAAATAAAAAGAGGG + Intronic
940954091 2:159709337-159709359 AATGGGTACAAATATAAAGTTGG + Intergenic
941538435 2:166751912-166751934 CATGGCCACAATTTCTAAGATGG + Intergenic
941540322 2:166774073-166774095 CATGTGCATATATTTAAAGAAGG - Intergenic
942345756 2:175001120-175001142 CATGGACAAAAATTTAAATAAGG + Intronic
942383308 2:175416239-175416261 CATGGGCACAAAAATACAGTTGG - Intergenic
943202955 2:184853153-184853175 AATGGGCATAAATTTAACCAAGG - Intronic
943296851 2:186151136-186151158 GATGGGTACAATTTTAAAGATGG - Intergenic
943846794 2:192660115-192660137 CATGTGCACTGTTTTAAAGACGG + Intergenic
944077965 2:195753356-195753378 GATGGTCACAAATCTCAAGATGG - Intronic
945856382 2:215074060-215074082 CAGGGAGAAAAATTTAAAGAAGG - Intronic
946356266 2:219187414-219187436 CTTGGGCACAAATTTCAGGTGGG - Intergenic
1169625554 20:7564469-7564491 CAAGTCAACAAATTTAAAGATGG - Intergenic
1170532862 20:17311940-17311962 CATGGGCACATACTGAATGAGGG - Intronic
1171494756 20:25548113-25548135 CATGGGGGCACATTTAAGGATGG + Intronic
1174428914 20:50453552-50453574 CAAGGTCACACATTTAATGATGG - Intergenic
1175006390 20:55687791-55687813 CTTGGGCACAAAATTAAACGAGG - Intergenic
1176765752 21:13016808-13016830 GATGGATACAAATTGAAAGAAGG - Intergenic
1177374216 21:20248186-20248208 CATAGACACAATTTAAAAGATGG + Intergenic
1179275816 21:39890770-39890792 CCTGGGCACAAAATTTAAGAGGG - Intronic
1180430385 22:15243648-15243670 GATGGATACAAATTGAAAGAAGG - Intergenic
1182910105 22:33976266-33976288 CATGACCACAAATCTCAAGAAGG - Intergenic
1183322148 22:37171517-37171539 CAGGAGCACAATTTTAAACAAGG + Intronic
1183546671 22:38457863-38457885 CCTGGGCACAAACTTGAAGATGG + Intergenic
1183819180 22:40330998-40331020 CATGAGCACAAACATACAGACGG - Exonic
949300270 3:2575630-2575652 TTTGAGCACAGATTTAAAGAAGG - Intronic
951167486 3:19500065-19500087 CATAGGCTCAAATTAAAGGACGG + Intronic
953651645 3:44810797-44810819 CATTAGCACATATTTAAAAAGGG - Intronic
953971291 3:47349625-47349647 CATGTGAACCAATTTAAAAATGG - Intergenic
954765298 3:52910186-52910208 CAAGGGAAGAAATTTAGAGAGGG - Intronic
955494449 3:59517087-59517109 CATGGGCCCAGATTTAGAGTTGG + Intergenic
955505153 3:59625328-59625350 CTTGGGCACAAAATTTAAGGGGG - Intergenic
956322649 3:68015093-68015115 CATGGGCATATTTTTAAAGTAGG - Intronic
956740688 3:72273429-72273451 CATAAGCCCAAAATTAAAGAGGG + Intergenic
957025135 3:75173324-75173346 CATTGGCACATATTCAGAGAAGG + Intergenic
957517657 3:81276797-81276819 CATGGGCAAAAATGTTAAAAGGG - Intergenic
957839918 3:85654652-85654674 CATGGGCACTAATATTAAGTGGG - Intronic
957965662 3:87320359-87320381 CATGTGGACAAATTTAAAATAGG + Intergenic
959428447 3:106222267-106222289 CATAGGCTCAAAATAAAAGATGG - Intergenic
960163982 3:114380985-114381007 CATGAGTAGAAATTTAAAGTTGG - Intronic
961297229 3:125895182-125895204 CAGTGGCAAAAATTAAAAGATGG - Intergenic
964433622 3:156630230-156630252 CTAGGACACAAAATTAAAGAAGG - Intergenic
965648042 3:170905061-170905083 CTTGGGTGCAAAATTAAAGAAGG + Intronic
966350588 3:179029860-179029882 CTTGGGCATAAAATTTAAGAAGG - Intronic
968352044 3:198065935-198065957 CATCACCACAAATTTAAAGGTGG + Intergenic
969207814 4:5660973-5660995 CATGAGCACCAAATTAAATAAGG + Intronic
971333801 4:25704308-25704330 CTTGGACACAAAATTTAAGAAGG + Intergenic
971339607 4:25755910-25755932 CCTGGCAACAAATTTAAGGATGG + Intronic
972431974 4:38991522-38991544 CATGGGTAGAAAGTTAAAGGTGG - Intronic
973932363 4:55806034-55806056 TATGGACACAAACTTAATGAAGG + Intergenic
975315747 4:72951204-72951226 GATGGGCCGAAATCTAAAGATGG - Intergenic
975863040 4:78698245-78698267 AATTGGCAAAAATTTAAAGGGGG - Intergenic
976066361 4:81192308-81192330 AATGGGTAGAAATTGAAAGAGGG + Intronic
976379647 4:84384686-84384708 GGTGGGCACACATTTAATGAGGG - Intergenic
976789976 4:88867349-88867371 CTTGGGAACCATTTTAAAGAGGG + Intronic
976895377 4:90103876-90103898 CATGGACTGAAATTTAAAGGAGG + Intergenic
976943167 4:90731684-90731706 AATGGGAATAAATTTTAAGAGGG + Intronic
977101665 4:92823794-92823816 AATGGCCACAAAATAAAAGAAGG + Intronic
978159641 4:105530211-105530233 CATGCACACATATTTTAAGATGG + Intergenic
979218915 4:118198452-118198474 CAGGGGCACAAAGTTAATGCAGG - Intronic
980310402 4:131122022-131122044 CATAGGGACAAATTTAACTAAGG - Intergenic
980345212 4:131606839-131606861 CATTGGCTCAAATATAAAGAAGG + Intergenic
980401849 4:132298282-132298304 CATGCTCACAAACATAAAGATGG + Intergenic
980963215 4:139497140-139497162 AATGAGCCCAAATTTCAAGAGGG - Intronic
981266228 4:142786848-142786870 AATTGTCAAAAATTTAAAGAGGG + Intronic
981477575 4:145202868-145202890 GATGGGCACACATTTACAAATGG + Intergenic
985139845 4:186828731-186828753 CATGGCCAAGAATCTAAAGAGGG - Intergenic
985232601 4:187837288-187837310 CATGGGCAAAGATTTCATGATGG - Intergenic
985940111 5:3128618-3128640 AATAGACACAAATTTAAAAATGG + Intergenic
986619284 5:9654318-9654340 CTTGGGCAAAAATTTTTAGAAGG + Intronic
987378326 5:17258824-17258846 AAAGGGCTCAAATTTGAAGAAGG + Intronic
989005693 5:36809623-36809645 CAAGTGCACAAATAAAAAGAGGG - Intergenic
989035977 5:37172345-37172367 TATGGGCAAAAAATTCAAGAGGG + Intronic
990839590 5:60062001-60062023 CATGGGCAAAGATTTTATGATGG + Intronic
992210732 5:74477511-74477533 CATGGGCAAAATTATAAAGTAGG + Intergenic
994539694 5:101078424-101078446 TATGGGCACCAAGTTAAAAAGGG + Intergenic
995011619 5:107262072-107262094 CAGGGACACAGATTTAAACAAGG - Intergenic
996302039 5:121998909-121998931 CATGGGTACAAATTATAAAAGGG - Intronic
997007873 5:129841098-129841120 CATGGGCAACAAATGAAAGAAGG + Intergenic
997299024 5:132788874-132788896 CATGGGCATGAAGGTAAAGAAGG + Intronic
1001067128 5:168544723-168544745 AATGGCCACAATTTAAAAGACGG + Intergenic
1006532429 6:34667936-34667958 TCTGGGAACAAATTTAGAGATGG + Intronic
1007116351 6:39345821-39345843 AATGGGGGCAAATTTATAGAAGG + Intronic
1008006855 6:46419537-46419559 CTTGGGCAAAAATTTAAAACAGG - Intronic
1008412731 6:51199478-51199500 CATAGGCACACATTTGAATAAGG - Intergenic
1008671093 6:53769690-53769712 CAAGGGCACAAAATTTAAGGAGG + Intergenic
1009281566 6:61758447-61758469 CATGGGGACAGAAATAAAGATGG - Intronic
1009730294 6:67593962-67593984 CATTTGTACAAATTTATAGAAGG + Intergenic
1010838592 6:80620202-80620224 TATGGGTACAATTTTAAATAAGG + Intergenic
1012063695 6:94519086-94519108 CATGTCCACAAATTGAAAGTGGG - Intergenic
1012538765 6:100334322-100334344 TGTGGGCACAAATATAAACATGG - Intergenic
1013013359 6:106139793-106139815 CATGGGAACCTATTTAAAGTAGG - Intergenic
1013303117 6:108822644-108822666 CCTGGGCACCAAGTCAAAGAAGG + Intergenic
1013464925 6:110409627-110409649 CATGGGCACATGTTTAAAGATGG - Intronic
1014894143 6:126880611-126880633 CATTGCCATAAATTTAAAGGGGG + Intergenic
1016727651 6:147393513-147393535 CATGGGAACAAATTTGAAAAAGG - Intergenic
1016957234 6:149638680-149638702 CATGAGCACACATATAGAGATGG - Intronic
1017851843 6:158311065-158311087 CATGGGTACAAATGTGAACACGG + Intronic
1019060004 6:169250398-169250420 CATGGGAAAATATTTAAAGGAGG + Intronic
1019761876 7:2818930-2818952 CACGGGCAGAATTCTAAAGATGG + Intronic
1020111466 7:5450545-5450567 CCTGGGCACAATTTTACAGACGG + Intronic
1020534482 7:9378287-9378309 CATAGGAAAAAATATAAAGAAGG + Intergenic
1020576874 7:9944383-9944405 AATGGGCACAAAAATATAGATGG - Intergenic
1026011316 7:66638691-66638713 GAAGGGCACAAACTTAAACAAGG - Intronic
1027990735 7:85357650-85357672 CATGGTGACAAATCTACAGAAGG + Intergenic
1030956665 7:115861255-115861277 AAGGAGCACAAATTTTAAGAAGG + Intergenic
1032224877 7:130023374-130023396 CATGTGAATAAATTTAAAGTTGG - Intronic
1033235283 7:139633402-139633424 AATGAGAACAAATTTAAAGGGGG - Intronic
1033736265 7:144225079-144225101 GATGGACAAAAATTAAAAGATGG - Intergenic
1033746789 7:144325876-144325898 GATGGACAAAAATTAAAAGATGG + Intergenic
1036983305 8:13495918-13495940 AATGTGCACAAATTTATTGAAGG + Intronic
1037685631 8:21137295-21137317 CATGGGTACAAATTGATGGAAGG - Intergenic
1038059909 8:23901564-23901586 CATTTGCACAAATTTAAAATAGG + Intergenic
1038946321 8:32364752-32364774 AATTGGCACAACTTTAAAGGGGG - Intronic
1039313824 8:36349984-36350006 CATGGGCTCAAATATAGATAAGG - Intergenic
1039818791 8:41118217-41118239 CATGGGCTCTGATTTAATGAAGG - Intergenic
1039893531 8:41700216-41700238 CATGGGCACAGACACAAAGATGG + Intronic
1042984065 8:74564419-74564441 CTTAGGCACACTTTTAAAGAAGG - Intergenic
1044825728 8:96195132-96195154 CATGATCATAAATTTAAACAAGG + Intergenic
1045057458 8:98382002-98382024 CTTGGGCACAAAATTTAAGTGGG - Intergenic
1045867316 8:106882745-106882767 CATTGACATAAATATAAAGATGG + Intergenic
1047178273 8:122562657-122562679 GATGGCAACAAATTGAAAGAAGG - Intergenic
1048187994 8:132261872-132261894 TTTGGGCACAAAGTTTAAGAGGG + Intronic
1050879355 9:10679830-10679852 CAGCAGCACAAATTCAAAGATGG - Intergenic
1050985289 9:12074899-12074921 AATGGATACAAATTTAAAAATGG + Intergenic
1051080276 9:13286126-13286148 CCTGGGCACAAAATTAAAGGAGG - Intergenic
1052039193 9:23719069-23719091 CACCTGCAGAAATTTAAAGAGGG + Intronic
1052660178 9:31419395-31419417 CATGTGAACAAATTGAAAGATGG - Intergenic
1053362250 9:37497016-37497038 CATTGGCCCCAATTTATAGATGG + Intronic
1053709309 9:40789134-40789156 GATGGATACAAATTGAAAGAAGG + Intergenic
1054419218 9:64909931-64909953 GATGGATACAAATTGAAAGAAGG + Intergenic
1055181286 9:73389545-73389567 CATAGGCATACATTTAAACAAGG - Intergenic
1056257817 9:84818311-84818333 CTAGGGCACAATTTGAAAGACGG + Intronic
1058416408 9:104793355-104793377 CATAGGCCCAAATTTGAGGAAGG - Intronic
1059032283 9:110711655-110711677 CAGTGGAACAAACTTAAAGAAGG + Intronic
1059077137 9:111205351-111205373 CAAGAGCAAAAATTTAAAAATGG + Intergenic
1059346865 9:113634861-113634883 AATGGGCTCAAATTACAAGAGGG + Intergenic
1187099158 X:16174125-16174147 CTTGGGAACAAATTTAACAAAGG + Intergenic
1187364398 X:18654579-18654601 CATAGGCACATGTTGAAAGATGG + Intronic
1187618941 X:21029246-21029268 CTTGGGCACAAAATTAACCAAGG + Intergenic
1187619876 X:21040323-21040345 CATGGTCATAAATTTAAAATGGG - Intergenic
1188073529 X:25747322-25747344 TATGAGTACAAATTTAAAGCTGG - Intergenic
1189449411 X:41113944-41113966 AATGTGAACAAATGTAAAGATGG + Intronic
1193359882 X:80569250-80569272 CATAGGCTCAAATTTAAAAATGG - Intergenic
1193882801 X:86945464-86945486 CATGGGAAAAAATTCAAAAAAGG - Intergenic
1194458107 X:94129742-94129764 CAAGGGCACAAAATTTAAGGAGG - Intergenic
1195315275 X:103671562-103671584 CATGGACACAAATTCACACATGG - Intergenic
1196523953 X:116708771-116708793 CATGGGCAAATATTTAACAATGG - Intergenic
1197777315 X:130127003-130127025 CATGAACACAAGTTTAAAGGTGG + Intergenic
1197914377 X:131519615-131519637 CCTGGGGAAAAATTTAAATATGG - Intergenic
1199055333 X:143287337-143287359 CATTGTCACAAATTTCAAGATGG + Intergenic
1199993048 X:153000337-153000359 CATGGGCTCAAAGCTAAAAATGG - Intergenic