ID: 1087512111

View in Genome Browser
Species Human (GRCh38)
Location 11:99109518-99109540
Sequence ATGGCTTATCTGGTTTAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 111}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087512111 Original CRISPR ATGGCTTATCTGGTTTAAAG AGG (reversed) Intronic
908094198 1:60720078-60720100 ATGGCATATATATTTTAAAGAGG - Intergenic
913325608 1:117625786-117625808 ATGGCTGATCTGCTTTTAAGAGG - Exonic
913330015 1:117659429-117659451 ATGGCTTAGCAGGTGAAAAGGGG + Intergenic
917936421 1:179872054-179872076 TTGGCTTCTCTGTTCTAAAGAGG - Intronic
919543541 1:198881611-198881633 TTGACTTATCTGTTTTGAAGTGG - Intergenic
920299521 1:204979824-204979846 CTTGATTATCTGCTTTAAAGGGG + Intronic
921850889 1:219930610-219930632 GAGGCTTATCTGGTGTAAGGTGG - Intronic
922016690 1:221655428-221655450 ATGGCTTACCTGGTAACAAGAGG - Intergenic
924331033 1:242940701-242940723 GTGGCTTAGCAGGCTTAAAGAGG - Intergenic
1063059601 10:2537693-2537715 AGGGCTCATCTGCTCTAAAGAGG - Intergenic
1063303061 10:4870267-4870289 ATGTCTTATATGGTTTTAAATGG - Intergenic
1064776000 10:18777990-18778012 ATGGTTTCTGTGGTTTACAGGGG - Intergenic
1067009437 10:42696097-42696119 ATGGCTTATCTCCTTTATATTGG - Intergenic
1067314280 10:45147154-45147176 ATGGCTTATCTCCTTTACATTGG + Intergenic
1069527561 10:69186630-69186652 AGGGCTTATTTGGTTTAGAGTGG + Intronic
1069554132 10:69385703-69385725 CTGGATTAACTGGTTTACAGAGG - Intronic
1070111719 10:73493631-73493653 ATGGATTATATGTTTTAAAATGG - Intronic
1075880296 10:125845488-125845510 ATGCCTTCTCTTGTCTAAAGTGG + Intronic
1079821643 11:25139004-25139026 ATGAATTATCTTGTTTAAAGAGG - Intergenic
1087512111 11:99109518-99109540 ATGGCTTATCTGGTTTAAAGAGG - Intronic
1088070818 11:105782443-105782465 ATGTATTATTTGGTTTTAAGAGG - Intronic
1092058491 12:5526210-5526232 GTGGCTTATCTGCTTTTATGTGG - Intergenic
1098042191 12:66363560-66363582 ATGGCAAAACTTGTTTAAAGAGG - Intronic
1098745993 12:74237330-74237352 ATGGGTTATGTGGTTGTAAGTGG - Intergenic
1102852509 12:116262007-116262029 ATGCCTGAACTGTTTTAAAGAGG - Intronic
1103885521 12:124197467-124197489 ATGGCTTTACTGATTTAACGGGG - Intronic
1104378851 12:128289502-128289524 ACGGCGTACCTGGTTTATAGGGG + Intronic
1105539880 13:21307217-21307239 ATGGCTTCTCTGGTTAGACGAGG + Intergenic
1105798443 13:23880833-23880855 ATGGCTTCTCTGGTTAGACGAGG - Intronic
1107309268 13:39059697-39059719 ATGTATTATGTGGTTTTAAGAGG + Intergenic
1109316535 13:60756060-60756082 AAGATTTATCTGGTTTTAAGAGG - Intergenic
1110146240 13:72193914-72193936 GTGGCTGATCTGGTTTAACAAGG - Intergenic
1110425446 13:75361883-75361905 CTGCCTTATCTGCTTTGAAGGGG + Intronic
1111199174 13:84911511-84911533 ATGCCTTATCAGAATTAAAGTGG + Intergenic
1111788594 13:92823587-92823609 AGGGCTTACCTATTTTAAAGGGG - Intronic
1112608879 13:100936077-100936099 ATGGATTATCTCTTTTAAGGGGG - Intergenic
1113150024 13:107252747-107252769 ATTGTTTATATTGTTTAAAGTGG - Intronic
1113238023 13:108303272-108303294 ATGGCTTCTCAGCTTTAAAAGGG + Exonic
1118240465 14:64051943-64051965 ATGGATTTTCTGTTTTAAAGGGG + Exonic
1126127458 15:45308700-45308722 CTGGTTTATTTGGTTTAAATTGG + Intergenic
1128465697 15:67909280-67909302 ATACCTTATGTGGTTTAAAAAGG + Intergenic
1133450184 16:5897341-5897363 ATGCCTTTTCTGTTTAAAAGCGG - Intergenic
1135636011 16:24076314-24076336 TTGGCTTTTCTGGTTAAAAGAGG + Intronic
1144321172 17:14121771-14121793 CTGGCTTATGTGGTGGAAAGTGG + Intronic
1146088761 17:29855044-29855066 ATAGATTATATGGTTTTAAGAGG + Intronic
1148606584 17:48933972-48933994 AATGCTTATCTATTTTAAAGGGG + Intronic
1149087414 17:52734724-52734746 ATGCCTTCTCTGGTTTTAATGGG - Intergenic
1149571930 17:57678258-57678280 ATGGTTTATTTGGTTAAGAGAGG - Intronic
1151035117 17:70789770-70789792 GTGACTTTTCTGCTTTAAAGGGG + Intergenic
1160058551 18:75509204-75509226 ATGGCTTCTCTGGGCTCAAGCGG - Intergenic
1160109399 18:76011608-76011630 ATGGCTTATCTTGTCTCACGGGG - Intergenic
1167703911 19:51067143-51067165 ATGGGTTATCTGATTTTATGAGG - Intergenic
925363039 2:3292960-3292982 AGGGCTTATTTCGTTTAATGTGG - Intronic
928061450 2:28117409-28117431 ATGCCTAAGCTGGTTTGAAGTGG - Intronic
937648613 2:124295321-124295343 ATGGATTATGTGGTGTACAGAGG + Intronic
939322172 2:140638363-140638385 ATGGCTTGTCTTTTTTAAATTGG - Intronic
939883836 2:147659620-147659642 CTGGCTTCTCTGCTTGAAAGGGG + Intergenic
942516762 2:176762136-176762158 ATAGCATATCTGTGTTAAAGAGG - Intergenic
944903830 2:204243094-204243116 ATGCCTTACCTGGTTTGAACAGG - Intergenic
947430836 2:230026170-230026192 ATGGATCATTTGCTTTAAAGGGG + Intergenic
1169851735 20:10059688-10059710 ATGGCTCAACATGTTTAAAGGGG + Intergenic
1175549584 20:59808539-59808561 TTGGCTTTTGAGGTTTAAAGAGG - Intronic
1175762085 20:61568119-61568141 AGGGTTCATCTGTTTTAAAGGGG - Intronic
1175787228 20:61719558-61719580 AAGGCTTTTGTGATTTAAAGCGG - Intronic
1177542911 21:22519320-22519342 ACGGCTTATCTGGGTTATACAGG - Intergenic
1184283121 22:43450169-43450191 AGGGCTTATCTGGGTTTCAGAGG + Intronic
1184558601 22:45247861-45247883 ATTCCTTTTCTGGTTTAAGGTGG + Intergenic
1185234809 22:49705527-49705549 AAGGCTTATCTGGATTAAGGTGG + Intergenic
950584928 3:13885538-13885560 ATGGTTGATTTGGCTTAAAGAGG - Intergenic
952038051 3:29227534-29227556 ATTGGATATCTGATTTAAAGAGG + Intergenic
954141012 3:48605517-48605539 CTGGCTTCTCTGGTGAAAAGTGG + Intronic
961254770 3:125539880-125539902 ATGGCTTATCTAGATTCAAAAGG + Intronic
967684659 3:192406433-192406455 AGGGCTTATGTGGTCTACAGAGG - Intronic
968073612 3:195803615-195803637 ATAGCTTATCTTGTTAATAGCGG + Intronic
970816900 4:20167456-20167478 ATGGCTTATGTCTTTTAAATAGG + Intergenic
977794913 4:101152971-101152993 AAGGTTTATCTGGGTCAAAGGGG + Intronic
977953915 4:103004816-103004838 ATTTCTTATCTAGTTAAAAGAGG + Intronic
978624802 4:110672771-110672793 ATTAGTTATCTGGATTAAAGAGG + Intergenic
984328764 4:178288579-178288601 ATGATTTAGCTGGTTGAAAGTGG + Intergenic
986523846 5:8651010-8651032 ATTGTTTTTCTGTTTTAAAGAGG + Intergenic
987926605 5:24350278-24350300 ATGCCTTATCTGGGCTAATGTGG - Intergenic
988073064 5:26319693-26319715 AGGGCTTAGGAGGTTTAAAGTGG - Intergenic
990138074 5:52671103-52671125 CTGGTTTAACTGGTTTCAAGTGG + Intergenic
990827457 5:59917328-59917350 ATGGCTTAGCTGGTCTCAATGGG + Intronic
991003054 5:61802292-61802314 GTGGCTTTTCTGGATTAATGTGG + Intergenic
991326892 5:65443691-65443713 ATAGTTTATCTTTTTTAAAGTGG - Intronic
993156092 5:84225470-84225492 ATCACTTATCTGTTTTAACGAGG + Intronic
994267110 5:97730549-97730571 ATCTATTTTCTGGTTTAAAGCGG - Intergenic
995921851 5:117324172-117324194 TTGACTTATCTGTTTTAAAATGG - Intergenic
996887648 5:128377085-128377107 ATGGTTTATGTGGTTTTAACAGG - Intronic
997646418 5:135484978-135485000 AGGACTGATCTGGCTTAAAGAGG + Intergenic
999942575 5:156560313-156560335 AGGGCTTTTCTGCTTTCAAGGGG - Intronic
1001140913 5:169143095-169143117 AAGGTTTATTTGGGTTAAAGTGG - Intronic
1006661186 6:35646479-35646501 ATGGCTTAACTGGAATTAAGGGG - Intronic
1010354092 6:74909956-74909978 ATAGTTTATCTTGATTAAAGAGG + Intergenic
1010832237 6:80544637-80544659 TGGACTTCTCTGGTTTAAAGAGG - Intergenic
1012321401 6:97851430-97851452 ATGGCTGTTCGGGTTTACAGTGG - Intergenic
1017210931 6:151855247-151855269 ATGGCTTAACTGGTTAATAGTGG - Intronic
1017682876 6:156881794-156881816 ATGGCTTATTTGGGTTAATAAGG + Intronic
1018108132 6:160508392-160508414 ATGGGTTAACTTGGTTAAAGGGG - Intergenic
1021898621 7:25261198-25261220 ATGGATTATATGTGTTAAAGGGG - Intergenic
1031427525 7:121624204-121624226 AGGGCTGATATGGTTTAAAGTGG + Intergenic
1033670383 7:143487155-143487177 ATGAATTATCTGCTTTAAAATGG + Intergenic
1033878646 7:145854810-145854832 ATGGCTTATGAGCTTTAAGGGGG + Intergenic
1034631949 7:152537997-152538019 TTACCTTCTCTGGTTTAAAGTGG + Intergenic
1037501775 8:19493360-19493382 TTAGCTTGTCTGCTTTAAAGGGG - Intronic
1040037904 8:42888453-42888475 ATGGCTTTTTTTTTTTAAAGGGG - Intronic
1041344547 8:56883163-56883185 GTGGAAAATCTGGTTTAAAGTGG + Intergenic
1042354508 8:67811660-67811682 GTGGCTTAGCTTTTTTAAAGTGG + Intergenic
1046120058 8:109834824-109834846 ATTGTTTATTTTGTTTAAAGTGG - Intergenic
1046697991 8:117364104-117364126 ATGTCTTATTGGGTTTATAGAGG - Intergenic
1047139493 8:122121373-122121395 ATGGCTTATCCACTCTAAAGTGG + Intergenic
1048648781 8:136451376-136451398 ATGGCTCAACTGGTTTGAAAGGG + Intergenic
1048788804 8:138081302-138081324 ATGGCTCACCTGGTTTACAAAGG + Intergenic
1048828480 8:138453002-138453024 ATGACTTATGTGGGTTAATGTGG + Intronic
1050207785 9:3215415-3215437 ATGGCTTATTTGGTGTAAAAAGG - Intergenic
1051357411 9:16252647-16252669 ATGGCTCCTTTGGTATAAAGGGG - Intronic
1055135117 9:72820707-72820729 AGGGTTTGTCTGGTTGAAAGTGG + Intronic
1058115668 9:101081512-101081534 AAGGCATTTCTGATTTAAAGTGG - Intronic
1061485969 9:130920686-130920708 CTGGCCTATCTGGTTTAAGGAGG - Intronic
1191725019 X:64270296-64270318 ATGCCTTATCTGGCTTAAAGTGG + Intronic
1192453205 X:71256183-71256205 TTTCCTTATCTGTTTTAAAGAGG - Intergenic
1192700021 X:73458982-73459004 AAGGCTTTTCTGGTTTTAAAGGG - Intergenic