ID: 1087517411

View in Genome Browser
Species Human (GRCh38)
Location 11:99181396-99181418
Sequence ATAACACTTGTAATCCAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 2, 1: 3, 2: 11, 3: 13, 4: 132}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087517411_1087517421 27 Left 1087517411 11:99181396-99181418 CCAGGTTGGATTACAAGTGTTAT 0: 2
1: 3
2: 11
3: 13
4: 132
Right 1087517421 11:99181446-99181468 TCCATCCAGAAATGTTAGCAGGG 0: 2
1: 2
2: 1
3: 9
4: 155
1087517411_1087517412 -6 Left 1087517411 11:99181396-99181418 CCAGGTTGGATTACAAGTGTTAT 0: 2
1: 3
2: 11
3: 13
4: 132
Right 1087517412 11:99181413-99181435 TGTTATTATCCCACCCCCATTGG 0: 1
1: 2
2: 2
3: 8
4: 79
1087517411_1087517413 0 Left 1087517411 11:99181396-99181418 CCAGGTTGGATTACAAGTGTTAT 0: 2
1: 3
2: 11
3: 13
4: 132
Right 1087517413 11:99181419-99181441 TATCCCACCCCCATTGGTATTGG 0: 2
1: 2
2: 0
3: 5
4: 63
1087517411_1087517420 26 Left 1087517411 11:99181396-99181418 CCAGGTTGGATTACAAGTGTTAT 0: 2
1: 3
2: 11
3: 13
4: 132
Right 1087517420 11:99181445-99181467 ATCCATCCAGAAATGTTAGCAGG 0: 2
1: 2
2: 1
3: 15
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087517411 Original CRISPR ATAACACTTGTAATCCAACC TGG (reversed) Intronic
900776407 1:4588898-4588920 ATAACATTTGTAATCCAACCTGG - Intergenic
906144072 1:43549816-43549838 GTGCCACTTGTACTCCAACCTGG + Intronic
906498322 1:46321416-46321438 TTCACGCTTGTAATCCAGCCTGG + Intergenic
907718218 1:56947612-56947634 ATATCAGTTGTAATACAACATGG - Intronic
908743738 1:67355369-67355391 ATGCCACTTGTACTCCAGCCTGG + Intronic
910909671 1:92219685-92219707 ATAACAACTGTACTCCAGCCTGG - Intronic
913002023 1:114590345-114590367 ACAACACTTGCACTCCAGCCTGG + Intronic
915664463 1:157432027-157432049 ACAACACTTGCAATCCAACCCGG + Intergenic
918919905 1:190695133-190695155 CTATCACTTGTAATCTCACCAGG - Intergenic
920102473 1:203525935-203525957 ATATCACTTGTACTCCAGCCTGG + Intergenic
920930069 1:210379776-210379798 AGAACACTTGGAATACAGCCAGG - Intronic
921183294 1:212648388-212648410 ATCACCATTGTATTCCAACCTGG - Intergenic
921815006 1:219553467-219553489 ATAACATTTATTATCCAAACTGG - Intergenic
921888150 1:220327019-220327041 ATGCCACTTGTACTCCAGCCTGG - Intergenic
923766858 1:236900530-236900552 TAAACACTTGTAAGCCTACCAGG - Exonic
924172784 1:241358363-241358385 ATAACACTTCTACTCAAACAGGG + Intergenic
1063560410 10:7121030-7121052 CTCACACTTGTAATCCCAGCAGG - Intergenic
1064436658 10:15316763-15316785 TTCACACTTGTATTCCTACCGGG - Intronic
1066210971 10:33237814-33237836 CTCACACTTGTAATCCCAGCGGG - Intronic
1066331594 10:34429436-34429458 ATGCCACTTGTACTCCAGCCTGG - Intronic
1071026236 10:81117262-81117284 ACAACACTGGTAAGCCAAGCTGG + Intergenic
1073278353 10:102332424-102332446 ATAACATTTTTACTCCAGCCTGG - Intronic
1077738195 11:4814620-4814642 ATAACCCTTGGAACACAACCTGG - Intronic
1077929240 11:6712942-6712964 AGAACACTCTGAATCCAACCAGG - Intergenic
1078313053 11:10265726-10265748 GCACCACTTGTACTCCAACCTGG - Intronic
1087517411 11:99181396-99181418 ATAACACTTGTAATCCAACCTGG - Intronic
1087557306 11:99737342-99737364 GTAACACTTGTATTCCACCTTGG - Intronic
1089162201 11:116447208-116447230 ATTACAGTTGTAATCCACCATGG + Intergenic
1089173037 11:116528453-116528475 ATAACAACTGTACTCCAGCCTGG + Intergenic
1095569800 12:43671936-43671958 AGAATAATTGTAATCTAACCAGG - Intergenic
1098490449 12:71070012-71070034 ATAGCAGTTGTTATCAAACCTGG - Intronic
1103369838 12:120410570-120410592 CTCACACCTGTAATCCAACATGG - Intergenic
1103512840 12:121487095-121487117 ACACCACTTGTACTCCAGCCTGG + Intronic
1107969357 13:45626365-45626387 ATAAGATTTGTCATCCAGCCTGG + Intergenic
1112112262 13:96314247-96314269 ACCACACTTGTACTCCAGCCTGG - Intronic
1113347810 13:109497725-109497747 ATAGCAGCTGTTATCCAACCTGG - Intergenic
1114816437 14:25964454-25964476 ATATAATTTGTAATCCAAACTGG - Intergenic
1116361982 14:44011512-44011534 ATAACACTTGCACTCCAGCCTGG - Intergenic
1117200952 14:53389584-53389606 ATCCCACTTGTAATCCTACTTGG + Intergenic
1118943306 14:70359294-70359316 AGTACACCTGAAATCCAACCGGG + Intronic
1120646903 14:87085222-87085244 ATAACACTTATATGCCATCCTGG - Intergenic
1121115644 14:91340957-91340979 ACACCACTTGTACTCCAGCCTGG + Intronic
1121350281 14:93167964-93167986 ATTACACCTGTAATCCGACTCGG - Intergenic
1125262065 15:37837708-37837730 TTAACACCTTTAATCCAAACAGG + Intergenic
1126161395 15:45616949-45616971 ATTATACTTGCAATCCAAACAGG - Intronic
1126343829 15:47672590-47672612 ATAAAAATTTTAATACAACCTGG - Intronic
1128197048 15:65767590-65767612 GAACCACCTGTAATCCAACCAGG + Intronic
1130545023 15:84850424-84850446 ATGACACTTGCACTCCAGCCTGG - Intronic
1131236874 15:90704384-90704406 ATGCCACTTGTACTCCAGCCTGG + Intergenic
1132101984 15:99030182-99030204 ACAACACTTGTAATCAAGGCTGG - Intergenic
1132142231 15:99405612-99405634 GCAACACTTATAATCCAACAAGG + Intergenic
1134289599 16:12893062-12893084 TTAATACATGTAATACAACCTGG - Intergenic
1134569388 16:15278565-15278587 ATACCACTTGTACTCCAGCCTGG - Intergenic
1134732988 16:16477484-16477506 ATACCACTTGTACTCCAGCCTGG + Intergenic
1134934449 16:18234487-18234509 ATACCACTTGTACTCCAGCCTGG - Intergenic
1135747519 16:25029846-25029868 AAAACACCTGGAATCCAGCCAGG - Intergenic
1137953131 16:52802421-52802443 ACACCACTTGTACTCCAGCCTGG + Intergenic
1147773421 17:42883495-42883517 ATGGCACTTGCACTCCAACCTGG - Intergenic
1147937393 17:44020412-44020434 ATAACACTTGAAATCCAACCTGG - Intronic
1147942887 17:44062323-44062345 ATATCATTTGTAGTCCAACCTGG - Intronic
1203160132 17_GL000205v2_random:41716-41738 ATAGCACCTGTAATCCCACCTGG - Intergenic
1153701571 18:7699654-7699676 CTCACACTTGTAATCCCAGCAGG - Intronic
1154256964 18:12790350-12790372 AAAACACTTTTAATACCACCAGG + Intronic
1154300789 18:13190659-13190681 TTAAAACTTGAAATCCAGCCAGG + Intergenic
1155460938 18:26082013-26082035 ATACCACTTGCACTCCAGCCTGG + Intronic
1155707411 18:28833999-28834021 TTAAAGCTTGTAATCCAACAAGG + Intergenic
1155909932 18:31495689-31495711 ACAACACTTGCAATCCAACCTGG + Intergenic
1157428822 18:47606512-47606534 CTCACATTTGTAATCCAATCTGG - Intergenic
1163885752 19:19963339-19963361 ACAACACTTGCAATCCAACCTGG + Intergenic
1163888747 19:19992330-19992352 ACAACACTTGCAATCCAACCTGG - Intergenic
1163935206 19:20436264-20436286 ACAACACTTGTAATCCAACCTGG + Intergenic
1163949416 19:20570154-20570176 ACAACACTTGCAATCCAACCTGG + Intronic
1163968661 19:20771747-20771769 ACAGCACTTGCAATCCAACCTGG - Intronic
1168194266 19:54761960-54761982 ACATCACTTGTACTCCAGCCTGG - Intronic
1168204670 19:54840936-54840958 ACATCACTTGTACTCCAGCCTGG - Intronic
925072709 2:983697-983719 ACAACACTTTAAATCCAACCAGG - Intronic
927597470 2:24409207-24409229 ATAACACATAAAATCCAACCAGG - Intergenic
928254017 2:29706394-29706416 ATAACACTAAGTATCCAACCTGG + Intronic
930124773 2:47786898-47786920 CTCACACTTGTAATCCCAACAGG - Intronic
932507435 2:72249221-72249243 ATACCACTTATACTCCAGCCTGG + Intronic
936836873 2:116720167-116720189 ATAGCACCTGTAGTACAACCTGG + Intergenic
938283067 2:130081071-130081093 CTTACACCTGTAATCCACCCAGG + Intronic
938432543 2:131257828-131257850 CTTACACCTGTAATCCACCCAGG - Intronic
942091660 2:172497456-172497478 ACACCACTTGCACTCCAACCTGG + Intronic
944416353 2:199483597-199483619 ATACCACTTGCACTCCAGCCTGG - Intergenic
945260648 2:207840228-207840250 ATCACACTTGCACTCCAGCCTGG - Intronic
947938993 2:234032355-234032377 TTAACACATGTCATCCATCCAGG - Intergenic
1170379071 20:15736470-15736492 CTCACACTTTTTATCCAACCAGG - Intronic
1175420087 20:58826386-58826408 ATAACATTTGTCATCCACCTGGG - Intergenic
1176338642 21:5622294-5622316 ACAACACTTGCAATCCAACCTGG - Intergenic
1176340050 21:5685367-5685389 ACAACACTTGCAATCCAACCTGG - Intergenic
1176472304 21:7117520-7117542 ACAACACTTGCAATCCAACCTGG - Intergenic
1176495865 21:7499298-7499320 ACAACACTTGCAATCCAACCTGG - Intergenic
1176504777 21:7639089-7639111 ACAACACTTGCAATCCAACCTGG + Intergenic
1183730193 22:39614264-39614286 ATAACCTTTCTAAACCAACCGGG + Intronic
954728462 3:52636813-52636835 CTCACACTTGTAATCCTGCCTGG + Intronic
956280610 3:67552127-67552149 AAAACACTTGCACTCCAGCCTGG + Intronic
958427187 3:93992834-93992856 GTACCACTTGTACTCCAGCCTGG - Intronic
961569115 3:127785588-127785610 GTCACACTGGGAATCCAACCAGG - Intronic
966040223 3:175475758-175475780 ATACCACTTGCATTCCAGCCTGG - Intronic
966071787 3:175886722-175886744 ATAAAACTGCTAATCCAAACAGG + Intergenic
966953644 3:184849429-184849451 ATAATTTTTGTAAACCAACCAGG + Intronic
971088255 4:23305784-23305806 ATGAGACTTGGAATCCAAGCTGG - Intergenic
973112558 4:46413554-46413576 TTTACATTTGTAATGCAACCTGG - Intronic
974421237 4:61678173-61678195 ATAAAATTTGTAAACCATCCTGG + Intronic
974524696 4:63034572-63034594 ATAACATCTGTAATTCAAGCTGG - Intergenic
976316072 4:83660198-83660220 ATATCACTTGCACTCCATCCTGG + Intergenic
976898345 4:90139914-90139936 ATGCCACTTGCACTCCAACCTGG + Intronic
977118482 4:93065520-93065542 ATCAAACTTGTTTTCCAACCTGG - Intronic
978213981 4:106175090-106175112 ATCACGCTTGTACTCCAGCCTGG + Intronic
978440476 4:108728632-108728654 AGATCACTTGTACTCCAGCCTGG + Intergenic
982889350 4:160827323-160827345 ATAAAACTTCTAAGCAAACCAGG + Intergenic
983098176 4:163590814-163590836 ATAACATTTGTGAGTCAACCAGG - Intronic
985880913 5:2638468-2638490 ATAACACTTGTAAATCAAACGGG + Intergenic
987016486 5:13825296-13825318 ATAGCACTTGCACTCCAGCCTGG + Intronic
989651145 5:43691609-43691631 ATAACAGTTGAAATACAACTTGG + Intronic
992812018 5:80397939-80397961 ATCACACCTGTACTCCAGCCTGG + Intergenic
993035673 5:82754659-82754681 ATATTTCTTGTAATCTAACCAGG - Intergenic
994040930 5:95259252-95259274 ACAACACTTGCAACCCAACCTGG + Intronic
998939614 5:147266983-147267005 ATTGCACTTGTACTCCAGCCTGG + Intronic
999587470 5:153106837-153106859 ACAACATTTGTCATCCTACCTGG - Intergenic
1003417787 6:5928331-5928353 ATATCACTTATCATCCAACCTGG - Intergenic
1004102611 6:12629224-12629246 ATGCCACTTGTACTCCAGCCTGG + Intergenic
1004663781 6:17732883-17732905 ATTACACCTGCACTCCAACCTGG - Intergenic
1005749391 6:28869077-28869099 ATAGCACTGATAATGCAACCCGG - Intergenic
1010050519 6:71498820-71498842 CTCACACTTGTAATCCCAGCAGG + Intergenic
1014355319 6:120401529-120401551 ATAAAACTGGTAGTCCTACCTGG - Intergenic
1014899873 6:126949914-126949936 ATAACACTTCTAATTCCATCAGG + Intergenic
1015090545 6:129352121-129352143 ATAAAACTTGTTGTCCAATCTGG + Intronic
1020471407 7:8539858-8539880 ATAACTCTTGGAACCCAACAAGG + Intronic
1020554114 7:9648864-9648886 AAAACACATTTAATCCATCCAGG + Intergenic
1020821763 7:12977657-12977679 ATAACACTTGTAAGTAAGCCTGG - Intergenic
1022568384 7:31426554-31426576 ATAACACTTTCAATCCGACAAGG - Intergenic
1023111325 7:36813988-36814010 ATAAGACTTTGAATCAAACCTGG + Intergenic
1023288873 7:38648168-38648190 ATGCCAATTGTAATCAAACCAGG - Intergenic
1023885964 7:44356271-44356293 AAAACACTTGGAAACCAGCCGGG - Intergenic
1025148567 7:56526485-56526507 ATAACAATTGTAATGAAACTTGG - Intergenic
1031138493 7:117913794-117913816 ACACCACTTGTACTCCAACTGGG - Intergenic
1031597927 7:123669324-123669346 ATGACACTTGTATTCCTAGCTGG + Intergenic
1031750183 7:125562244-125562266 ACATCACTTGTACTCCAGCCTGG - Intergenic
1034754044 7:153597781-153597803 ATTGCACTTGTTATCTAACCAGG + Intergenic
1036714364 8:11106805-11106827 ATGCCACTTGTACTCCAGCCTGG + Intronic
1041234470 8:55785532-55785554 ATAGCCCTTATACTCCAACCTGG + Intronic
1041839435 8:62251083-62251105 ATAACATTTGCAATCCATACAGG + Intronic
1042885477 8:73545303-73545325 CTCACACCTGTAATACAACCTGG - Intronic
1043886693 8:85609184-85609206 ATCACACCTGTACTCCAGCCTGG - Intergenic
1046692695 8:117303732-117303754 ATGCCACTTGTACTCCAGCCTGG + Intergenic
1050279352 9:4034176-4034198 ACACCACTTGTGCTCCAACCTGG + Intronic
1051055926 9:12985619-12985641 ATAACTCTTTTATTTCAACCTGG + Intergenic
1051451886 9:17206196-17206218 ATAACACTTGTAATCCAACCTGG + Intronic
1056489449 9:87090711-87090733 AAACCACTTATAATCAAACCTGG - Intergenic
1056508733 9:87282721-87282743 ATACCACTTTTTTTCCAACCTGG - Intergenic
1058046353 9:100361692-100361714 ATAAAACTGATAACCCAACCAGG + Intergenic
1203423017 Un_GL000195v1:12626-12648 ACAACACTTGCAATCCAACCTGG + Intergenic
1185796243 X:2967467-2967489 CTCACACTTGTAATCCCAGCTGG + Intronic
1185980418 X:4772667-4772689 ATAATACCTGCAATCCAACATGG - Intergenic
1187284804 X:17894766-17894788 ATAAAACTTATTATCTAACCAGG - Intergenic
1189636933 X:43021241-43021263 ATAGCACTTGTAAACCATTCTGG - Intergenic
1192560869 X:72127196-72127218 ATAACACATGTATTCCAAAAGGG + Intronic
1197050699 X:122055541-122055563 ATAAAATTTGTAATCAAAACTGG + Intergenic
1199292104 X:146116135-146116157 ATAACCCCTGCACTCCAACCTGG - Intergenic