ID: 1087517413

View in Genome Browser
Species Human (GRCh38)
Location 11:99181419-99181441
Sequence TATCCCACCCCCATTGGTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 2, 1: 2, 2: 0, 3: 5, 4: 63}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087517411_1087517413 0 Left 1087517411 11:99181396-99181418 CCAGGTTGGATTACAAGTGTTAT 0: 2
1: 3
2: 11
3: 13
4: 132
Right 1087517413 11:99181419-99181441 TATCCCACCCCCATTGGTATTGG 0: 2
1: 2
2: 0
3: 5
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087517413 Original CRISPR TATCCCACCCCCATTGGTAT TGG Intronic
905853308 1:41290303-41290325 AATCCCAGCCCCATGGGTCTAGG + Intergenic
918763900 1:188453630-188453652 TTGCCCAACCACATTGGTATAGG + Intergenic
919119096 1:193316669-193316691 TTCCCCTCCCCCATTGGAATAGG - Intergenic
919550741 1:198983405-198983427 TATCCCTTTCCCATTGGCATTGG + Intergenic
920613536 1:207466576-207466598 TATTCTACCCCCATTGCTGTTGG + Exonic
922197641 1:223373514-223373536 TTTCCTGTCCCCATTGGTATTGG - Intergenic
1062843528 10:688878-688900 GATCCCACCCCCATTGTTCGCGG - Intronic
1084664119 11:70567066-70567088 AATGCCACCACCATTGTTATCGG + Intronic
1087517413 11:99181419-99181441 TATCCCACCCCCATTGGTATTGG + Intronic
1089819643 11:121213112-121213134 GATCCCACCACCATTACTATGGG + Intergenic
1090161231 11:124497811-124497833 TACCCCATCCCCCTTGGTAGGGG - Intergenic
1110026170 13:70542557-70542579 TATCACACACCCATTGTCATGGG + Intergenic
1112565348 13:100547293-100547315 TACCCCACCCCCTCTGGTCTGGG - Intronic
1114899527 14:27039439-27039461 AATCCCAACACCTTTGGTATTGG + Intergenic
1120250817 14:82060308-82060330 CACCCCACCCCTAGTGGTATTGG - Intergenic
1120897160 14:89543893-89543915 CCCCCCACCCCCATTGGTTTTGG - Intronic
1128134410 15:65252185-65252207 TTTCCCACTCTCATTGGTCTTGG - Intronic
1129662618 15:77561458-77561480 TATCACACCCCCCGTGATATGGG - Intergenic
1131469103 15:92680552-92680574 TATCCCATTCCCATTGTTATAGG + Intronic
1134508801 16:14829621-14829643 TATCACACCCACTTTGATATTGG - Intronic
1134696510 16:16228518-16228540 TATCACACCCACTTTGATATTGG - Intergenic
1134975322 16:18566179-18566201 TATCACACCCACTTTGATATTGG + Intergenic
1139530996 16:67542710-67542732 AGTCCTACCCCCAGTGGTATGGG + Exonic
1147937446 17:44020747-44020769 TATCCCACTCCCATTGGTATTGG + Intronic
1148460696 17:47837651-47837673 TCTCCCACCCCCACTGGTCCTGG + Exonic
1152026471 17:77812635-77812657 GAGCCCAACCCCATTGGTGTTGG - Intergenic
1158566904 18:58561726-58561748 ACTCCCACCCCCATTGGTGGAGG + Intronic
1163193929 19:15701408-15701430 CATCTCACCCCCATTGAAATGGG + Intergenic
1166577450 19:43855664-43855686 CATCCCTGCCCCATTGGTGTTGG - Intergenic
1167644384 19:50697761-50697783 TACCCCACCCCCATTAGGAAGGG + Intronic
930903215 2:56533264-56533286 CTTCCCACCCACAGTGGTATTGG - Intergenic
931665049 2:64604482-64604504 TATCCCAGCCCCATCAGGATTGG + Intergenic
932980815 2:76663614-76663636 TATTCCACCCACATGGGTATAGG + Intergenic
946806078 2:223472531-223472553 TCTACCACCCCAATTGGAATAGG - Intergenic
948778634 2:240303402-240303424 TATCCCACCCACAGTGGGAGAGG - Intergenic
952653919 3:35760811-35760833 TGTCCCACCCACATTAGGATTGG + Intronic
958495004 3:94833724-94833746 TATCCCAGCACCATTTGAATAGG - Intergenic
959187555 3:103065445-103065467 TAGCCGACTCCCCTTGGTATTGG + Intergenic
961927070 3:130492448-130492470 TATCCATCCCCTACTGGTATTGG - Intergenic
971002333 4:22337328-22337350 TATCCCACCCCCATTGGTATTGG + Intergenic
973150899 4:46887219-46887241 TATCCCACCCTAAAGGGTATGGG + Intronic
973540328 4:51928638-51928660 TTTCCCACCCCCAGTGGCATTGG - Intergenic
975608438 4:76179776-76179798 TTTCCAACCCCCTTTGCTATGGG - Intronic
978456040 4:108892986-108893008 TATCCCACCCTAATTGGTGCCGG - Intronic
978665705 4:111178494-111178516 TAGCCCACCCACATTGGGAAAGG - Intergenic
980459196 4:133083889-133083911 CATGCTACCCCAATTGGTATTGG + Intergenic
982455987 4:155610185-155610207 AGTCCCACCCCCATTGGTGAGGG - Intergenic
982777919 4:159461083-159461105 TATCCCTGCCCCTTTGTTATGGG - Intergenic
984157217 4:176207427-176207449 TATCCCACCCACCTTGTGATTGG + Intergenic
989064170 5:37443138-37443160 AATCCCACCCCCTATGTTATAGG - Intronic
989296550 5:39834281-39834303 TTTCCCACCCTCTTTTGTATTGG + Intergenic
994417983 5:99498970-99498992 AATCCCACCCCCTATGTTATAGG - Intergenic
994461982 5:100076183-100076205 AATCCCACCCCCTATGTTATAGG + Intergenic
1001557545 5:172646895-172646917 CATCCCACCCCCATTTGCACTGG - Intronic
1001722308 5:173866832-173866854 TATCTCACCCCCTTTTGTGTTGG - Intergenic
1005716804 6:28557246-28557268 AATGCCACTCCCATTTGTATTGG - Intergenic
1006763178 6:36481729-36481751 TATTCCTCCCCCATTGGTGGAGG - Exonic
1024875181 7:54013900-54013922 TGTCTCACCCCCATTGCTATTGG - Intergenic
1029175901 7:98664285-98664307 TATTCCTGCCCCATTGTTATAGG - Intergenic
1030495347 7:110291772-110291794 TCTCCCACCCACATGTGTATGGG - Intergenic
1031767563 7:125801107-125801129 TATCTCTCCCCCAGTGGTAGTGG + Intergenic
1038891213 8:31726637-31726659 TTTCACTCCCCCACTGGTATTGG - Intronic
1039554214 8:38465562-38465584 TATCCTACCCCCAGTGGGTTAGG - Intronic
1051451884 9:17206173-17206195 TACCCCACCCCCATTGGTATCGG - Intronic
1057216434 9:93231316-93231338 TATCCCAGCCCAAGTGGTCTGGG - Intronic
1059123823 9:111664592-111664614 TATCCCACCACCAATGGCAGGGG + Intronic
1186068538 X:5792379-5792401 TTTCCCACCCACATTGGAAAAGG - Intergenic
1186149254 X:6656647-6656669 TATCACACCCCTACTGGTATTGG + Intergenic
1188526492 X:31093660-31093682 TCTCCCACTCCCATTGAGATGGG + Intergenic
1196183118 X:112716850-112716872 TATCCCAGCCCCATTGTTTATGG + Intergenic
1196755830 X:119156302-119156324 TATGCCACCCCCATTGGAGGAGG + Intergenic
1197028328 X:121782594-121782616 TAACCAACACCTATTGGTATTGG + Intergenic