ID: 1087517926

View in Genome Browser
Species Human (GRCh38)
Location 11:99189141-99189163
Sequence ATCCTGTTATTTGTGTAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 3, 2: 2, 3: 33, 4: 236}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087517926_1087517929 0 Left 1087517926 11:99189141-99189163 CCATGTTACACAAATAACAGGAT 0: 1
1: 3
2: 2
3: 33
4: 236
Right 1087517929 11:99189164-99189186 TTCTTTCTTAGGCTTTGGAGTGG 0: 1
1: 0
2: 0
3: 25
4: 456
1087517926_1087517928 -5 Left 1087517926 11:99189141-99189163 CCATGTTACACAAATAACAGGAT 0: 1
1: 3
2: 2
3: 33
4: 236
Right 1087517928 11:99189159-99189181 AGGATTTCTTTCTTAGGCTTTGG 0: 1
1: 0
2: 1
3: 20
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087517926 Original CRISPR ATCCTGTTATTTGTGTAACA TGG (reversed) Intronic
900029727 1:362471-362493 AGCCTGTTATTTGTACAAGATGG + Intergenic
900050325 1:591222-591244 AGCCTGTTATTTGTACAAGACGG + Intergenic
901223517 1:7597543-7597565 ATCCTATTAGTTCTGTTACATGG - Intronic
904743702 1:32697818-32697840 AAGCTGTCATTTGTGTCACAAGG - Intronic
905719182 1:40181763-40181785 TTCCTATTATTGGTGTTACAGGG - Intronic
907737661 1:57130591-57130613 ATCCTGTCATTTGGAGAACATGG + Intronic
907885471 1:58588840-58588862 TTCCTGTTATTTATGTTACATGG - Intergenic
910781197 1:90935846-90935868 ATCCTGTGATTTGAACAACACGG + Intronic
911928843 1:103874067-103874089 AACCTGTGATTTGATTAACAAGG + Intergenic
912600637 1:110929696-110929718 ATCATGTTTTTTGAGAAACATGG + Intergenic
914330791 1:146669131-146669153 ATAATGTTACTTGTGTAACAAGG - Intergenic
917300408 1:173568436-173568458 ATCATGTCTTTTGTGGAACATGG - Intronic
918850696 1:189685685-189685707 TTCCTGTTATTTTTTTAATAAGG - Intergenic
920763047 1:208804275-208804297 ATCCTGTCTTTTAGGTAACATGG - Intergenic
921578071 1:216860745-216860767 ATCATTTTCTTTCTGTAACAAGG - Intronic
923747302 1:236713545-236713567 ATCCTATGATTTGTGTTAAAGGG + Intronic
924646415 1:245881527-245881549 ATACTGTTATTTGCCTAGCATGG - Intronic
1063348345 10:5332597-5332619 ATCCTCTCATTTGAGCAACATGG - Intergenic
1064771994 10:18732987-18733009 TTCATATTATTTGTGGAACATGG - Intergenic
1068479036 10:57565280-57565302 ATTCTGTCATTTGTGAAACATGG - Intergenic
1068843049 10:61637741-61637763 ATTCAGTCATTTGTGAAACATGG - Intergenic
1069091027 10:64198693-64198715 ATTCTGTTATCTGTATATCATGG - Intergenic
1069345971 10:67470255-67470277 ATCCTGTCATTTGCAAAACATGG - Intronic
1075451859 10:122557275-122557297 ATCCTGTAATCTGTGTGACCAGG - Intergenic
1077822366 11:5760373-5760395 TTTCTGTTAATTGTGTGACATGG + Intronic
1077934311 11:6767760-6767782 ATCTGGTTATTTTTATAACATGG + Intergenic
1085247103 11:75111156-75111178 ATGCTGTTCTTTGTGTCCCAAGG - Intronic
1086123151 11:83321520-83321542 ATCCTGTTAGTTGTGTAACATGG - Intergenic
1086347508 11:85912239-85912261 TTCCTATTGTTTGTGTGACATGG + Intronic
1087517926 11:99189141-99189163 ATCCTGTTATTTGTGTAACATGG - Intronic
1087719898 11:101651154-101651176 ATCTTGCTATCTGTGTACCAAGG - Intronic
1090679592 11:129039664-129039686 ACCCTTTAAATTGTGTAACAGGG - Intronic
1091000187 11:131904539-131904561 ATCCAGTGATTTGTTTAAGATGG + Intronic
1092397330 12:8139203-8139225 ATCCTGTCATTTGCACAACATGG - Intronic
1092632557 12:10398212-10398234 ATCCTGTCATTTATACAACATGG - Intronic
1092733239 12:11554222-11554244 ATCCTGTGCTTCGTGCAACAAGG + Intergenic
1097520553 12:60664250-60664272 ATCTTGTCATTTTTGTAACATGG - Intergenic
1099383268 12:81981791-81981813 ATCCTGTAATTTGTGACACAGGG + Intergenic
1099792505 12:87353732-87353754 ATGTTTGTATTTGTGTAACATGG - Intergenic
1100035397 12:90244912-90244934 ATTGTGTTATGTGTGTTACATGG - Intergenic
1100675083 12:96857444-96857466 ATCATGTCTTTTGTGGAACATGG - Intronic
1106354548 13:28967729-28967751 ATCATGTCATCTGGGTAACAAGG - Intronic
1107177753 13:37419597-37419619 ATTTTGTCATTTGTGAAACATGG + Intergenic
1110032517 13:70634155-70634177 ATCCTGTGATTTTTTTAACTTGG + Intergenic
1110830900 13:80029739-80029761 ACTCTGTTTTTTGTGTACCAGGG - Intergenic
1111270551 13:85877521-85877543 ATCCTTTTATTGGTGTATAAAGG - Intergenic
1111310447 13:86477339-86477361 ATCCTTTCTTTAGTGTAACAAGG + Intergenic
1111882073 13:93969878-93969900 ATCCTGTCATTTGCGCAACGTGG - Intronic
1113080964 13:106519354-106519376 GTCCTGTTACATGAGTAACATGG - Intronic
1113157263 13:107337923-107337945 TTGCTGTTATTTGCGTGACACGG - Intronic
1114798840 14:25747991-25748013 ATCCTTTTCTTTGAGTTACATGG - Intergenic
1115011668 14:28555614-28555636 ATCCTGTCATTTGCAAAACATGG + Intergenic
1115613078 14:35067337-35067359 ATTCTGTCATTTGTGCAACGTGG - Intronic
1115932780 14:38516103-38516125 ATTCTTTTATTTGTCTGACAGGG - Intergenic
1116153986 14:41179834-41179856 ACCCTGTAATTTGTGTAAGATGG + Intergenic
1117023758 14:51598704-51598726 ATAATGTTATTTGAGAAACATGG - Intronic
1117201649 14:53395829-53395851 ATCCTGTTATCTTTGTAAGCAGG - Intergenic
1117842464 14:59873980-59874002 ATCCTGTCATTTGCACAACATGG - Intergenic
1118195322 14:63620269-63620291 ATCCTGTCATTTGTGAAACAGGG + Intronic
1120509472 14:85396206-85396228 AGCATTTTATGTGTGTAACATGG - Intergenic
1120808546 14:88778863-88778885 ATCCTGTTATATGCTTAAAAGGG - Intronic
1125106865 15:35981769-35981791 TATCTGGTATTTGTGTAACATGG + Intergenic
1127870273 15:63067099-63067121 CTCCTGTTTTTTTTTTAACATGG + Intronic
1128084205 15:64874749-64874771 ATCCTGTTATTCGGTTAACTTGG - Intronic
1129555155 15:76500617-76500639 ATCTTCTTATTTACGTAACATGG + Intronic
1129565771 15:76621674-76621696 ATCATGTTATGTCTGTAATAAGG - Intronic
1133515821 16:6507654-6507676 ATCCTGTTATATGTCCAACATGG + Intronic
1135740252 16:24969204-24969226 AACATGATATTTATGTAACAGGG - Intronic
1140002761 16:71041774-71041796 ATAATGTTACTTGTGTAACAAGG + Intronic
1140143165 16:72279038-72279060 CTGCTCTTGTTTGTGTAACATGG + Intergenic
1140156287 16:72430058-72430080 ATCCAGGTATTTGTGAAAGATGG + Intergenic
1142318575 16:89366016-89366038 ATCATGTCTTTTGTGGAACATGG - Intronic
1143865569 17:9920527-9920549 AGACTGTGATTTGTGTAGCAAGG - Intronic
1144718559 17:17451479-17451501 TTCCTATTAATTGTGTAACTTGG - Intergenic
1145225633 17:21125885-21125907 ATGCTATTGTTTGTGTAACAAGG + Intronic
1146887811 17:36484058-36484080 GTCCTGTGATGTGTGTACCAAGG - Intergenic
1149742293 17:59058212-59058234 ATTATGTTTTTTGTGCAACATGG + Intronic
1150598633 17:66629961-66629983 ATGCTGTTATTTGAGTAAGCTGG + Intronic
1150736836 17:67747928-67747950 ATCCTGGTATTTGTGTTTCTGGG - Intergenic
1151586943 17:75014893-75014915 ATCCTGTATTTTGTTTATCATGG - Intronic
1152950030 17:83224089-83224111 AGCCTGTTATTTGTACAAGATGG - Intergenic
1153837248 18:8974971-8974993 ATCCTGTCATTTGCAAAACATGG + Intergenic
1154461016 18:14586248-14586270 ATCCTGTTATTTGCAAAGCATGG + Intergenic
1155375785 18:25155814-25155836 ATCCTGCCATTTGTACAACATGG + Intronic
1156163557 18:34389848-34389870 ATTCTGTCATTTGTGACACATGG - Intergenic
1163215100 19:15870804-15870826 AGACTGTTATTTGTGTATCTTGG - Intergenic
1164326482 19:24197048-24197070 ATCCTGTTATCTTTGTAAGCTGG - Intergenic
1166332461 19:42086897-42086919 CTCCTTTTGTTTGTTTAACAAGG + Intronic
926069970 2:9879538-9879560 ATCCTCTTTTTTGTGTTGCATGG - Intronic
926453620 2:13037879-13037901 ATTTTCTTATTTGTGTCACAAGG + Intergenic
927767428 2:25824658-25824680 ATACTGTTATTTGTAAACCACGG - Intronic
928250626 2:29674852-29674874 ATCCTGTTATTTGTCTATTCAGG + Intronic
928634148 2:33225888-33225910 ATCCTGTCATTTGTGTAACATGG - Intronic
930446811 2:51483872-51483894 ATACTATTATTTGTGTTACTTGG - Intergenic
930679836 2:54245188-54245210 ATCCTGTGATTCCTGCAACATGG - Intronic
932174009 2:69583079-69583101 AGCTTGTTATTTGTGGAACTTGG - Intronic
932877966 2:75473291-75473313 GTCCTGTGCTTTGTGTAACGTGG + Intronic
935847692 2:107184706-107184728 ATCCTGTTATTGGTGATACAGGG - Intergenic
938310670 2:130286466-130286488 TTCTTGTTCTTTGTGTCACAGGG + Intergenic
939488173 2:142843210-142843232 ACCCTGTTATTTATTTAACAGGG - Intergenic
940526834 2:154826414-154826436 TTCCTGTTACTTGTATAAAATGG + Intronic
941556302 2:166986705-166986727 ATCCTGTTAAATGTTTATCAGGG + Intronic
943495363 2:188613335-188613357 ATCTTGTCATTTGGGCAACATGG - Intergenic
943572473 2:189589996-189590018 ATCCTGTCATTTGAGCAATATGG - Intergenic
943660122 2:190550539-190550561 ATCCTGTTGTGTGTGTAACGTGG - Intergenic
945939629 2:215935109-215935131 ATCCTGTCATTTGCACAACATGG - Intergenic
946705014 2:222449786-222449808 AGCCAGTTATGTGTGTACCAAGG + Intronic
947145804 2:227063975-227063997 ATGCTTTTATTTGTTTAACAAGG + Intronic
1170767583 20:19303956-19303978 CTCCTGGTTTTTGTGAAACACGG - Intronic
1170966612 20:21078154-21078176 TTCCTTTTATCTGAGTAACAAGG - Intergenic
1171126375 20:22605445-22605467 ATCCTGTTTCTTTTTTAACAGGG + Intergenic
1171752123 20:29061957-29061979 ATCCTGTGATTTTTTTTACATGG - Intergenic
1173052704 20:39579868-39579890 ATCCTATTATTTGCCTAACAGGG - Intergenic
1174164865 20:48577456-48577478 AACCTGTCATTTGGGTCACATGG - Intergenic
1176208266 20:63902979-63903001 ATCCTGTTTTTTTTACAACAGGG + Intronic
1176813486 21:13571592-13571614 ATCCTGTTATTTGCAAAGCATGG - Intergenic
1176994475 21:15539188-15539210 ATTCTGCAATTTGTGTAAGACGG + Intergenic
1178249486 21:30988441-30988463 ATCCAGAGATTTGTGTCACATGG + Intergenic
1182664355 22:31946114-31946136 ACCCAGTTATGTGTGTAACAAGG - Intronic
1182991611 22:34773101-34773123 ATCCTGTTATTTGTGAACACAGG + Intergenic
949107257 3:215246-215268 ATCCTGTCATTGTGGTAACATGG + Intronic
949132159 3:516485-516507 ATCCCTTTATTAATGTAACACGG + Intergenic
949211812 3:1512040-1512062 ATCCTGTGATTTGTACAACCAGG + Intergenic
949329490 3:2906022-2906044 ATCCTGTCATTTGTGACAAAAGG + Intronic
949750290 3:7344607-7344629 AGCCTGTTATTCGTGCAACATGG + Intronic
950269346 3:11601171-11601193 GTTTTGTTATTTGTGAAACACGG - Intronic
952619187 3:35315551-35315573 GTTTTGTTATTTGTATAACAAGG - Intergenic
955616837 3:60818154-60818176 TTCCTATTATTTGTGGAGCATGG + Intronic
955675217 3:61441246-61441268 ATCCTGTTATTTCTCTCATAGGG - Intergenic
957047188 3:75385143-75385165 CTCCTCTTATTTTTCTAACAGGG - Intergenic
957482731 3:80819352-80819374 ATCATGTCCTTTGTGCAACATGG + Intergenic
958695135 3:97517900-97517922 ATTCTGTTACTTGTGCAACAGGG - Intronic
958745038 3:98123884-98123906 ATCCTGTAATTTTGGCAACATGG + Intergenic
959466543 3:106694242-106694264 TTCCTGTTATGTCTGTAAGAAGG - Intergenic
960704655 3:120470240-120470262 ATACTGTGATTTTTGTCACAGGG - Intergenic
963416687 3:145004365-145004387 ATCCTCTCATTTGTGTGACATGG - Intergenic
963593764 3:147299067-147299089 ATCCTGCTATATGGGGAACAAGG + Intergenic
964558701 3:157968876-157968898 ATCCTGATATTTGTGAAACTGGG - Intergenic
965190592 3:165523012-165523034 ATTTTGTTATTTGTGTTAAAGGG + Intergenic
965738003 3:171842377-171842399 ATCCTTTTATTTCAGTAAAAAGG + Intergenic
966117835 3:176486203-176486225 ATCCTGTTTTTTTTTTAAGAAGG - Intergenic
969823861 4:9741258-9741280 CTCCTCTTATTTTTCTAACAGGG + Intergenic
970764358 4:19529582-19529604 ATCCTGTTATTTGTGCAACATGG + Intergenic
975456917 4:74602439-74602461 GTCCTCTTATTAGTGTTACATGG + Intergenic
975511776 4:75201660-75201682 AACCTGTTATTTGTGTATTCAGG + Intergenic
976675691 4:87700272-87700294 ATCATGTTATCTGACTAACATGG - Intergenic
977665762 4:99645648-99645670 TTTCTGTTATTTGAGGAACATGG - Intronic
981032687 4:140141371-140141393 ATCCAGTCATCTGTGTAACATGG - Intronic
982457669 4:155629387-155629409 ATGCTGTCATTTGTACAACAAGG + Intergenic
982702218 4:158670435-158670457 TTACTGCTATTTGGGTAACATGG + Intronic
984623295 4:181977417-181977439 ATCCTGTTTCTAGTGTATCACGG + Intergenic
985829604 5:2218632-2218654 ATCCAGATATTTGTCTAAGAAGG - Intergenic
987403795 5:17504394-17504416 ATCTTGTCATTTGTGACACATGG - Intergenic
987404227 5:17508743-17508765 ATCTTGTCATTTGTGACACATGG - Intergenic
987411262 5:17617139-17617161 ATCTTGTCATTTGTGACACATGG - Intergenic
987411831 5:17622456-17622478 ATCTTGTCATTTGTGACACATGG - Intergenic
989520903 5:42398750-42398772 AACCTATTCTGTGTGTAACATGG - Intergenic
990643909 5:57822042-57822064 ATCCTGTTACCTCTGTAACTGGG + Intergenic
991446039 5:66700874-66700896 GTCCTTTTATTTGTATAAAATGG + Intronic
991662439 5:68963623-68963645 ACACTGTCATTTGTGTAAGAAGG + Intergenic
992259808 5:74958383-74958405 ATATGGTTCTTTGTGTAACATGG - Intergenic
992515709 5:77490726-77490748 ATCATGTTATTTGCTTAACCAGG - Intronic
992792585 5:80226850-80226872 ATCCTCTTACTTGTGAAAAATGG - Intronic
994923156 5:106078581-106078603 ATACTGTGATTTGTGTTGCAAGG - Intergenic
995906582 5:117131318-117131340 AGCCTGTCTTTTATGTAACAAGG + Intergenic
997742181 5:136265728-136265750 TTCTTGTTATTTGTGTAAGTGGG - Intronic
998656117 5:144181617-144181639 ATTCTGCCATTTGTGCAACATGG + Intronic
999192840 5:149761660-149761682 ATTCTGTCATTTGTGTAGCATGG + Intronic
999720932 5:154398734-154398756 ATTCTCTCATTTGTGGAACAGGG - Intronic
1000023725 5:157340995-157341017 CTCCTGTTATCTGTGTCCCATGG + Intronic
1000738130 5:164931128-164931150 ATCCTGTTATTGGTGTATTCAGG + Intergenic
1000841435 5:166223684-166223706 ATATTGTAAATTGTGTAACATGG + Intergenic
1001178896 5:169499786-169499808 ATCATGTCCTTTGTGCAACATGG - Intergenic
1002744262 5:181457901-181457923 AGCCTGTTATTTGTACAAGATGG - Intergenic
1004784442 6:18950951-18950973 ATCCTGTCATTTGTGCAACATGG + Intergenic
1005178551 6:23076341-23076363 ATTCTGTCATTTGTGCAACATGG + Intergenic
1008390276 6:50942581-50942603 ATCTTATTAATTGTGTAATAAGG + Intergenic
1010939152 6:81895610-81895632 ATTCTGTTATTAGTGAATCAGGG + Intergenic
1011196123 6:84781103-84781125 ATCTTGTTATTGGTTTGACAAGG + Intergenic
1011312736 6:85998497-85998519 ATCCTGTTTTTTTTTTAACAGGG - Intergenic
1011326869 6:86158095-86158117 ATCATGTCCTTTGTATAACATGG + Intergenic
1012160767 6:95882536-95882558 TTCATGTTACATGTGTAACAGGG - Intergenic
1013779410 6:113713499-113713521 ATCCCTTTTTTTGTTTAACATGG - Intergenic
1014012777 6:116495321-116495343 ATCCTGTCATTTGCAAAACATGG - Intronic
1015249976 6:131116964-131116986 ATCGTTTTATTTGTGTCACCAGG - Intergenic
1016633836 6:146264842-146264864 ATCATGTCTTTTGTGCAACATGG - Intronic
1016842320 6:148536791-148536813 ATCCTGAGATTTTTGTACCAAGG + Intronic
1017284690 6:152660921-152660943 ATCTTTTTATTTGTTTAATATGG + Intergenic
1017678790 6:156842710-156842732 ATCCTGTTTCTAGTGTAAAATGG - Intronic
1018223177 6:161601937-161601959 AAACTGTTATTTTTTTAACAGGG + Intronic
1018531614 6:164769943-164769965 ATCCTGGTATTTATGTAAGATGG - Intergenic
1019249178 6:170731455-170731477 AGCCTGTTATTTGTACAAGACGG - Intergenic
1020314320 7:6894152-6894174 CTCCTCTTATTTTTCTAACAGGG - Intergenic
1022937640 7:35196195-35196217 ATACTGTTAGTTGAGTAGCACGG + Intergenic
1024432974 7:49312002-49312024 AACCTGTTATTTTAGTAACTGGG - Intergenic
1024908429 7:54416694-54416716 ATCCTATTATTTGAGCAACAGGG + Intergenic
1025245837 7:57316531-57316553 ATCCTATTTTTTGTTCAACATGG - Intergenic
1027175867 7:75903038-75903060 ATCCTGTAATCTCTGTTACAGGG + Intronic
1027649894 7:80853451-80853473 ATCCTGTCATTTGCACAACATGG + Intronic
1028047334 7:86139144-86139166 TTCCTATCATTTATGTAACATGG + Intergenic
1028247061 7:88492297-88492319 TTCATTTTATTTGAGTAACATGG - Intergenic
1028990371 7:97043031-97043053 TTCGTCTTATTTTTGTAACAGGG + Intergenic
1030122752 7:106126339-106126361 AACATGTTATGTGTGTAAAATGG + Intergenic
1030672702 7:112354474-112354496 ATCCTGTTATTGTGGCAACATGG - Intergenic
1031180138 7:118403728-118403750 ACCCTGTCATTTGTGCAACATGG - Intergenic
1031241990 7:119257654-119257676 ATTCTGTTAGTTGAGTAAAATGG - Intergenic
1031989582 7:128189036-128189058 ATCCTGTTTGTTTTGTGACAGGG - Intergenic
1032661641 7:133990423-133990445 ATCCTGTCATTCGAGCAACATGG - Intronic
1033784179 7:144710498-144710520 ATCCTTTTACTTTTTTAACATGG + Intronic
1033800128 7:144891335-144891357 TTCCTGTTATTTATGTCACCTGG + Intergenic
1033971956 7:147052450-147052472 ATTCTTTTATTGGTGGAACAGGG + Intronic
1035498923 8:76205-76227 AGCCTGTTATTTGTACAAGATGG + Intronic
1035706174 8:1677065-1677087 TTAGTGTTATTTTTGTAACAAGG + Intronic
1037220331 8:16511684-16511706 ATCCTGTTACTATTGTCACAAGG + Intronic
1037600340 8:20388623-20388645 ATACTGTTCTTTGTGGAGCAGGG + Intergenic
1039598642 8:38814086-38814108 AATCTGTTATTTGTGTCACTTGG + Intronic
1039622855 8:39015573-39015595 ATACTGTGATTTTTTTAACATGG + Intronic
1039656558 8:39415244-39415266 ATCCTGTAATGTGTAAAACATGG + Intergenic
1039678016 8:39691663-39691685 ATCATGTTATTTGCAGAACATGG + Intronic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1044933620 8:97273735-97273757 ATCTTTTTTTCTGTGTAACATGG - Exonic
1045577447 8:103440162-103440184 AACATGTTATCTGTGTAAAATGG + Exonic
1045582190 8:103494105-103494127 ATTCTGTTATTTGTGTCTCCAGG + Intergenic
1046204015 8:110965632-110965654 CTCGTATTATTTGTGTAACATGG - Intergenic
1046775220 8:118157373-118157395 ATCCTGGTATTGGTGTTCCATGG - Intergenic
1049084317 8:140466083-140466105 ACCCTGTTATTTCTGTGACCAGG + Intergenic
1049834489 8:144725847-144725869 ATCCTGTCATATATGTAACAAGG + Intronic
1050099164 9:2099981-2100003 ATCCTGTTAATTTTGCCACAGGG + Intronic
1051324910 9:15955440-15955462 ATCCTGATATTTGGAGAACAAGG + Intronic
1051783630 9:20718326-20718348 CACCTGCTATTTGTGTAAGATGG - Intronic
1053095413 9:35323083-35323105 ATCTTATTATTTGTGTCTCATGG + Intronic
1054899331 9:70351505-70351527 ATCCTGAAAAGTGTGTAACAGGG - Intronic
1055140270 9:72869103-72869125 ATCCTTTTATTTATGTAAATAGG + Intergenic
1055348721 9:75363008-75363030 ATCCTGTTATCTTTGTAAGCTGG - Intergenic
1056514043 9:87333401-87333423 ATTCTTTTTTTTGTGTGACAAGG - Intergenic
1056567869 9:87790769-87790791 ATCCTGTCATTTGCGTGAAATGG + Intergenic
1057980405 9:99655848-99655870 ATCATGTCATTTGTGCAACATGG + Intergenic
1058276759 9:103052012-103052034 ATCTTGTCATTTGTGAAACATGG + Intergenic
1058406461 9:104681052-104681074 ATCCTGTCATTTGCACAACATGG + Intergenic
1058707975 9:107653035-107653057 ATACTGTTATTTGGCGAACAGGG + Intergenic
1059003350 9:110374296-110374318 ATCATGTTCTTTGTGGAATATGG - Intronic
1062369148 9:136228081-136228103 CTCCTGGCATTTCTGTAACAGGG + Intronic
1203490856 Un_GL000224v1:103170-103192 GTCCTGTTTTCTGTGTAATAAGG + Intergenic
1203503480 Un_KI270741v1:45048-45070 GTCCTGTTTTCTGTGTAATAAGG + Intergenic
1203610074 Un_KI270748v1:88394-88416 AGCCTGTTATTTGTACAAGATGG - Intergenic
1185732179 X:2470080-2470102 ATCCTGCCATTTGCGCAACATGG + Intronic
1186927159 X:14346789-14346811 ATCATGTCATTTGTAAAACATGG - Intergenic
1187458400 X:19463456-19463478 TTCCTGTAAGTTGTGTCACAAGG - Intronic
1188346343 X:29070909-29070931 ACCCTGTTTTTTGTGCAATATGG - Intronic
1188419143 X:29975187-29975209 ATCCTGTCATTTGAACAACATGG - Intergenic
1188429839 X:30094017-30094039 ACCATGTTACTTGTCTAACATGG + Intergenic
1188656955 X:32709308-32709330 ATCATCATATTTGTGTTACATGG - Intronic
1188920081 X:35963012-35963034 ATCTTGTCATTTGCGAAACATGG + Intronic
1189115230 X:38335385-38335407 TTCCTATTATTTGTGTTTCATGG + Intronic
1190459286 X:50655422-50655444 ATCCTGTCATTTGTACAACATGG - Intronic
1190512560 X:51188625-51188647 ATCCTGTCATTTGTGGCAAATGG + Intergenic
1192874529 X:75214337-75214359 ATCCTGCCATTTGTGAAATATGG + Intergenic
1193143272 X:78051926-78051948 ATCCTGTCATTTGAGAAAGATGG - Intergenic
1193262195 X:79421319-79421341 TTTCTGTTATTTTTTTAACATGG + Intergenic
1193335853 X:80288023-80288045 ATCCTGTCATTTGCTCAACATGG + Intergenic
1194039072 X:88917389-88917411 TTCCTGTTATTTGTTTTTCAGGG - Intergenic
1194166110 X:90519182-90519204 ATCCAGTCATTTGTGAAACATGG + Intergenic
1194225455 X:91250914-91250936 ATTCTGTTATTTCCGTCACAAGG + Intergenic
1194401865 X:93447233-93447255 CTATTTTTATTTGTGTAACATGG - Intergenic
1194899700 X:99495602-99495624 ATTCTGTTCTTTGTGGTACAAGG - Intergenic
1194971515 X:100349074-100349096 ATCATGTTATCTGTTTAACCTGG + Intronic
1195196866 X:102506276-102506298 ATCTTTTTATTATTGTAACAGGG + Intergenic
1195519935 X:105819496-105819518 ATCCTGTTATTTCTGTTAGGAGG + Intergenic
1198175703 X:134152350-134152372 ATCTGCTTATTTGTCTAACAGGG + Intergenic
1198210838 X:134514388-134514410 ATGCTACTATTTGTGTTACAAGG - Intronic
1198439128 X:136644780-136644802 TTCATGTTATTTGTGTGCCAAGG - Intergenic
1199916480 X:152347173-152347195 ATCCTGTCATTTGCAAAACATGG + Intronic
1200512380 Y:4096947-4096969 ATCCAGTCATTTGTGAAACATGG + Intergenic
1200561994 Y:4715823-4715845 ATTCTGTTATTTCCGTCACAAGG + Intergenic
1200665604 Y:6018338-6018360 ATTCTGTGTTTTGTGAAACATGG - Intergenic