ID: 1087523016

View in Genome Browser
Species Human (GRCh38)
Location 11:99267546-99267568
Sequence AAGTATCAATTAAACTAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 273}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087523016 Original CRISPR AAGTATCAATTAAACTAACA AGG (reversed) Intronic
905842588 1:41195989-41196011 AGGAATAAATTTAACTAACACGG + Intronic
906133093 1:43473364-43473386 ATGTATTAATAAAACTAACAAGG - Intergenic
907582828 1:55587308-55587330 AAGAATGAATAAAACTATCATGG - Intergenic
908927408 1:69272673-69272695 AAGTTTCAATTAAACAGCCAAGG - Intergenic
909627129 1:77730106-77730128 AAATATCACTTAAAATATCAAGG - Intronic
910552706 1:88494698-88494720 AGGTACCAATTTAACTAAGATGG + Intergenic
911119325 1:94279620-94279642 AAGTATGCATTCAACCAACATGG - Intergenic
911466181 1:98255875-98255897 AATTAACAATTAAACTAAAGAGG + Intergenic
911668280 1:100580101-100580123 AATTATAAATTAAAACAACAAGG + Intergenic
913341478 1:117761863-117761885 AAATATCAATGAAACTAAGTTGG - Intergenic
913342599 1:117773688-117773710 AAGTATCAATCAGACTAAGTTGG - Intergenic
915023902 1:152808147-152808169 AACTGTCAATTAATCTGACATGG + Intronic
915794954 1:158720292-158720314 AGGTATCAAATAAATTAACTTGG + Intergenic
916319767 1:163491141-163491163 AAATATAAAATAAAATAACAGGG - Intergenic
917023949 1:170621219-170621241 AAGTAAAAATTTAAATAACAAGG + Intergenic
918255870 1:182746560-182746582 AAGTATCACTTGAACTCAAAAGG + Intergenic
918727952 1:187949513-187949535 AAAGATCAATAAAATTAACATGG + Intergenic
922121616 1:222675107-222675129 TAGTACCAATTAAAATAAAAAGG - Intronic
922928193 1:229368082-229368104 AAGTGTCAAGTACACTAATATGG - Intergenic
923828647 1:237528550-237528572 AAGTATGAATTCAACTCACACGG - Intronic
924484476 1:244467388-244467410 AAGTGTGAATTAAAATTACAGGG + Intronic
1063837282 10:10030021-10030043 AAATACAAATTAAAATAACAGGG + Intergenic
1063895098 10:10671650-10671672 AAACATAAATTAAACCAACAAGG - Intergenic
1065194074 10:23244625-23244647 AGGTATAAATTTAACCAACAAGG + Intergenic
1066189112 10:33039255-33039277 AAGTATCAATGAAACAAACAAGG + Intergenic
1066707159 10:38192971-38192993 AAGTATAATTTAAAAAAACATGG + Intergenic
1066821579 10:39498800-39498822 ATGTATGCATTAAACTCACAGGG + Intergenic
1068397853 10:56487424-56487446 ACCTATCAATATAACTAACAAGG - Intergenic
1068470382 10:57454305-57454327 AAATACCAATTAAAATATCATGG + Intergenic
1071544012 10:86514101-86514123 AAATTTCAATTAAAATTACAAGG + Intronic
1073336275 10:102712623-102712645 AATTATAAATTAAACAATCATGG + Intronic
1074053625 10:109902371-109902393 AAGTGTCAATTAAACTTTCTGGG - Intronic
1074295270 10:112181825-112181847 AGGTACCATTTAAATTAACAAGG + Intronic
1078379448 11:10827080-10827102 AAATCTCAAATACACTAACAAGG + Intronic
1079523835 11:21361374-21361396 AAGTATCAGTTAACCTATAAAGG - Intronic
1079610321 11:22425150-22425172 ATTTTTCAATTAAACCAACAGGG - Intergenic
1079911863 11:26319720-26319742 AAATATAAGTTAAAATAACAAGG - Intronic
1080358385 11:31480981-31481003 AATTATAAATTACACAAACATGG + Intronic
1081219379 11:40441015-40441037 AAGTATCAAATAAACTAAGCAGG + Intronic
1081275022 11:41137697-41137719 AAATATAAATAAAACAAACAAGG + Intronic
1081960912 11:47136574-47136596 AAGCATCAACCAAACTAACGGGG + Intronic
1082221945 11:49649231-49649253 AAGTATTAATTAAAGTAGCAGGG + Intergenic
1087523016 11:99267546-99267568 AAGTATCAATTAAACTAACAAGG - Intronic
1087666856 11:101059530-101059552 AAGTCTCTATTAAAGTAAAAGGG + Intronic
1088085994 11:105981160-105981182 ATGTATGAATTAAACTAACATGG + Exonic
1088388376 11:109285534-109285556 AAGTAATGAGTAAACTAACAAGG + Intergenic
1089993637 11:122884050-122884072 AAGCAACAATTAAAATAATAAGG + Intronic
1090144864 11:124310796-124310818 AAGTATGAATTACCTTAACATGG + Exonic
1090427676 11:126620235-126620257 AAGGATCAATTCAAAGAACAAGG - Intronic
1092340250 12:7669816-7669838 AAGTATGATTGTAACTAACAGGG - Intergenic
1092664095 12:10775023-10775045 AACAATAAATAAAACTAACATGG - Intergenic
1093170227 12:15852089-15852111 AAGTATCAATTTAAATACCCAGG + Intronic
1094409350 12:30152248-30152270 AAGTATTAATCAATCTCACAGGG + Intergenic
1095509563 12:42935736-42935758 AAGAATCAATTAAATAACCATGG + Intergenic
1097490231 12:60259064-60259086 AAGTAGCCATTAAAGAAACAAGG + Intergenic
1097590556 12:61569378-61569400 AAGTGTCACTTAGACTATCATGG - Intergenic
1098784863 12:74739906-74739928 AGGTATAAATTAAACTAAGGAGG - Intergenic
1099193830 12:79590933-79590955 AATTATTAAATAAACTAAAAGGG + Exonic
1100078321 12:90816132-90816154 AATTACCAATTAAACTATTATGG + Intergenic
1100187371 12:92152550-92152572 AGGTATCAATAAAAATAACCTGG + Intergenic
1102377667 12:112436101-112436123 AAGAATAAATAAAACAAACATGG + Intronic
1102845768 12:116180809-116180831 AAGTATCAATTAAATCTAAATGG + Intronic
1105395342 13:20028460-20028482 AAGTTTCAATTAAATGAAAAGGG - Intronic
1105757312 13:23479124-23479146 AAGTCTCAATAAAACTAAAAGGG - Intergenic
1106982010 13:35297171-35297193 AAGTATTAATGAAACCAACATGG + Intronic
1107002045 13:35559322-35559344 CAGTATCACTTTAACGAACACGG + Intronic
1107031557 13:35859171-35859193 TGGGAACAATTAAACTAACACGG + Intronic
1108164922 13:47682809-47682831 AAATAGCAACTAAACTGACAAGG + Intergenic
1108722405 13:53145603-53145625 AAGAATCAATTGAACTCAGAAGG + Intergenic
1109004756 13:56858026-56858048 ACTTATAAATTAAACTAAAAGGG - Intergenic
1109732514 13:66433873-66433895 GAGTATTAATTAAACTTTCAAGG + Intronic
1109885762 13:68542118-68542140 AACTATCAATTTAAGTAATAGGG - Intergenic
1110011185 13:70336107-70336129 AAGTAGCAATTCAACTACCAAGG + Intergenic
1111622793 13:90746183-90746205 ATAGATCAATTAAACTTACATGG + Intergenic
1111848157 13:93537853-93537875 AAGTAACAATTACATTAATATGG - Intronic
1112808941 13:103195075-103195097 CAGTATTGATTAAACTTACAAGG + Intergenic
1114941023 14:27610966-27610988 AAGTATAAATAAAACTAAATGGG + Intergenic
1116282751 14:42929226-42929248 AAGGGACAATTAAGCTAACAGGG - Intergenic
1119992373 14:79213498-79213520 AAGAAACAATTAAAAGAACAAGG + Intronic
1120367301 14:83587621-83587643 GACTAACAGTTAAACTAACAGGG + Intergenic
1120372442 14:83653546-83653568 ATCTATCAATTAAAATAAAATGG + Intergenic
1121905323 14:97736401-97736423 AAGTATCTGTTAAAGTAAAATGG - Intergenic
1122558602 14:102594622-102594644 AACTATCAAAAACACTAACATGG - Intronic
1123831537 15:24144329-24144351 AAGGCTCAATTAAGTTAACAGGG - Intergenic
1123845741 15:24300139-24300161 AAGGCTCAATTAAGTTAACAGGG - Intergenic
1124806367 15:32887520-32887542 AAATGTAAATTAAACTAAAATGG + Intronic
1124884127 15:33668570-33668592 AAGCATAAATTAAAGCAACAGGG + Intronic
1124939706 15:34206929-34206951 AAGCACCAAATTAACTAACATGG + Intronic
1126876037 15:53042357-53042379 AAGAATAAATTTAACTAAAAAGG + Intergenic
1129805896 15:78457462-78457484 AACTATCAATTAATCAAGCAAGG - Intronic
1130003739 15:80072492-80072514 AATTATCAGTTTCACTAACAGGG + Intronic
1135644337 16:24148205-24148227 AAGTATCAATAGGACTAGCAAGG - Intronic
1140592893 16:76374468-76374490 ATGAATTAATTAAACTCACAGGG + Intronic
1147735451 17:42634743-42634765 AAATATCAATTAAATCAAAATGG + Intergenic
1148360567 17:47009284-47009306 AGTTATAAATTAAACTAACAGGG - Intronic
1148498439 17:48069885-48069907 AAGTATTTACTAAATTAACATGG + Intergenic
1149579609 17:57740322-57740344 AAGTATCAATTAAATAGACAAGG + Intergenic
1149868774 17:60164934-60164956 AAAAATGAATTAAACTACCAAGG - Intronic
1150785987 17:68162854-68162876 AATTATAAATTAAACTAACAGGG + Intergenic
1150887252 17:69101504-69101526 AAGAATCACTTAAACTCAGAAGG + Intronic
1203187109 17_KI270729v1_random:135138-135160 AATTATCAAATAAACTCAAATGG - Intergenic
1153454579 18:5266227-5266249 AAGAATCAATTTCACTAAAATGG + Intergenic
1153587679 18:6640162-6640184 AAGCAACAATTATAGTAACATGG - Intergenic
1155387817 18:25299798-25299820 TAAGATCAATTAAACTTACATGG + Intronic
1155680579 18:28481399-28481421 AAGGATCAACTAAACCAAAATGG + Intergenic
1156012933 18:32514890-32514912 GAGTATTAATGACACTAACATGG + Intergenic
1156073411 18:33241643-33241665 AAGAATGAATTTAACTAACGAGG + Intronic
1156289772 18:35736451-35736473 AAGAATCAATGAAACCAAAATGG - Intergenic
1156601469 18:38612088-38612110 TTGTATCAATTTAACTTACAAGG + Intergenic
1156669998 18:39457029-39457051 AAGAATCAATTAAACTAGGGTGG + Intergenic
1157012757 18:43671159-43671181 AAAGATCAATTTAACCAACAAGG + Intergenic
1158842921 18:61407503-61407525 AGGCATGAATTAAAGTAACAGGG + Intronic
1159116722 18:64122905-64122927 AAGTATATATTTAACTAAGAAGG - Intergenic
1163894171 19:20042694-20042716 AAATATCAATGAAACAAAAATGG - Intergenic
1165968712 19:39606845-39606867 AAGTATGCATTCAACGAACATGG + Intronic
927364469 2:22277811-22277833 AAGTATGAATTATAGTAAAAGGG - Intergenic
927412038 2:22837716-22837738 AAGTATTAGCTAAACTAAGAGGG + Intergenic
928349309 2:30534033-30534055 AAGTATAAATGTAATTAACAAGG - Intronic
928702359 2:33911763-33911785 AAGTAAAAATTAAAATAACTAGG + Intergenic
930020971 2:47001982-47002004 AAGTATCCATGAAGCAAACATGG - Intronic
930269549 2:49240268-49240290 AAATATCAATGAGAATAACAGGG - Intergenic
930573458 2:53115548-53115570 AGATATGAATTAAACTACCAAGG - Intergenic
930852390 2:55974843-55974865 AAGCAGCAGTTAAAATAACATGG - Intergenic
931710219 2:64982897-64982919 AAGTAACAATTATATTAAAAAGG - Intergenic
933533711 2:83544358-83544380 AAGTATCATTTAGACTCACATGG + Intergenic
936861208 2:117022687-117022709 AAGTAACAGTTAAACTTACAAGG - Intergenic
938674701 2:133619855-133619877 AAGCATCAAGTAACCTAAAAAGG + Intergenic
939635606 2:144579099-144579121 AAATATGAATTAAGATAACATGG - Intergenic
939636420 2:144588203-144588225 AAGTATCACTTAAGCTCAAAAGG - Intergenic
940956135 2:159729726-159729748 AAGTATAAATTTAACTAAACTGG + Intronic
941483774 2:166052588-166052610 AATTCTCGATAAAACTAACATGG + Intronic
942236311 2:173910685-173910707 AAATATGAATTAAAGCAACAGGG + Intronic
942356644 2:175121143-175121165 AACTAATAATTGAACTAACATGG - Intronic
943497431 2:188639686-188639708 AATTTTCTATTAAACTAACTTGG + Intergenic
945594508 2:211775089-211775111 GACTAACAATTAAACTTACAGGG + Intronic
946985567 2:225268435-225268457 TTTTATCAACTAAACTAACATGG - Intergenic
1169178075 20:3536604-3536626 AAATATCATTTGTACTAACATGG - Intronic
1171526312 20:25814221-25814243 ATGTATCAATAAAAATAAAAAGG - Intronic
1171550515 20:26041664-26041686 ATGTATCAATAAAAATAAAAAGG + Intergenic
1172368965 20:34372364-34372386 AAGTAGAACTTAAAATAACATGG - Intronic
1173084503 20:39902806-39902828 AAGGAGCAATTAATCTAACTAGG - Intergenic
1174717862 20:52779049-52779071 AAGTAACAATTAGACTGACATGG - Intergenic
1176694345 21:9957107-9957129 AAGTATCAAGTAACCTATAAAGG - Intergenic
1176930701 21:14806339-14806361 ACGTATAAATTTAACTAAGAAGG + Intergenic
1177333317 21:19690175-19690197 AAGTAGCAAGTAAATTATCAAGG - Intergenic
1177957443 21:27616960-27616982 AAATGTCAATTAGACTAACTTGG + Intergenic
1178933398 21:36839258-36839280 CAGTATCCACTAAACCAACACGG - Intronic
1181451781 22:23027390-23027412 AAGTAACTATTAAAATAAGAGGG + Intergenic
1184145298 22:42606901-42606923 AAGCATCAATTAAATAAGCATGG + Intronic
949196030 3:1308850-1308872 AATTACCAATTAAAACAACAAGG - Intronic
949970843 3:9402691-9402713 AAGTATACATGTAACTAACATGG - Intronic
951334224 3:21402103-21402125 AATGATCAATTAAACAAAAATGG + Intergenic
952299905 3:32095762-32095784 AAGAAACAAGTAAACAAACAAGG - Intergenic
952598726 3:35052200-35052222 AAGTATCAATTTTAATAAAAAGG - Intergenic
952733856 3:36668368-36668390 AGGTAGCAAGTAAACAAACAAGG + Intergenic
954549468 3:51468659-51468681 AAGTATCACAAAAACAAACAAGG + Intronic
957220363 3:77374682-77374704 AAGTATATTTTAAACCAACATGG - Intronic
958207200 3:90417713-90417735 ATGTATGCATTCAACTAACAGGG - Intergenic
958490351 3:94765044-94765066 AAGTACCAAGTAAACTATAAAGG - Intergenic
959653607 3:108775918-108775940 AATTATCATTTAAACCAATAGGG + Intergenic
960020121 3:112940579-112940601 AAATGTCAATTAAAATCACAAGG + Intronic
963385668 3:144590154-144590176 AAGTATCAATGAACCTAAAATGG - Intergenic
963456160 3:145550742-145550764 AAATATCAATCAAAGTAACTGGG + Intergenic
965332137 3:167388838-167388860 AATTATTAAATAAACAAACAAGG - Intergenic
965953437 3:174338562-174338584 AAGTATAATTTAAAAAAACAGGG - Intergenic
966256640 3:177924806-177924828 ATCTATCAATAAAACTAATATGG - Intergenic
967642071 3:191876854-191876876 AAGTAAAAAATAAACTAAAAAGG - Intergenic
969069843 4:4527404-4527426 AAGTTTCCATTAAAGTAATAAGG - Intronic
971339130 4:25751749-25751771 AAGTATCAATTGAGCTATCTTGG + Intronic
971676837 4:29642327-29642349 AAGTCTAAATTAAAATAAAAGGG + Intergenic
971719108 4:30221896-30221918 AAGTATAAAGTAGACTAAGAAGG + Intergenic
972165440 4:36277968-36277990 AAGTAGCAAATAATCAAACAGGG - Intergenic
972868276 4:43261316-43261338 AAGTATCGAGAAAATTAACATGG + Intergenic
974556560 4:63458858-63458880 AACTAACAATTAATATAACATGG + Intergenic
976154328 4:82126266-82126288 AGGAATCAATGAAACTAACATGG + Intergenic
976780772 4:88756335-88756357 CAGTATCAAGTAAACAAAAAGGG - Intronic
977905852 4:102477025-102477047 AAGTATCAGGTAAACTATAAAGG + Intergenic
978176840 4:105742357-105742379 AAGTATAATTTCAACTAGCAAGG - Intronic
979495198 4:121375383-121375405 AAGTTTCCATTAGACTAAGAAGG - Intronic
980445238 4:132897457-132897479 CAATAGCAATTAAAATAACATGG + Intergenic
982912999 4:161168781-161168803 GAGTACCAATTACACCAACATGG + Intergenic
983483836 4:168310053-168310075 AAGTATCAATTTAACTAATTCGG - Intronic
983682403 4:170369011-170369033 AAGTAACAATTCAAAAAACAAGG + Intergenic
986834091 5:11615384-11615406 AAGTATAAATTCAATTAATAGGG - Intronic
986893216 5:12334252-12334274 AAGACTTAATTAAACTAAGAAGG - Intergenic
986931585 5:12830615-12830637 AAGCCTCAAATAAACAAACATGG - Intergenic
986980384 5:13441267-13441289 AAGAATGAATTACACTAAAAAGG + Intergenic
987511092 5:18840134-18840156 AAGTATCCATGAAGCTAGCATGG - Intergenic
987870191 5:23606970-23606992 AAGTATAAATTTTAATAACAAGG - Intergenic
988620787 5:32821517-32821539 GAGTTTCAATTTAAGTAACAGGG + Intergenic
990136923 5:52656692-52656714 AAAAATCAATTTAAATAACACGG + Intergenic
991153748 5:63404043-63404065 ATATATCAATTAAACTATCCTGG + Intergenic
991166504 5:63569574-63569596 AAGTATCAATTAGCCTTCCATGG + Intergenic
991195625 5:63929265-63929287 AAGAATTAAGAAAACTAACAAGG + Intergenic
991244382 5:64493829-64493851 ATGTAGCAATTAAAATATCATGG + Intergenic
991249691 5:64545926-64545948 AAGTATTAATGAAAGTAACCGGG + Intronic
992077233 5:73202797-73202819 AAGAATAAATTAAAATAAAAAGG + Intergenic
992468058 5:77026959-77026981 GAGTATCAATTAAAACAGCAAGG + Intergenic
993554375 5:89317326-89317348 AAGTTTCAATTCTACTAACCTGG + Intergenic
994343533 5:98660403-98660425 ATGTATCAATGAAGCTAAGAGGG + Intergenic
994553351 5:101263871-101263893 AAGTATAAATTAAAACCACAAGG + Intergenic
994641464 5:102414991-102415013 AGGAATATATTAAACTAACAAGG + Intronic
995965050 5:117895496-117895518 AAACATGAATTAAACTAATAAGG - Intergenic
996121219 5:119674541-119674563 AAGAATAAATTTAACTAAGAAGG - Intergenic
1000158904 5:158580550-158580572 AAGTATCATGTAAACTATAAAGG - Intergenic
1000471994 5:161654929-161654951 ACGTAGGAATTAAGCTAACAAGG + Intronic
1004553077 6:16668560-16668582 AAGTCACAAATAAACTAGCATGG - Intronic
1005010890 6:21334400-21334422 ACATAAGAATTAAACTAACATGG - Intergenic
1005390880 6:25331981-25332003 AAGAATCAATTAAAATAATAGGG + Intronic
1009234872 6:61110177-61110199 AAGTTTCAATTATAGGAACATGG + Intergenic
1009612869 6:65968995-65969017 AAATATCTATTAAAATAACATGG + Intergenic
1010859416 6:80888481-80888503 AAGAATCAATGGAACTAACTGGG - Intergenic
1012123124 6:95391787-95391809 AGGTAGTAATTAAACAAACAGGG - Intergenic
1012374805 6:98548530-98548552 AAGGATAAATTAAAGTGACAGGG - Intergenic
1012812504 6:103978305-103978327 AAGTATTTATTAAGCTAATATGG + Intergenic
1013831537 6:114278693-114278715 AAGTAGAAATTAAACAGACAGGG + Intronic
1013999817 6:116352320-116352342 AAGAATCAATTCAACTAAAATGG + Intronic
1014035655 6:116764943-116764965 AAGAGTCAATTAAGCTTACAGGG - Intronic
1014176416 6:118336191-118336213 AAGTAAGAGTTAAACTCACATGG + Intergenic
1014263150 6:119243541-119243563 AAGTATTAATAAACCCAACAAGG + Intronic
1015046709 6:128784999-128785021 AAGTATCAATTTAAATAAACAGG + Intergenic
1015073631 6:129128371-129128393 TAGTATTAATTAAAATAGCATGG - Intronic
1015205018 6:130627278-130627300 ACCTATCAATTAAACTGACAAGG + Intergenic
1015505027 6:133975955-133975977 AAGTGACATTTAAACTCACAAGG - Intronic
1015822145 6:137274103-137274125 AAGAATAAATAAAAATAACATGG - Intergenic
1018562305 6:165114293-165114315 AAGCATCAATTTAACTATAAGGG - Intergenic
1020479411 7:8639530-8639552 AAATGTCAATGAAAATAACAAGG - Intronic
1021947525 7:25743034-25743056 AAATATTAATTGAACTAACCTGG + Intergenic
1022815367 7:33908617-33908639 AAGTATCAATTAAATTCAGAAGG + Intronic
1023151147 7:37202709-37202731 AAGTATAAATTACAGTAAGAAGG - Intronic
1025091439 7:56067470-56067492 CTGTATCAATTAAAATAACATGG - Intronic
1025299347 7:57805703-57805725 ATGTATCAATAAAAATAAAAGGG + Intergenic
1025833883 7:65077942-65077964 CTGTATCAATTAAAGTAACATGG - Intergenic
1025903655 7:65767462-65767484 CTGTATCAATTAAAGTAACACGG - Intergenic
1026700654 7:72640878-72640900 AAGAGTAAATTAAACCAACAGGG + Intronic
1027794245 7:82672277-82672299 AAATATCAATTAAATTTGCAAGG - Intergenic
1028268828 7:88761367-88761389 ACTTAACAATTAAACTCACAGGG + Intronic
1028573764 7:92322239-92322261 AATTATAAATTAAAATAAGATGG - Intronic
1028708818 7:93883550-93883572 ATTTCTTAATTAAACTAACATGG + Intronic
1029431860 7:100536419-100536441 AAGTTTAAATTAAATTAAAATGG - Intergenic
1030941246 7:115652105-115652127 AAGTCTCATTTATTCTAACACGG - Intergenic
1030941318 7:115653574-115653596 AAGTTTCATTTATTCTAACATGG + Intergenic
1031130561 7:117828480-117828502 AAGTATCATTTGCAGTAACAGGG + Intronic
1031193238 7:118581965-118581987 AAGTATTCACTAAACTTACAAGG - Intergenic
1031556106 7:123178775-123178797 AAGTTCCAGTTAAACTTACAAGG + Intronic
1031675443 7:124605696-124605718 AACTATGAATTCAACCAACATGG - Intergenic
1031755972 7:125643205-125643227 ACGCACCAATTAAATTAACAAGG + Intergenic
1031994352 7:128219528-128219550 AAGCTTCAGTGAAACTAACAGGG - Intergenic
1031994486 7:128220463-128220485 AAGCTTCAGTGAAACTAACAGGG - Intergenic
1033998381 7:147381976-147381998 AAGTATAATTTAAAATAATATGG + Intronic
1037318977 8:17626442-17626464 AAGTACCAAGTTCACTAACACGG - Intronic
1038509946 8:28123517-28123539 AAATATCAGTTAAACCAAGATGG + Intronic
1038839112 8:31162741-31162763 AAGTATCCATTAGATTATCATGG - Intronic
1039597430 8:38803142-38803164 AACTATAAATGAAACCAACAAGG - Intronic
1040904749 8:52455775-52455797 AAATATCAATTAAAGAAAGATGG - Intronic
1041948032 8:63468928-63468950 AAGCATCAATCAACCTTACAGGG - Intergenic
1042705087 8:71658209-71658231 TAGTAACAATTAAATTAAAATGG - Intergenic
1043157387 8:76800616-76800638 AAGAAGCAATTAAACTGACAAGG - Intronic
1045147799 8:99367381-99367403 AAGAAACAAATAAACTTACAAGG - Intronic
1046164500 8:110414054-110414076 AAGTATCACTTAAATGAACTTGG - Intergenic
1047383673 8:124388185-124388207 TACTATCAATTTAACTTACAAGG - Intergenic
1051229043 9:14934766-14934788 AAGTATCCATTAGACCAACGTGG + Intergenic
1051312171 9:15787818-15787840 AAATACAAATTAAAGTAACAAGG - Intronic
1052069636 9:24066365-24066387 AACCAGCAATTAAACTAACATGG - Intergenic
1052178432 9:25494953-25494975 AAATATCAAATAAACTCAGAAGG + Intergenic
1053287145 9:36857065-36857087 AAGTGTCAAATAAACTCACTAGG + Intronic
1053380024 9:37641167-37641189 AAGTTTCCATAAAAATAACATGG - Intronic
1053697761 9:40652718-40652740 AAGCATCAATTAAACCAGCTGGG + Intergenic
1053794235 9:41710324-41710346 ATGTATCAATAAAAATAAAAAGG - Intergenic
1054150934 9:61604503-61604525 ATGTATCAATAAAAATAAAAAGG + Intergenic
1054182642 9:61922363-61922385 ATGTATCAATAAAAATAAAAAGG - Intergenic
1054309052 9:63452126-63452148 AAGCATCAATTAAACCAGCTGGG + Intergenic
1054440993 9:65260074-65260096 AAGCATCAATTAAACCAGCTGGG + Intergenic
1054470716 9:65535615-65535637 ATGTATCAATAAAAATAAAAAGG + Intergenic
1054489284 9:65761416-65761438 AAGCATCAATTAAACCAGCTGGG - Intergenic
1054655865 9:67666116-67666138 ATGTATCAATAAAAATAAAAAGG + Intergenic
1054914192 9:70480671-70480693 AAGTAACAATTGAACTACAAGGG + Intergenic
1055524704 9:77119707-77119729 AAGTCTTAAATAAATTAACATGG - Intergenic
1057145001 9:92752464-92752486 AAGTATAAAATAAACTTTCATGG + Intronic
1057766983 9:97929930-97929952 CAGTATCCATTGAAATAACAGGG + Intronic
1059040438 9:110809006-110809028 AAGCATCAATTGAAATAAGAAGG - Intergenic
1060581532 9:124751606-124751628 AAATATCAATTAAACCAAGTGGG + Intronic
1202780140 9_KI270717v1_random:26118-26140 AAGCATCAATTAAACCAGCTGGG + Intergenic
1185736288 X:2499395-2499417 AAGTATCATTTAACCTAACATGG + Intronic
1187545271 X:20245573-20245595 AAGTATCAATTAAAAAAATTGGG + Intronic
1188482474 X:30649686-30649708 AAGTAATCATTAAACTAGCAAGG + Intergenic
1193904820 X:87229172-87229194 AAATAACAATTAAGCAAACAAGG + Intergenic
1194211545 X:91075888-91075910 AAATGTCAATTAAAATTACAAGG + Intergenic
1194221330 X:91195796-91195818 AACTATCACTTAAAATAACTGGG + Intergenic
1194230036 X:91310283-91310305 AAGTATCAATACAAGTAAAATGG - Intergenic
1195809144 X:108811046-108811068 AGGTATCAATTCAAGTGACAGGG - Intergenic
1196254973 X:113506581-113506603 AAGGATCAATTAGACTTCCAAGG - Intergenic
1196334310 X:114513352-114513374 AGGTATTGATTAAACTAAGAGGG - Intergenic
1197158003 X:123291260-123291282 ATGTATCTATTAAGATAACAAGG + Intronic
1197296547 X:124725860-124725882 AAGTATCTATTAACTTGACATGG + Intronic
1198943135 X:141980921-141980943 AAGTATCAGGTAAACTATAAAGG - Intergenic
1199885632 X:152019183-152019205 AGGTAGCAATTAAACATACAAGG + Intergenic
1200690325 Y:6302537-6302559 AAGCATGAATTAAACAAAAAGGG - Intergenic
1200861827 Y:8000659-8000681 AAGTACCAAAAAAACTAACAGGG + Intergenic
1200883479 Y:8245074-8245096 AAGCATGAATTAAACAAACAGGG - Intergenic
1201044948 Y:9872179-9872201 AAGCATGAATTAAACAAAAAGGG + Intergenic
1201060874 Y:10045741-10045763 AAGCATGAATTAAACAAACAGGG - Intergenic
1201079990 Y:10232980-10233002 ATGTATCCATTTAACTCACAGGG - Intergenic
1202106822 Y:21379644-21379666 AAACATGAATTAAACAAACAGGG - Intergenic
1202117414 Y:21482991-21483013 AAACATGAATTAAACCAACAGGG + Intergenic
1202194932 Y:22290660-22290682 AAACATGAATTAAACAAACAGGG - Intergenic
1202200066 Y:22336771-22336793 AAATATGAATTAAACAAACAGGG + Intronic