ID: 1087524702

View in Genome Browser
Species Human (GRCh38)
Location 11:99295517-99295539
Sequence ATGTCCTTCTAGAAGACTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 2, 1: 17, 2: 35, 3: 55, 4: 178}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087524700_1087524702 2 Left 1087524700 11:99295492-99295514 CCATGGAAAAAGAGCCTAACAAA 0: 1
1: 0
2: 49
3: 63
4: 262
Right 1087524702 11:99295517-99295539 ATGTCCTTCTAGAAGACTGAAGG 0: 2
1: 17
2: 35
3: 55
4: 178
1087524699_1087524702 18 Left 1087524699 11:99295476-99295498 CCACTTTTATTCTAAACCATGGA 0: 17
1: 21
2: 24
3: 47
4: 248
Right 1087524702 11:99295517-99295539 ATGTCCTTCTAGAAGACTGAAGG 0: 2
1: 17
2: 35
3: 55
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087524702 Original CRISPR ATGTCCTTCTAGAAGACTGA AGG Intronic
905159352 1:36017946-36017968 ATGCCCATCCAGAAGAGTGAAGG + Intronic
907211830 1:52830334-52830356 ATGTCCTGGTAGAAGAGTGAAGG + Intergenic
907511267 1:54962469-54962491 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
908732635 1:67242150-67242172 ATGCCCTGCTAGAAGAGTGAAGG + Intronic
909209977 1:72810700-72810722 ATGTCCTTCTAGAAGACTGAAGG + Intergenic
909576125 1:77178295-77178317 ATGCCCTTCTAGAAGTATGAAGG - Intronic
909825012 1:80116807-80116829 ATGCTCTTCTGGAAGAGTGAAGG + Intergenic
910809643 1:91223092-91223114 ATCCCCTTTTAGAAGAGTGAAGG - Intergenic
916567043 1:165990026-165990048 ATGTCCTTCTATAAGTGAGAGGG + Intergenic
916640556 1:166724402-166724424 ATGCCCTTCTACAAGAGTGAAGG - Intergenic
917085365 1:171299468-171299490 TTGTCCTTCTGGAAGACTCCTGG - Intergenic
917904640 1:179576226-179576248 ATGTCATGCTAGAGGGCTGACGG + Intergenic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
918834412 1:189442132-189442154 ATGTCCTACTATACCACTGATGG - Intergenic
919214614 1:194535715-194535737 ATGTCATTATAGAAGTCTGGTGG - Intergenic
922158347 1:223058325-223058347 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
922759018 1:228113558-228113580 ATGTCCTTTTAGAAAAGTGAAGG + Intergenic
922847428 1:228698653-228698675 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
1063322745 10:5066958-5066980 ATGCCCTTCTAAAAGAGTGAAGG + Intronic
1064652658 10:17525006-17525028 AAGTGCTTCTAGAAAACTCAAGG + Intergenic
1065807216 10:29405324-29405346 ATGTCCTTCTGTAAGAGTGAAGG + Intergenic
1067905190 10:50283260-50283282 ATGTCCCCAGAGAAGACTGATGG + Intergenic
1068357565 10:55929423-55929445 TTATCCTTCTCAAAGACTGATGG - Intergenic
1068401266 10:56530710-56530732 ATGACTTTCTTGAAGACTGAGGG + Intergenic
1068982534 10:63076595-63076617 ATGTTCCTCTTGAAGACAGAAGG + Intergenic
1070996564 10:80788729-80788751 AGTTTCTTCTAGAAGAATGAGGG + Intergenic
1071790936 10:88953242-88953264 ATGTATTTATAGACGACTGAAGG - Intronic
1071875080 10:89836615-89836637 AAGTCCTTATAGAAGCCTAAAGG + Intergenic
1073515012 10:104068530-104068552 TTGGCCTTCTAGAAGCTTGAGGG - Intronic
1074263278 10:111875295-111875317 ATGTCCTTACTGAAGACTGTTGG - Intergenic
1077259074 11:1606013-1606035 ATGTCCTTTTAGAAGTTTCAGGG + Intergenic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1079164297 11:18024411-18024433 ATGTCTGGCTAGAAGACAGATGG + Intronic
1081647788 11:44802051-44802073 ATGACATTCTTGAACACTGATGG - Intronic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1083011851 11:59408939-59408961 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1083132858 11:60642407-60642429 TGGACCTTCTAGAAAACTGAAGG - Intergenic
1085479843 11:76812207-76812229 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1085646961 11:78230590-78230612 ATGTGCTCCTAGAAGGCAGAGGG + Intronic
1086114559 11:83234155-83234177 ATGTACTTCTGAATGACTGAAGG - Intronic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087524702 11:99295517-99295539 ATGTCCTTCTAGAAGACTGAAGG + Intronic
1088000722 11:104876873-104876895 ATGTCCTGCGAGAAACCTGATGG - Intergenic
1088103815 11:106183577-106183599 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1088536245 11:110865339-110865361 ATCTCCTTCTAAAAGAATAAGGG - Intergenic
1089125034 11:116170878-116170900 CTGTCCTTGTAGAATACAGATGG - Intergenic
1089524867 11:119090266-119090288 GTATCCTTTTAGAAGAGTGACGG + Intronic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1090536223 11:127644772-127644794 AGGTACTTGTAGAAAACTGAGGG + Intergenic
1090659111 11:128869350-128869372 ATCTCCCACTAGGAGACTGAGGG + Intergenic
1091049596 11:132355437-132355459 ATGTCCTCCTGGAAGGATGATGG + Intergenic
1091325035 11:134679687-134679709 ATGTGCTTCTTGGAGCCTGAAGG - Intergenic
1093356236 12:18171840-18171862 ATGCCATTCTAGAAGATTGAAGG - Intronic
1093380466 12:18485213-18485235 CTGTCCTGCTGGTAGACTGATGG + Intronic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1098294417 12:68989988-68990010 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1098502563 12:71210505-71210527 GTGTCCTTCTAGAAGAATAAAGG - Intronic
1098711973 12:73774195-73774217 ATGCCCATCCAGAAGAGTGAAGG - Intergenic
1099654022 12:85466699-85466721 ATTTCCTTTTAGAAGACACAAGG - Intergenic
1100120739 12:91366725-91366747 ATTTCCTTCTTCAAGCCTGAGGG + Intergenic
1100159163 12:91837651-91837673 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1102003025 12:109569938-109569960 ATTTGTTTCTAGAAGACAGAAGG - Intronic
1103628060 12:122235614-122235636 GTGTCCTTCTAGGATTCTGATGG + Intronic
1105412645 13:20184244-20184266 GTGTCCTCCTAGAAGGCAGATGG - Intergenic
1106624385 13:31405578-31405600 ATGGACTTTTAGAAGAGTGAAGG - Intergenic
1109756480 13:66767564-66767586 ATGTACTTTTAGAAGTTTGAAGG - Intronic
1109860162 13:68187779-68187801 ATGTCATTCTAGAGGAGAGAAGG + Intergenic
1110050158 13:70886918-70886940 ATGTCCTTTTAATAGAATGAAGG - Intergenic
1110960105 13:81610618-81610640 ATGCCCTTCTAAAAAAGTGAAGG - Intergenic
1111594602 13:90395612-90395634 ATGCCCTTCTAGAAGACTGATGG - Intergenic
1113968453 13:114168849-114168871 ATGCCCTTCCAGAAGAGTGAAGG + Intergenic
1114912219 14:27214563-27214585 ATGCTCTTCTAAAAGAGTGAAGG + Intergenic
1114919707 14:27311393-27311415 ATGCCCTTCTAGAATGCTGCAGG - Intergenic
1115006366 14:28490049-28490071 ATGTCCATCCAAAAGAATGATGG + Intergenic
1115543767 14:34446647-34446669 ATGCCCTTCTAGAAGAGGGAAGG - Intronic
1116234949 14:42268088-42268110 ATGCCCTTCTAGAAAAGTGAAGG + Intergenic
1116483920 14:45424040-45424062 ATGCCCTTCTAGAAGAGTAAAGG - Intergenic
1116679307 14:47945556-47945578 ATGTCTTTCTAGAAGAGTGAAGG - Intergenic
1116725624 14:48558391-48558413 ATACCCTTATAGAAGAGTGAAGG + Intergenic
1116802884 14:49461809-49461831 ATGTGCTTCTGGAAGGCTGAAGG - Intergenic
1118285466 14:64466595-64466617 AAGTCATTCTAGAACAATGACGG - Intronic
1121268139 14:92617970-92617992 ATGCCCTTCTAGAAGAGTGAAGG + Intronic
1121440978 14:93949121-93949143 ATGTCCTTCCAGAACAAGGAAGG - Intronic
1122076001 14:99234995-99235017 AAGTCCCTCTAGAAGAGAGACGG - Intronic
1122160642 14:99781611-99781633 CTGTGCTTCAGGAAGACTGATGG - Intronic
1124012066 15:25846687-25846709 ATGTCATTTTAGATCACTGAAGG - Intronic
1124638369 15:31379501-31379523 ATTTCTTTCCAGAAGACTGGGGG + Intronic
1125233907 15:37489608-37489630 ATATTCTACTTGAAGACTGAGGG + Intergenic
1127290461 15:57565820-57565842 ATGTACTTTTAGTATACTGAGGG + Intergenic
1128393292 15:67197831-67197853 AAGTCCTTATATATGACTGAAGG + Intergenic
1128602050 15:69003774-69003796 TTGTCCATCTAGAAGAGTGAAGG + Intronic
1129260280 15:74362982-74363004 ATGCCCTTTCAGAAGAGTGAAGG - Intronic
1131432621 15:92398932-92398954 CTGTCTTTCTAAATGACTGATGG - Intronic
1132278367 15:100590470-100590492 ATGCCCTTCTAGAAGATTGAAGG - Intronic
1134829539 16:17312078-17312100 AAGGCCTTCTAGAAGAGTCAAGG + Intronic
1141409092 16:83820440-83820462 GTGTCCCCCTAAAAGACTGATGG + Intergenic
1142029646 16:87832134-87832156 CTCTGTTTCTAGAAGACTGAAGG + Exonic
1144426679 17:15149489-15149511 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1147463876 17:40595142-40595164 ATGCCTATCTAGAAGAGTGAAGG - Intergenic
1149052410 17:52322286-52322308 AAGAACTTCTTGAAGACTGAAGG + Intergenic
1153232026 18:2947373-2947395 TTGTCCTTCTAGAGGATGGATGG - Intronic
1154365682 18:13706581-13706603 TTGCCCTTCTAGAAGAGTGAAGG - Intronic
1155590329 18:27420230-27420252 ATGCATTTCAAGAAGACTGAAGG - Intergenic
1155803424 18:30137294-30137316 ATGCCCTTTTAAAAGAATGAAGG + Intergenic
1156031990 18:32723420-32723442 ATTTGCTTTCAGAAGACTGAGGG + Intronic
1156567687 18:38214237-38214259 ATTTTCTTCTAGAAGATTTATGG - Intergenic
1157013303 18:43678854-43678876 ATGCCCTTCTAGAAGACTGAAGG + Intergenic
1157647149 18:49286433-49286455 ATGTCCTTCAAGAACACACAAGG - Exonic
1160262929 18:77312438-77312460 ATGCCTTTCTAGAAGAGTGAAGG + Intergenic
1160360603 18:78273242-78273264 GTGTTCTTCAGGAAGACTGAAGG - Intergenic
1162229779 19:9256542-9256564 ACATCCTTCTAGAATAGTGATGG - Intergenic
1164461337 19:28451388-28451410 ATGCCCTTTTAGAAAAGTGAAGG - Intergenic
1166561246 19:43733718-43733740 TTGTTCTGCAAGAAGACTGAGGG + Exonic
926522055 2:13927706-13927728 ATGTCCATCTAGAAGAGTGAAGG - Intergenic
928382638 2:30832928-30832950 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
928817090 2:35310558-35310580 ATGGCCATTTTGAAGACTGAAGG + Intergenic
929305684 2:40358856-40358878 ATATGCTTCTACAAGACTGAAGG + Intronic
929428940 2:41870659-41870681 ATGTCCTTCAAGAAGAGTTTAGG + Intergenic
930325763 2:49915161-49915183 ATGTGATACTAGAAGAATGAAGG + Intergenic
931288151 2:60849798-60849820 ATGTCCTTGTGGAAGGCAGAGGG + Intergenic
932194521 2:69771643-69771665 ATGTCCTTATGGCAGACTGCAGG - Intronic
933077739 2:77950907-77950929 GTGCCCTTCTAGAAGAGTGAAGG + Intergenic
937225868 2:120368414-120368436 ATGGCCACCTAGAAGCCTGAGGG + Intergenic
939036618 2:137139293-137139315 ATGTCCATCTAAAAGAATGGAGG - Intronic
940569296 2:155409914-155409936 ACGCCCTTTTAGAAGAGTGAAGG - Intergenic
941246168 2:163099925-163099947 TTGTCCTTCTAGAATTCTGCAGG - Intergenic
942550674 2:177113950-177113972 ATGTCCTTCTAAATTACTTAAGG + Intergenic
942629542 2:177940792-177940814 ATGTCCTACTAAGAGACTCACGG - Intronic
943307022 2:186275653-186275675 ATGGCCTTCTATAAACCTGAGGG - Intergenic
943372763 2:187036275-187036297 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
943969135 2:194380814-194380836 ATGCCCTTCTAGAAGAATGAAGG + Intergenic
944620803 2:201514152-201514174 AAATTCTTCTAGAATACTGAAGG + Intronic
945560970 2:211339713-211339735 ATGTTCTTCTGGAAGCCTAATGG - Intergenic
945811826 2:214558266-214558288 ATGTCCTGCAAGAAGAAAGAGGG - Intronic
1170677801 20:18498521-18498543 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1171721762 20:28570300-28570322 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171756299 20:29113199-29113221 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1171785953 20:29464694-29464716 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171862288 20:30412278-30412300 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1173108008 20:40156255-40156277 CTATGCTTCTGGAAGACTGAAGG - Intergenic
1173383796 20:42570082-42570104 ATGTCCTTCCAAAGGACAGAGGG - Intronic
1175908274 20:62392449-62392471 ATGTCCTTTTTGAGGTCTGAGGG + Exonic
1177326858 21:19601857-19601879 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
1177534067 21:22401693-22401715 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1180228169 21:46410376-46410398 ATGTTCTTCCAAAAAACTGAGGG - Intronic
1180295318 22:10928987-10929009 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1180413354 22:12637057-12637079 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1181129273 22:20720717-20720739 ATTTCCTTGTAGAAGACGGCTGG - Intronic
1181453732 22:23041413-23041435 ATGCCCATCTAGAAGAATGAAGG + Intergenic
1182018248 22:27059433-27059455 ATGGCCTCCTATATGACTGATGG - Intergenic
1183643423 22:39107351-39107373 ATGTCCTTCTAGAAGAGTAAAGG - Intergenic
949689223 3:6615413-6615435 CTGTCCTCCTAGAATACTCATGG - Intergenic
949962609 3:9325620-9325642 ATGTCCTTCTAGACGAGTGAAGG + Intronic
951187212 3:19727649-19727671 ATGTCCTTGTGGAAGAGTGAAGG - Intergenic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
951603158 3:24399291-24399313 ATGCCCTTCAGGTAGACTGAGGG - Intronic
951841564 3:27039463-27039485 ACGCCCTTTTAGAAGAATGAAGG + Intergenic
952042348 3:29276477-29276499 ATGTCCTTCTTAAAGATAGAAGG + Intergenic
953566884 3:44039981-44040003 AGGTTCTTGTAGAAGACTAAAGG + Intergenic
954305281 3:49722343-49722365 ATGTCCATCCAGAAGCCTGTAGG + Exonic
955959475 3:64325171-64325193 ATATCCTTATTGAAGTCTGAGGG - Intronic
956931082 3:74043635-74043657 AAGTGCTCCTAGAAGACTGCTGG - Intergenic
957135755 3:76286974-76286996 ATGTCCATTTGGAACACTGAAGG - Intronic
957406638 3:79780442-79780464 ATGTCTTTCTGCAAGACAGATGG - Intergenic
957750863 3:84413533-84413555 ATGCCCTTCTAGAATAGTGAAGG - Intergenic
958898456 3:99857253-99857275 ATGTTCTTGGAGAACACTGATGG - Intronic
959132634 3:102376317-102376339 ATGTACTTTTAGAAGATTGCTGG - Intronic
960775059 3:121241139-121241161 ATGTCATTCTCTAAGACTTAGGG - Intronic
962146686 3:132847029-132847051 ATGTCCTTGTAGAGGTATGATGG - Intergenic
962568391 3:136687697-136687719 TTGTCTTTCTAGAAAAATGAAGG + Intronic
963576623 3:147068406-147068428 ATGTCCTTTTAGAAGAGGGAAGG - Intergenic
965096069 3:164227733-164227755 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
965157995 3:165089200-165089222 ATGTCCTTCTAGAATTCAGACGG + Intergenic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
968266489 3:197367291-197367313 GTGGCATTCTGGAAGACTGAGGG - Intergenic
968386349 4:142529-142551 ATGCCCCTCTAGAAGAGTGAAGG - Intronic
969435524 4:7187012-7187034 ATGTCCAACCAGAAGACGGAGGG - Intergenic
970040298 4:11789263-11789285 ATGTGTTTCTAGAAGCCAGATGG + Intergenic
970761851 4:19498972-19498994 ATGACCATCTGGAAGACTGAAGG - Intergenic
970822723 4:20237689-20237711 TGTTCCTTGTAGAAGACTGAGGG - Intergenic
972819190 4:42680004-42680026 ATGTCCTGCTAGAAGAGTGAAGG - Intergenic
973813874 4:54600250-54600272 ATATCCTTCTACAGGACTGAAGG + Intergenic
974189795 4:58489830-58489852 ATGCCGTTTTAGAAGAGTGAAGG + Intergenic
975062929 4:70025727-70025749 AGGCCATTTTAGAAGACTGATGG - Intergenic
975063007 4:70026720-70026742 AGGCCATTTTAGAAGACTGATGG + Intergenic
975064850 4:70047985-70048007 AAGCCATTTTAGAAGACTGATGG - Intergenic
975140879 4:70917106-70917128 ATGCCCTTTTAGAACAGTGAAGG + Intronic
977088340 4:92634220-92634242 ATGTCCTTTTATAATACTGTAGG - Intronic
978950729 4:114555918-114555940 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
979296245 4:119035331-119035353 CTGCCCTCCTAGAAGACTGAGGG - Intronic
980937018 4:139235247-139235269 ATGCCCTTTTAGAAGAGTGAAGG + Intergenic
981201305 4:141982806-141982828 ATATCCTTTTAGAAGATTGAAGG - Intergenic
981824411 4:148923872-148923894 ATGTCTTATTAGAAGACTGCTGG - Intergenic
984473492 4:180208077-180208099 TTGTCTTTCTAAAAAACTGAAGG - Intergenic
984553528 4:181187452-181187474 TTGTACTTCTAGAAAACTGAAGG + Intergenic
985009244 4:185565833-185565855 AGAGGCTTCTAGAAGACTGAGGG + Intergenic
988274386 5:29062243-29062265 TTGTCCTTCAAGGATACTGAGGG + Intergenic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
990082002 5:51928480-51928502 ATGCCCTTCTAGAAGATCGAAGG - Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
993009446 5:82463517-82463539 ATTTTCTTCTAGAATACTTATGG - Intergenic
993248789 5:85487644-85487666 ATGCCCTTCCAGAAGAGTGAAGG - Intergenic
993468312 5:88274725-88274747 ATGTCCTTCAAGAAGAAATAAGG - Intergenic
993897030 5:93548107-93548129 ATTTCCTTCAGGAAAACTGAAGG - Intergenic
993992080 5:94670060-94670082 TTCTCCTTCTAGAATACTGCTGG - Intronic
994467662 5:100159043-100159065 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
994702517 5:103154237-103154259 ATTTTCTTCTAAAAGGCTGAGGG - Intronic
994711871 5:103275816-103275838 AGGTCCTTTTAGAAGGCTCAGGG - Intronic
995673120 5:114630477-114630499 ATTTAATTCTAGAAAACTGATGG - Intergenic
999092658 5:148951086-148951108 AGGCCCTTCCACAAGACTGAAGG - Intronic
1000561763 5:162798302-162798324 GTGTCCTTCAAGAAGACTTGTGG + Intergenic
1005639408 6:27781807-27781829 ATGCCTTTTTAGAAGAGTGAAGG - Intergenic
1006290670 6:33133669-33133691 ATGCCCTTCTAGAAGACTGAAGG + Intergenic
1006819790 6:36883716-36883738 ATGTCTTTCTAGAAGAGTGAAGG - Intronic
1011123734 6:83983861-83983883 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1011341867 6:86324826-86324848 AAGCCCTTCTAGAAGAGTGAAGG - Intergenic
1011880189 6:92014752-92014774 AAGTCTTCCTAGAAAACTGATGG - Intergenic
1012348535 6:98222493-98222515 ATGTCCTTGATGAAGACAGATGG + Intergenic
1014162944 6:118191088-118191110 ATGCCCTTCTAGAAGAGTAAAGG + Intronic
1014646482 6:123980261-123980283 ATGTCTTTTTTGAAGACTGGAGG + Intronic
1014947111 6:127512169-127512191 CTGTTCTTTTAGAAGACTCATGG + Intronic
1015258459 6:131207262-131207284 TTGTCCTCCTAGAAGCCAGATGG + Intronic
1015579008 6:134703182-134703204 ATTTCATTCTAAAAGACTAATGG + Intergenic
1015831327 6:137372239-137372261 ATGCCCATCTAGAATACTGAAGG + Intergenic
1018347826 6:162921257-162921279 ATCTCCTGCTAGAAGACCGGGGG + Intronic
1019140948 6:169942041-169942063 ACGTCCTTCCAGAAAAGTGAGGG - Intergenic
1019270802 7:147277-147299 ATGCCCTTCTAGAAGAGGGAAGG + Intergenic
1019455049 7:1122637-1122659 ATGTCCTTCGGGAGGACTGTGGG - Intronic
1020647225 7:10829519-10829541 ATGGCCTTCTAGAAGAGTGAAGG - Intergenic
1021115600 7:16743211-16743233 ATTTCCTGCTAGAAGTTTGAGGG - Intergenic
1022550307 7:31232504-31232526 ATATCACTCTAGAAAACTGACGG - Intergenic
1026932470 7:74231372-74231394 CGGTTCTTCTAGAAGCCTGAAGG - Intergenic
1027707634 7:81554292-81554314 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1031305387 7:120119664-120119686 ATGTCCTTCTAAAAGAATGAAGG - Intergenic
1033072369 7:138215865-138215887 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1033850007 7:145483438-145483460 ATGCCCTTCTAGAAGAGTAAAGG + Intergenic
1033962884 7:146935501-146935523 ATGCCCTTCTAGAAGAGTGAAGG - Intronic
1034710949 7:153191057-153191079 ATGTACTTCTTGAAGACCCAAGG + Intergenic
1035115435 7:156519446-156519468 ATGTTCTTTGAGAAGACAGATGG + Intergenic
1038609109 8:29043022-29043044 TTGTCTTTCTAGAAAACAGATGG + Intronic
1040089391 8:43381475-43381497 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1040402721 8:47068473-47068495 ATGCCCTCCTAGAAGAGTGAAGG - Intergenic
1041298406 8:56386338-56386360 TTGTACTTCTAGAAGACTCCAGG - Intergenic
1042538311 8:69881717-69881739 GTTTCCTTCTAGAACCCTGATGG - Intergenic
1043827090 8:84942282-84942304 ATGTCCTTCTAAAGGAGTGAAGG - Intergenic
1044621950 8:94199479-94199501 GTGTTTTTCTGGAAGACTGAAGG - Intronic
1046202585 8:110946858-110946880 AGGCCCTTCTAGAAGACTGAAGG + Intergenic
1046487144 8:114901550-114901572 ATACCCTTCTAGAAGAGTGAAGG - Intergenic
1050314545 9:4387958-4387980 ATGCCCTTTTAGAAGAGTGAAGG + Intergenic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1050674816 9:8040001-8040023 AAGTACTTCCAGAAGATTGATGG + Intergenic
1051119509 9:13736716-13736738 GTGTCCTTCTAGAGCACTGAAGG + Intergenic
1052037469 9:23699056-23699078 ATGTCTTTCTATAGGAGTGAAGG + Intronic
1055281107 9:74675734-74675756 AGCTCCTCCTGGAAGACTGACGG - Intronic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1056480828 9:87004024-87004046 ATGTTCTTCTACAGGCCTGAGGG + Intergenic
1057781151 9:98051602-98051624 ATGCCCTTCTAGAGGAGTGAAGG + Intergenic
1058047265 9:100369934-100369956 ATGTCCATCCAAAAGAGTGAAGG - Intergenic
1058218064 9:102259719-102259741 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1058866309 9:109165346-109165368 ATGTCCTTGTTCAAGATTGAGGG - Intronic
1060500743 9:124152294-124152316 ATGTCCTTATTCAAGACAGAAGG + Intergenic
1062719597 9:138031255-138031277 ATTTCCTTTGAGAAGACTCATGG + Intronic
1202802194 9_KI270720v1_random:10091-10113 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1203446753 Un_GL000219v1:63862-63884 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1185677408 X:1859952-1859974 GTGTCCTTCTAAGAGACAGAAGG - Intergenic
1186893395 X:13982372-13982394 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1187087320 X:16054352-16054374 TGGTCCTTCTTGAAGACTCAAGG + Intergenic
1188221495 X:27546558-27546580 ATGTCCTGGTAGAAGTCTGCTGG - Intergenic
1188563160 X:31493244-31493266 ATGTCCTTCAAGAAGATTTTTGG - Intronic
1189187686 X:39068333-39068355 ATGACTTTCTAGAAAACTGTAGG - Intergenic
1191643885 X:63457795-63457817 ATGTCCATCTAGAATGATGAAGG + Intergenic
1192983595 X:76372700-76372722 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
1193782551 X:85721344-85721366 ATCTCCTACTAGAGGGCTGATGG - Intergenic
1194515516 X:94847092-94847114 ATGTTCCTCTAGAAGATTAATGG - Intergenic
1194546897 X:95247242-95247264 ATATACTTCTAAAAGAATGAAGG - Intergenic
1195426325 X:104736016-104736038 GTGTGCTTCTAGAATAATGAAGG - Intronic
1195471855 X:105239392-105239414 ATGCCTTTCTAGAAGAATGAAGG + Intronic
1195950744 X:110270086-110270108 TTGTCCTTATAAAAGACTGTTGG - Intronic
1196464109 X:115956018-115956040 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1196970764 X:121105941-121105963 ATTTCCTTCCAACAGACTGAAGG - Intergenic
1197934465 X:131726602-131726624 ATGCCCTTTGAGAAGAGTGAAGG - Intergenic
1198498521 X:137218747-137218769 ATGTCCTTTTAGAAGAGTGAAGG - Intergenic
1198531892 X:137556004-137556026 ACCTCCTTCTAGAAGAAAGAAGG - Intergenic
1200271409 X:154688048-154688070 ATTTCCTTCTAAAAGAATTATGG - Intronic
1200967876 Y:9117391-9117413 ACATCCTTCTATAAAACTGAAGG + Intergenic