ID: 1087524841

View in Genome Browser
Species Human (GRCh38)
Location 11:99296696-99296718
Sequence CTGGACTCCCTGGGAAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 3, 1: 11, 2: 15, 3: 41, 4: 213}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087524841_1087524846 15 Left 1087524841 11:99296696-99296718 CCTGTTTTTCCCAGGGAGTCCAG 0: 3
1: 11
2: 15
3: 41
4: 213
Right 1087524846 11:99296734-99296756 ATATCCACTTTTAATTAAGCTGG 0: 4
1: 3
2: 7
3: 23
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087524841 Original CRISPR CTGGACTCCCTGGGAAAAAC AGG (reversed) Intronic
901939880 1:12653838-12653860 CTAAACTTCCTGGGAAAAAGAGG - Intronic
902936464 1:19768360-19768382 CTGGACTCCCTTGGAGAGAAAGG - Intronic
904827230 1:33281440-33281462 CAGGACCACCTGGGAAAGACAGG - Intronic
905916503 1:41688294-41688316 CAGGACACCCTGAGAAAGACAGG - Intronic
906581748 1:46940838-46940860 CTGTGCTCCCTGGCAAACACAGG + Intronic
906766045 1:48435218-48435240 CTGGACTCCCTGGGTCAAGTGGG + Intronic
906891506 1:49720975-49720997 CTGGACTTCCTGGGTAAAGTGGG + Intronic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
908156882 1:61362479-61362501 CAGGACTCCCTGGCCAAAAGAGG + Intronic
909210435 1:72816213-72816235 CTAGACTTCTTAGGAAAAACAGG - Intergenic
912687639 1:111779667-111779689 CTGGACTCCCTGAGAACCACAGG + Intronic
914457110 1:147846308-147846330 CTGTCCTGCCTGGGAAAAACAGG + Intergenic
915297502 1:154931560-154931582 CTGCACTGCATGGGAAAGACAGG - Intronic
917085786 1:171304899-171304921 CTGGACTTCCTGGGCCAAATGGG + Intergenic
917293692 1:173496302-173496324 CTGGACTCCTTGGGAAAAATAGG + Intergenic
920748693 1:208653427-208653449 CTGAACTCCTTGGGAAAGAATGG - Intergenic
921077158 1:211709077-211709099 CTGGACCCCTTGGGAAAAGCAGG + Intergenic
921535697 1:216346286-216346308 TGGGACTCCTTGGGAAAAAAAGG + Intronic
921546858 1:216483598-216483620 CTAAACTTCCTGGGAAAAAGAGG + Intergenic
922885213 1:229014935-229014957 GTGGCCTCCCTGGGAAAACTTGG + Intergenic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
924808620 1:247381721-247381743 TGGGACTTCTTGGGAAAAACAGG - Intergenic
1063102828 10:2965327-2965349 CTGGAGACCCAGGGAAGAACTGG + Intergenic
1063410263 10:5831834-5831856 CTGGAGTAGCTGGGAATAACAGG + Intronic
1063414620 10:5863358-5863380 CTGGACTTCCTGGGTCAAATGGG + Intronic
1065295070 10:24266477-24266499 CTGGACTTCCTGGGTAGAATGGG + Intronic
1065345470 10:24744025-24744047 CTGGGCTCCCATGGACAAACTGG - Intergenic
1068662308 10:59635292-59635314 CTGGACTCAGTGGGAACAACAGG + Intergenic
1070689336 10:78512903-78512925 CTGGGCTAACTGGGAAAAGCGGG + Intergenic
1071309750 10:84331258-84331280 TTGCACTCCCTCTGAAAAACTGG - Intronic
1071357260 10:84810610-84810632 TGGGACTCCTTGGAAAAAACAGG - Intergenic
1076639253 10:131902459-131902481 CTGCGCCCCCTGGGACAAACAGG + Intronic
1076985452 11:232907-232929 CGAGCCTCCCTGGGAGAAACAGG + Intronic
1077859047 11:6158816-6158838 CTGGACTACTTGGGAAAAACAGG - Intergenic
1078429865 11:11280585-11280607 CTGGAAATGCTGGGAAAAACTGG - Intronic
1078698449 11:13658472-13658494 CTGAGATCCCTGGGAAAAACAGG - Intergenic
1080058414 11:27931643-27931665 TGGGACACCCTGGGAAAAACAGG - Intergenic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1084148932 11:67279104-67279126 TTGGGCTCCCTGGGCAGAACTGG - Intronic
1084440688 11:69171076-69171098 CTGCACTTTGTGGGAAAAACAGG + Intergenic
1084878124 11:72149122-72149144 TGGGACTCCTTGGGGAAAACAGG + Intergenic
1084878608 11:72153281-72153303 TATGACTCCCTGGGAAAAACAGG - Intergenic
1085192869 11:74644055-74644077 CTCACCTCCCTGGAAAAAACTGG + Intronic
1086915792 11:92528686-92528708 CTGGACTCCCTCAAAAGAACTGG - Intronic
1087227061 11:95613278-95613300 CTGGTCTCCTTGGGAAAAACAGG - Intergenic
1087524841 11:99296696-99296718 CTGGACTCCCTGGGAAAAACAGG - Intronic
1088030282 11:105240367-105240389 CTGAACTCCTTGGGAAAATTTGG + Intergenic
1089328892 11:117676509-117676531 CTGGACCCTTTGGGAAAAAGAGG - Intronic
1089875940 11:121722463-121722485 CTGGACTCCCTCCGAGAAGCAGG - Intergenic
1090978517 11:131695969-131695991 CTGGAGTGCATGAGAAAAACTGG + Intronic
1093415144 12:18911298-18911320 TTTGACTCCCTGGGCAAAGCTGG + Intergenic
1094233938 12:28141033-28141055 CTAGACTCTATGGGAAAGACAGG + Intronic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1094431335 12:30373116-30373138 GGGGACTCCTTGGGAAAAACAGG - Intergenic
1094681436 12:32670740-32670762 TTAGAGTGCCTGGGAAAAACAGG + Intergenic
1094741607 12:33296160-33296182 ATGGACTCCTTGAGAAATACAGG + Intergenic
1096475862 12:51908271-51908293 CTGGCCTCCATGGAAAAATCTGG - Intronic
1096514497 12:52148548-52148570 CTGGTCTACCTGAGAAAAGCAGG - Intergenic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1097414279 12:59295372-59295394 CTGGACTTCCTGGGTCAAATGGG + Intergenic
1098512635 12:71335899-71335921 TTGGACTAACTGGGAAAAACAGG - Intronic
1099949338 12:89283138-89283160 CTGCACTTCCTGGGAAACAGTGG + Intergenic
1101188549 12:102307063-102307085 CTGGATTCCTTGGGAAAAACAGG + Intergenic
1102389518 12:112538133-112538155 CAGGACTGCCTGGCAATAACAGG + Intergenic
1104812721 12:131628404-131628426 TTGTCCTTCCTGGGAAAAACAGG + Intergenic
1107311525 13:39083363-39083385 TGGGACTTCTTGGGAAAAACAGG + Intergenic
1107585510 13:41843300-41843322 TTAGACTCCCTTAGAAAAACAGG + Intronic
1107600382 13:42006554-42006576 CTGGAGTCCCTCTGAAGAACTGG - Intergenic
1109392553 13:61711044-61711066 CTGGACTACCAGGGAGAAATTGG + Intergenic
1110049900 13:70883730-70883752 CCTGACTCCTTGGTAAAAACAGG + Intergenic
1110132768 13:72027663-72027685 GAGGACTCCCTGTGAATAACGGG + Intergenic
1110303766 13:73959975-73959997 CTAAACTCCCTGAAAAAAACTGG + Intronic
1114452232 14:22834946-22834968 CTTGACTGCCTGGCCAAAACTGG - Exonic
1114575337 14:23707677-23707699 CTGGACTTCCTGGGTCAAGCGGG - Intergenic
1114680877 14:24482563-24482585 CTGGCTTCCCTGGGTAAAATGGG - Intergenic
1114709860 14:24767272-24767294 TTGGACTCCCCTGAAAAAACAGG + Intergenic
1115923159 14:38400820-38400842 CTTAACTCCCTGGGTAATACAGG + Intergenic
1116013426 14:39378000-39378022 CTGGAGCCCCTTGGAAAAACTGG - Intronic
1116329647 14:43579147-43579169 CTGGACTCTTTGGGAAAAACAGG + Intergenic
1116678831 14:47939967-47939989 CTGGACTCCATGGGAAAAACAGG + Intergenic
1117718063 14:58600918-58600940 CTGGATTGCCTGGCAAGAACTGG + Intergenic
1118547169 14:66904578-66904600 CTGGACTTCCTGGGTCAACCAGG - Intronic
1118764433 14:68900403-68900425 CTGGACTCCCTGGAGAAGGCAGG + Intronic
1118919566 14:70137835-70137857 TTTGGCTCCCTGGGAAAAATGGG + Intronic
1119305512 14:73604990-73605012 TGGGACTCATTGGGAAAAACAGG - Intergenic
1119651170 14:76384545-76384567 CTGGCCCCCCTGAGAAAAGCTGG + Intronic
1121003805 14:90473395-90473417 TGGGACTCCTTGGCAAAAACAGG + Intergenic
1122794367 14:104198624-104198646 CTGGACTCCCTGGGCAACCTTGG - Intergenic
1123712235 15:22997034-22997056 CTGGACACCCTGGGCAACAGTGG + Intronic
1123797030 15:23782530-23782552 CTGGAGTCCCTGTGACAACCAGG - Intergenic
1125512896 15:40302401-40302423 CTGGACTTCCTGAGAGACACAGG - Intronic
1126072388 15:44876352-44876374 CTGGACTTCCTGGGCCAAATGGG - Intergenic
1128901919 15:71430846-71430868 ATAGAAGCCCTGGGAAAAACTGG - Intronic
1132278766 15:100594050-100594072 CTCAACTCCCTGGCAAAAAATGG + Intronic
1132593226 16:735588-735610 CTGGTGTCCCAGGGAAAACCTGG - Intronic
1134277414 16:12789104-12789126 CTGGATTCTCTTGGAAAATCTGG + Intronic
1138015504 16:53424816-53424838 TGGGACACCTTGGGAAAAACAGG - Intergenic
1141834553 16:86530140-86530162 CAGGCCTCCCTGGGAAGGACAGG + Intergenic
1142571487 17:877799-877821 CTGGCCTGCCTGGTGAAAACCGG - Intronic
1145114555 17:20197185-20197207 CTGAACTCCTTGGGAAAAACAGG - Intronic
1149142672 17:53452900-53452922 ATCGACTCCCTGGGAAAATAAGG + Intergenic
1149445299 17:56708557-56708579 CTGGCTTCCCAGGGAGAAACAGG - Intergenic
1150075213 17:62186303-62186325 CTGGGCTCCCTGAGAGTAACGGG - Intergenic
1151484237 17:74388545-74388567 ATGGAGTCCCTGGGAGAAAGGGG + Intergenic
1153482832 18:5564771-5564793 CTGGACTCCCTGCCACCAACAGG + Intronic
1154365352 18:13703017-13703039 TGGGACCCCTTGGGAAAAACAGG + Intronic
1155191085 18:23431211-23431233 CTGGTAGCCCTGGGAAAAAGTGG - Intronic
1157197637 18:45632364-45632386 CAGGACTCCATGGGTACAACGGG + Exonic
1157280895 18:46345600-46345622 CTTGACTCCTAGGGCAAAACAGG + Intronic
1157410730 18:47460760-47460782 CAGGACTCCTTGGCAAAAATTGG + Intergenic
1157573501 18:48729199-48729221 CTGGACCCCCTGGGTAAGAGGGG - Intronic
1157925809 18:51765009-51765031 CTGGAGTTCCAGGGAAACACTGG + Intergenic
1158149987 18:54357534-54357556 CTGAACTCACTTGGAAAAACTGG + Intronic
1159035174 18:63270299-63270321 CTGTTCATCCTGGGAAAAACTGG + Intronic
1159654972 18:71022481-71022503 CTGGAGGCCCTGGGAAAGAAAGG + Intergenic
1160823633 19:1069367-1069389 CTGGGCTGCCAGGGACAAACAGG - Intronic
1161375301 19:3936799-3936821 CTGGGGTCTCTGGGATAAACTGG + Intronic
1162518549 19:11165385-11165407 CTGGAGTCCCGGGGAGGAACAGG + Intronic
1163125414 19:15241734-15241756 CTGTCCTCCCTGGGAAATACTGG - Intronic
1164029508 19:21389658-21389680 CTGGACTTCCTGGGTCAAATGGG + Intergenic
1166303537 19:41925220-41925242 GAGGATTCCCTGGGATAAACAGG + Intronic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1166900910 19:46062081-46062103 TGGAACTCCTTGGGAAAAACAGG - Intronic
1167430829 19:49453474-49453496 CGGGACTCCCCGCGAAAAACCGG - Intronic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
926149284 2:10415704-10415726 CTGGACTCCCCCCGAATAACAGG - Intronic
926616887 2:15004939-15004961 CTGGATTCCTTAGGAAAAGCTGG + Intergenic
929290695 2:40187475-40187497 TTGGTCTCCCTGGGAACAGCAGG - Intronic
929620570 2:43350100-43350122 CTCGACTCACTGGGTAGAACAGG + Intronic
932896942 2:75649479-75649501 CTGGCTTCCCTGGGACACACTGG - Intronic
932965895 2:76474217-76474239 CTGGATGCCTTGGGAAAAACAGG + Intergenic
933178833 2:79207310-79207332 CTGGACTACCTAGGTGAAACCGG - Intronic
933399976 2:81783638-81783660 CTGGAACACCTGGGATAAACTGG - Intergenic
933614278 2:84468399-84468421 CTGGACTCCTTGGGGTAAACAGG - Intergenic
934889027 2:98049524-98049546 CTAGACTCCTTGGGAAAAACAGG + Intergenic
935712692 2:105913274-105913296 CTGGAGTCACTGGGAAGAGCTGG + Intergenic
939496392 2:142932581-142932603 CTCGTCTACCTGGAAAAAACGGG - Intronic
939722207 2:145667878-145667900 CTGGAGGACCTGGGAAAAACGGG - Intergenic
939776482 2:146393439-146393461 TTGTTCTTCCTGGGAAAAACAGG + Intergenic
941482764 2:166038274-166038296 TTGGACTCCCTAGGAAAAGCTGG + Intronic
941601167 2:167545564-167545586 CTGGACTTCCTGGGACAATAGGG - Intergenic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
943468826 2:188266317-188266339 CAGGACTACCTGGGAGAAGCTGG - Intergenic
943919693 2:193689336-193689358 ATAGACTTCCAGGGAAAAACTGG - Intergenic
944110455 2:196125908-196125930 CTGGACACAATTGGAAAAACTGG - Intergenic
944124105 2:196274071-196274093 CTGGATGGCCTGGGAAGAACTGG + Exonic
946978122 2:225175789-225175811 CTAGATTCCCTGATAAAAACAGG + Intergenic
947304258 2:228725949-228725971 CTTTACTCACTGGGAAATACGGG + Intergenic
948278734 2:236730147-236730169 GTGGACTCTGTGGGGAAAACAGG - Intergenic
948471239 2:238181500-238181522 TTGGACTTCTTGGGAACAACTGG - Intronic
1169998169 20:11582878-11582900 CTGGACTCACTGGCAGACACAGG - Intergenic
1170495640 20:16921896-16921918 CTGCCTTTCCTGGGAAAAACTGG + Intergenic
1172152051 20:32797528-32797550 CTGTACACCCTGGGCAACACAGG - Intronic
1173812454 20:45964332-45964354 CTGGCCTCCCTTGGATAAATGGG - Intronic
1175263575 20:57689478-57689500 CTGGACTCCCCAGGAGGAACGGG - Intronic
1175804520 20:61820136-61820158 CTGGGCCCTCTGGGCAAAACCGG - Intronic
1176863135 21:14025145-14025167 CTGAAGTCTCTTGGAAAAACTGG - Intergenic
1178627151 21:34227680-34227702 TTGGACTCCCAGGGAAAAATAGG - Intergenic
1179896372 21:44365836-44365858 CTGGTCTCCCTGGGAGGAGCAGG - Intronic
1179987185 21:44928343-44928365 ATGGACTCCAGGGGGAAAACCGG + Intronic
1181985668 22:26798570-26798592 CTGGCCTTTCTGGGAAGAACAGG + Intergenic
1182861814 22:33566895-33566917 CTGGACTTCCTGGGTCAAATGGG - Intronic
1183973942 22:41499218-41499240 CTGGACTACCTGGCACATACTGG - Intronic
1184506673 22:44907917-44907939 CTGGAATCTCTGGGAAGTACAGG + Intronic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
951465020 3:22991414-22991436 CTGGCCCCCCAGGGAAAACCGGG - Intergenic
954702283 3:52456514-52456536 GTGGGCTGCCTGGCAAAAACCGG + Intronic
956309027 3:67858747-67858769 GTGGACTCCCTTGCACAAACTGG - Intergenic
958757048 3:98261512-98261534 CTGGACTCCCTGAACAAATCTGG + Intergenic
958953685 3:100443655-100443677 CTAAAATCCCTGGGGAAAACTGG - Intronic
961097185 3:124167398-124167420 CTGGACTCCCTAGAGAACACAGG + Intronic
961513717 3:127420120-127420142 CTGGCCTCCCTGCGACAACCAGG + Intergenic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
961632126 3:128308746-128308768 CAGGACTCCCTGGGAACACAAGG + Intronic
963064530 3:141252971-141252993 CTGGCCTCCTTGGGGAATACTGG - Intronic
964763950 3:160160298-160160320 GAGGACTCCTTGGGAAAATCAGG - Intergenic
964785947 3:160396713-160396735 CTGGCCTACCTGGAAAAGACTGG - Intronic
965535823 3:169822771-169822793 CTGCTCTACCTGGGAAACACCGG + Exonic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
967427868 3:189348223-189348245 CGGGAATCCCTGGGAACAACTGG + Intergenic
968384401 4:123559-123581 CTGGACTTCCTGGGTAAACTGGG - Intergenic
968393236 4:210395-210417 CTGAAGTCTCTTGGAAAAACTGG - Intergenic
968402345 4:308710-308732 CTGAAGTCTCTTGGAAAAACTGG + Intergenic
968476852 4:814686-814708 CCGGACTCCTGGGGAAAACCTGG - Intronic
969420078 4:7088923-7088945 CTGGACTCCTTGAGAAAAACAGG - Intergenic
970069612 4:12142707-12142729 CTGGACACACAGGGAAAAAATGG + Intergenic
971814107 4:31464941-31464963 TGGGACTCCTTGGAAAAAACAGG - Intergenic
971944150 4:33252308-33252330 CAGGACACAATGGGAAAAACTGG - Intergenic
972577305 4:40363770-40363792 CTGGACTGTCTTGGACAAACTGG + Intergenic
972618041 4:40719112-40719134 CTGGACTCCCTGTGTAACACAGG - Intergenic
972818986 4:42677212-42677234 CTGGACTCCTTGGGAAAAATGGG + Intergenic
975075177 4:70198072-70198094 CTGGGCTCCTTGGGCAAAACTGG - Exonic
976267464 4:83197554-83197576 ACAGACTCCCTGAGAAAAACGGG + Intergenic
976303885 4:83540526-83540548 CTGGACAGTCTGGAAAAAACTGG + Intronic
976984529 4:91276747-91276769 TTGGACACAATGGGAAAAACTGG - Intronic
981216132 4:142170751-142170773 TTGGAATTCCTGGGAAGAACAGG + Intronic
981788024 4:148502974-148502996 CTGGGCTTCCTGCAAAAAACTGG - Intergenic
982864221 4:160489884-160489906 TTGGACTCCTTGTGAAAAACAGG + Intergenic
985909096 5:2864964-2864986 CTCCTCTCCCTGTGAAAAACTGG - Intergenic
986082956 5:4413075-4413097 GTGGACTTCCAGGGAAAAAGGGG + Intergenic
986173457 5:5332320-5332342 CTGGTCTCCCCAGGAAAACCAGG + Intergenic
989336996 5:40329861-40329883 CTGGACGCCTTGGGAAAAACAGG - Intergenic
990290593 5:54346761-54346783 CTGGACTTCTTGGGAAAAACAGG + Intergenic
990669832 5:58115630-58115652 CTGGAGTTCCTGGGAAAGTCTGG - Intergenic
990776908 5:59313447-59313469 CTGGCTTTCCTGGGAGAAACTGG - Intronic
995625173 5:114068645-114068667 CTGGACCCTCTGGGAAGCACTGG - Intergenic
1002341564 5:178519536-178519558 CTGGCTTCTCTTGGAAAAACTGG - Intronic
1003834223 6:10050626-10050648 CAGAACACCCTGGGGAAAACAGG + Intronic
1006819465 6:36880266-36880288 CTGGAATCCATGGGAAAAACAGG + Intronic
1009716783 6:67408063-67408085 TGGAACTCCTTGGGAAAAACAGG + Intergenic
1010545481 6:77150230-77150252 CTGGCCTCCCTGAAAGAAACAGG + Intergenic
1010719146 6:79262714-79262736 TGGGACTCCTTGGGCAAAACAGG - Intergenic
1011653128 6:89525398-89525420 CTGGATTCCCAGTGAGAAACAGG - Intronic
1013888263 6:114997833-114997855 CTGGACTCCCTGGGTCAATACGG + Intergenic
1014855712 6:126398057-126398079 CAGGACTGTCTGAGAAAAACTGG - Intergenic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1016796134 6:148119566-148119588 CTGGGCTCTTTGGAAAAAACAGG + Intergenic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1019119379 6:169791014-169791036 CTGGAGTCCCTAGGAAATCCAGG - Intergenic
1020082189 7:5292054-5292076 CTGGTTTCCCTGGTATAAACAGG + Intronic
1020350549 7:7214286-7214308 TGGAACTCCTTGGGAAAAACAGG - Intronic
1021154241 7:17190314-17190336 TTGGCTTCCCTGGGAAACACTGG - Intergenic
1023588597 7:41757621-41757643 CTGAGCTCCTTGGGAAAAACAGG - Intergenic
1024090425 7:45935234-45935256 CTGCATTCCATGGGAAAGACAGG + Intergenic
1025196735 7:56940085-56940107 CTGGTTTCCCTGGTATAAACAGG - Intergenic
1025675212 7:63636852-63636874 CTGGTTTCCCTGGTATAAACAGG + Intergenic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1026826835 7:73587725-73587747 CTGGACTCCCAGGGAAAGAGTGG + Intergenic
1029700662 7:102244771-102244793 CTGCTCTCCCCTGGAAAAACAGG + Intronic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1031305068 7:120115718-120115740 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1031742892 7:125456450-125456472 CTGGACTTATTGGGAAAAACAGG - Intergenic
1034400987 7:150861229-150861251 CTGGGCTTCCTGGGAGGAACTGG - Exonic
1039057904 8:33551171-33551193 CTGGACTGCCTGGGGCAAGCCGG + Intronic
1039183774 8:34894178-34894200 TGGGACTCCTTGGAAAAAACAGG + Intergenic
1039441345 8:37597561-37597583 CTGGACTTCCTGGGAATCCCAGG + Intergenic
1044032827 8:87259772-87259794 CTGGACTCCTTAGGAAAAACAGG - Intronic
1044067998 8:87722244-87722266 CTGGACTTCCTGGGTCAAATGGG - Intergenic
1046067228 8:109211400-109211422 CTGGCCTCCCTGGAAAAGAGAGG - Intergenic
1048314626 8:133352882-133352904 ATGGACTCCCTGGGAGGCACGGG - Intergenic
1049279611 8:141737588-141737610 CTGAACTCCGTGGGACCAACAGG - Intergenic
1049437193 8:142592199-142592221 CTGGATTCTCTGGGAAAACAGGG - Intergenic
1049500526 8:142960955-142960977 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1049629213 8:143643244-143643266 CTGGAGGCCCTGGGGAAAACTGG - Intronic
1050657902 9:7849035-7849057 CTGGACTCCTTGGTAAAAACAGG + Intronic
1050879964 9:10687313-10687335 CTGAACTCTCTGAGAAAAAATGG - Intergenic
1052470296 9:28885323-28885345 CTGGACTCCCTGGAAGCAGCAGG + Intergenic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1052998471 9:34564411-34564433 CTGGACTCAGTGGGTAAGACTGG + Intronic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1057350398 9:94292455-94292477 CTGGTCTCCCTGGGTAAGGCTGG + Exonic
1057780672 9:98047458-98047480 TGGGACTCCTTGGGTAAAACAGG + Intergenic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1059340275 9:113594108-113594130 CTGGACTCCCAGGCACAAGCCGG - Intronic
1060443107 9:123660156-123660178 CTGGGCTCCCTGTCTAAAACGGG + Intronic
1061296929 9:129681884-129681906 CTGGGCTCCCTGGGGATCACGGG + Intronic
1061799342 9:133105553-133105575 CTGGCCTCCCGGGGACAGACTGG + Intronic
1062193090 9:135257639-135257661 CTGGCCACCCTGGGAGAAGCAGG + Intergenic
1062419573 9:136473440-136473462 CTGGTGTCCCTGTGAAAAAGAGG + Intronic
1186426566 X:9467342-9467364 CTGGACGCCCTGCAGAAAACTGG - Intronic
1187379504 X:18787484-18787506 CTAGACTCCCTGGGGGAAAATGG + Intronic
1189974253 X:46446578-46446600 CTAGACACCCTGGGAGAATCTGG - Intergenic
1190132976 X:47768362-47768384 CTGGGCTTCCTGGCAAAAGCAGG + Intergenic
1190962784 X:55268819-55268841 CAAGACTCCTTGGGAAAAACAGG + Intronic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1192005879 X:67211846-67211868 CTGGATTTCCTGAGAAAAATCGG + Intergenic
1192623846 X:72707501-72707523 ATGAACTCCCTGAGAAAAAGGGG + Intronic
1194131474 X:90087737-90087759 TGGGACTCCATGGGAAAAACAGG - Intergenic
1194230296 X:91314386-91314408 CTGGAGCCCCTGGAAAATACTGG + Intergenic
1194379907 X:93178943-93178965 TGGGACTCCTTGGGAAAAATAGG + Intergenic
1195068402 X:101257710-101257732 CTGCAGGCCCTGGGAAACACTGG + Intronic
1198181978 X:134219230-134219252 TGGGACTCCTTGAGAAAAACAGG - Intergenic
1198498308 X:137215995-137216017 CTGGACACCTTGGGAAAAACAGG + Intergenic
1198848153 X:140935960-140935982 CTGGAGACCCAGGGAAGAACTGG + Intergenic
1199123951 X:144091743-144091765 CTGGACTTCCTGGGTCAAATAGG - Intergenic
1200249524 X:154545448-154545470 ATGGACTTCTTGGGGAAAACAGG - Intronic
1200706374 Y:6446168-6446190 CAGGGCTCTCTGGGAAAAGCAGG + Intergenic
1201027738 Y:9718540-9718562 CAGGGCTCTCTGGGAAAAGCAGG - Intergenic
1201311285 Y:12600265-12600287 CTGGACTCCCTGGGTCGAATGGG - Intergenic