ID: 1087528184

View in Genome Browser
Species Human (GRCh38)
Location 11:99345389-99345411
Sequence CTGTGTACAAAGGTGAAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 184}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087528184 Original CRISPR CTGTGTACAAAGGTGAAGAT AGG (reversed) Intronic
903699780 1:25238404-25238426 CTGTTTACAAAGTTGTAGACTGG - Intergenic
903862981 1:26376321-26376343 TTGTGTAGAAAGGGGAAAATTGG - Intergenic
905003975 1:34695693-34695715 CTGTGAATAAAGGTGGGGATTGG - Intergenic
905267992 1:36768319-36768341 GTGTTTATAAAGGTGAAGAGGGG + Intergenic
910424400 1:87104738-87104760 CTGAGAACAAAGGTGAAGACAGG - Exonic
911465093 1:98241366-98241388 ATGCGTAAAAAGGTGAAGATTGG - Intergenic
911710404 1:101064924-101064946 GTGTGTACACATGTGCAGATGGG + Intergenic
915796924 1:158745373-158745395 CTTGGTACTGAGGTGAAGATGGG + Intergenic
919499542 1:198318838-198318860 CTGTGTACACAATTGAGGATTGG + Intronic
921171296 1:212552375-212552397 CTGTTTACAAAAGTGAGGCTAGG + Intergenic
924038794 1:239963306-239963328 CTGTGTGCAGAGGAGAAGACAGG - Intergenic
924214218 1:241803594-241803616 CTGAGTACAAAAGAAAAGATAGG + Intergenic
924732885 1:246728147-246728169 CTGTGTAACAAGGTGAATGTTGG + Intronic
1063254429 10:4310650-4310672 CTGTGTTCAAATGTGTAGAGTGG + Intergenic
1063506157 10:6601597-6601619 CTGTGAACACAGATGAAGTTTGG + Intergenic
1063710700 10:8475183-8475205 GTATGTAGCAAGGTGAAGATTGG - Intergenic
1064152215 10:12874566-12874588 CTGTCTACAGAGGTGAAGAGGGG + Intergenic
1064577851 10:16763887-16763909 CTTTATGCAAAGGTGAAGAGAGG - Intronic
1064719121 10:18210410-18210432 CTTTGAACAAAGGTGAAGAATGG + Intronic
1065179069 10:23106826-23106848 CTGTTTACAAAGGTGCAGACGGG - Intronic
1066188216 10:33031213-33031235 CATTGTACAGAGGTGAAGATCGG + Intergenic
1067311249 10:45115434-45115456 CTTTATGCAAAGGTGAAGAGAGG - Intergenic
1069204130 10:65660491-65660513 CTGTGAGCAAAGGTGAAACTAGG - Intergenic
1069733097 10:70631604-70631626 CTGTGTAGAAAGGTAGACATGGG + Intergenic
1070361507 10:75694533-75694555 CTGTGTGCAAATGTGAAAGTTGG - Intronic
1071087578 10:81880576-81880598 TTGTGTACAAAGGGGAGGAAGGG - Intronic
1071366034 10:84901403-84901425 CTGTTTACAAAGGTGAGGGCAGG - Intergenic
1071379891 10:85048021-85048043 CTCTGTATAAAGCTGAAGCTAGG + Intergenic
1072271038 10:93776856-93776878 CTGTGTGCAAAGGAGGAGGTTGG + Intronic
1078095729 11:8295538-8295560 TTGTGTCCAAAGAGGAAGATGGG - Intergenic
1078499856 11:11860978-11861000 CTGTGTTCAAATGTGACGTTGGG + Intronic
1080268057 11:30422287-30422309 CTGTGTTCAGAGGTGCAGGTTGG - Intronic
1082303609 11:50543185-50543207 CTGTGGCCAAAGGTGAAAAAGGG - Intergenic
1084937563 11:72595279-72595301 CTGTGTGCAGAGGTGGGGATTGG - Intronic
1085096132 11:73761639-73761661 GTGTGTGCAATGGTGAAGAAGGG - Intergenic
1087528184 11:99345389-99345411 CTGTGTACAAAGGTGAAGATAGG - Intronic
1087960359 11:104340617-104340639 CTGTGTATTAAGGAGGAGATTGG + Intergenic
1087983610 11:104649355-104649377 ATGTGTACAAATGTGAAAACAGG + Intergenic
1089874428 11:121705985-121706007 CTGTGTACAAGTGGGATGATTGG + Intergenic
1090155998 11:124439398-124439420 CTGTTTTCAAAAGTCAAGATGGG - Intergenic
1091940853 12:4480144-4480166 CTGTCTAGAAAGCTGAAAATGGG - Intergenic
1092132965 12:6125183-6125205 CTTTGTAAAATGGTGAAGGTGGG + Intergenic
1093634974 12:21455517-21455539 CTGTTTGCAAAGATGCAGATGGG - Intronic
1093827970 12:23718396-23718418 CTGTATGCAAAGATTAAGATAGG - Intronic
1094563969 12:31582991-31583013 CTGTGTACAAAAGAGAAAACAGG + Intronic
1095150555 12:38790174-38790196 CTGTTTACAACAGTCAAGATTGG + Intronic
1096223890 12:49852052-49852074 CTGTGTATAGAAGGGAAGATTGG - Intergenic
1097287743 12:57890471-57890493 CTGTGGACAAAGCTGGATATTGG + Intergenic
1102532922 12:113560027-113560049 CTGTGTTCAAATGTAAAGAAAGG - Intergenic
1103049078 12:117763657-117763679 CTGTGGGCTAAGGTGCAGATTGG + Intronic
1103802900 12:123550966-123550988 CTGAGCACAAAGGTGATGTTGGG + Intergenic
1104982692 12:132581365-132581387 CTGTGAACAGAGCTGCAGATGGG + Intronic
1106324223 13:28672596-28672618 CTGTTTTTAAAAGTGAAGATTGG + Intronic
1107811071 13:44200216-44200238 CTTTGTACAAAAGTAAATATAGG - Intergenic
1109075483 13:57829317-57829339 CTTTATAGAAAGGTGAAGTTTGG - Intergenic
1109123822 13:58491784-58491806 CTGTTTATAAAAGTGAAAATTGG - Intergenic
1111490382 13:88965492-88965514 AAGTGTACAAAGTTGTAGATAGG - Intergenic
1112686437 13:101833163-101833185 CTGTTTAGAAAGGTGCAGAATGG - Intronic
1114856071 14:26445746-26445768 CAGTGAACAAAGGCAAAGATTGG - Intronic
1115475410 14:33808647-33808669 CTATGTACACAGAGGAAGATGGG - Intergenic
1116790998 14:49339904-49339926 CTGTTTACAGAGGTGATGATAGG - Intergenic
1116839666 14:49807039-49807061 CTGGGTACAGAGGAGAAAATGGG - Intronic
1117445616 14:55801153-55801175 CTCTGTTCAAATGTGAAGATTGG + Intergenic
1125979161 15:43984320-43984342 CAGTGTATAGAGGAGAAGATGGG - Intronic
1127777756 15:62280829-62280851 CTGTGCACAGAGGTCAATATAGG + Intergenic
1128273393 15:66332154-66332176 CAGTATATAAATGTGAAGATTGG + Intronic
1129513594 15:76142812-76142834 CTGAGTGCAGAGGTGAAGAGAGG - Intronic
1129655035 15:77518444-77518466 CTGTGTACAGTTGTGGAGATGGG - Intergenic
1137835745 16:51590712-51590734 CTGAGAACTAAGATGAAGATAGG - Intergenic
1138155884 16:54702473-54702495 CTGTGTCCAGTGGTGGAGATGGG + Intergenic
1139589213 16:67924118-67924140 CTGTGTACAAGGGTTAGGCTGGG + Intronic
1151262699 17:72929192-72929214 CTGTCTACAAGGGAGCAGATAGG - Intronic
1153342002 18:3984883-3984905 CAGGGGACAATGGTGAAGATTGG - Intronic
1153548764 18:6238776-6238798 CTGAGTTCAAAGGAGAAGACAGG + Intronic
1153713015 18:7819197-7819219 CTGTGGACATAGGTGAGGACAGG + Intronic
1158060253 18:53331966-53331988 AAGTGTACAAAGGTGCAGAGAGG + Intronic
1165181938 19:33979059-33979081 CTGTATGCTAATGTGAAGATAGG - Intergenic
1165743813 19:38218725-38218747 CTCTGGGCAAAGGTGGAGATTGG + Intronic
927823436 2:26289328-26289350 CTGTGTAGAATAGTGAAGAAGGG + Intronic
932080439 2:68709550-68709572 ATGTGTACAAAGCTCAGGATGGG + Intronic
932910040 2:75796821-75796843 CTGTGAACAAAAATGAAGCTGGG + Intergenic
936328258 2:111524032-111524054 CTGTGTGCATAGCTGGAGATGGG + Intergenic
936416630 2:112320414-112320436 CTGTGTACAAATGAGAATTTAGG - Intronic
938170608 2:129072323-129072345 CTGTTTACAAAGTTGAATAAAGG - Intergenic
939250011 2:139671221-139671243 CTGGGTACAATGGTCAATATTGG - Intergenic
939819776 2:146943699-146943721 CAGTGTTCAAAGGAGAAGACAGG - Intergenic
941293610 2:163707746-163707768 CTGTGAAAAGAGGTGAAGAGTGG + Intronic
943426674 2:187746434-187746456 CTGTATACAAAGGTGTGGATAGG + Intergenic
945724459 2:213458675-213458697 CTGTGTACACAGTTGTATATTGG + Intronic
946509990 2:220345638-220345660 CTGTGGGAAAAGGTGAAGAGAGG - Intergenic
947778724 2:232737832-232737854 CTGGGGACAATTGTGAAGATGGG + Intronic
948396231 2:237647429-237647451 CTTTGTACAAAGGAGAAAAGGGG + Intronic
1169271383 20:4202064-4202086 CAGTATACAAAGTTGAAGAAAGG - Intergenic
1169706228 20:8508108-8508130 GTCTGAACAAAGGTGAAAATTGG + Intronic
1172333436 20:34092953-34092975 CTGTTTCCGAACGTGAAGATAGG + Intronic
1173170064 20:40716550-40716572 CTGTGTTCATAGGAGGAGATGGG + Intergenic
1173552454 20:43942243-43942265 CTGTTTACTAATGTTAAGATGGG - Intronic
1176375642 21:6085776-6085798 CTGTGGACACCGGTGAAGAGGGG + Intergenic
1179282692 21:39947917-39947939 CTGTTAAGAAAGGTGAAGAAAGG + Intergenic
1179747832 21:43452468-43452490 CTGTGGACACCGGTGAAGAGGGG - Intergenic
1180930496 22:19587251-19587273 CTATGTACCTAGGTGAGGATAGG - Intergenic
1181257902 22:21576031-21576053 CTGTGTCCAAAGATGAGCATAGG + Intronic
1183546672 22:38457864-38457886 CTGGGCACAAACTTGAAGATGGG + Intergenic
1184015083 22:41779957-41779979 CTGTAGCCACAGGTGAAGATGGG + Intronic
1184739707 22:46420839-46420861 CTGTGTGATAAGGTGAAGGTGGG + Intronic
954290707 3:49648544-49648566 TTGTGTACACAGGTGATGCTGGG + Intronic
954457240 3:50606449-50606471 CTGTGTACACAACTGAAAATCGG + Intergenic
954688120 3:52381617-52381639 CTGTGCACCAAGGCGAGGATGGG - Intronic
955665870 3:61348678-61348700 CTAGTTACAAAGGTGTAGATTGG + Intergenic
956393342 3:68798224-68798246 GTGTGTACAAAGGTGAATGCAGG + Intronic
957537755 3:81528552-81528574 ATTTGTCCAAAGGTGAAGGTGGG + Intronic
958154874 3:89743728-89743750 CTGTGTAAAATGCTGATGATAGG - Intergenic
960943894 3:122952990-122953012 CTGTTTACAAAGGTGTAGGAAGG - Intronic
961445159 3:126977041-126977063 CTGTGTCCACATGTGTAGATGGG + Intergenic
964776432 3:160283782-160283804 CTATGTACATAGGGGAAGAGGGG + Intronic
965121604 3:164565532-164565554 CAGTGTAAAAAGGAGAAGATGGG - Intergenic
965366084 3:167801846-167801868 CCTTGTTCAAAGTTGAAGATAGG - Intronic
965929338 3:174023447-174023469 CTGTTTGCAAGGGTGAAGAATGG + Intronic
967521341 3:190436313-190436335 TTGAGCACAAAGGAGAAGATGGG - Intronic
967727464 3:192874985-192875007 CAGTTTACAAAGGTGTAGTTAGG - Intronic
967838131 3:193981462-193981484 CTGTATACAGAACTGAAGATGGG - Intergenic
970594325 4:17585983-17586005 TTGTGTCCAAAAGTGATGATAGG - Intronic
971455436 4:26839848-26839870 CAGTCTACACAGGTGAAGCTGGG + Intergenic
972947439 4:44273539-44273561 CTGGGAAAAAAGATGAAGATGGG + Intronic
980642029 4:135593705-135593727 CTGTGTACACAGGTTAATATAGG + Intergenic
981176236 4:141687205-141687227 CTGCTTACAAGGATGAAGATGGG - Intronic
981982000 4:150804976-150804998 CTAGGTACGAAGATGAAGATTGG + Intronic
983607081 4:169599764-169599786 TTGTGAACAAACATGAAGATGGG + Intronic
983763815 4:171450889-171450911 TTCTGTACAAAGCTGAGGATAGG - Intergenic
984119002 4:175718728-175718750 CAGTGTAAAAAGGCAAAGATGGG + Intronic
986642775 5:9888589-9888611 CTGTGTGCAACGGTGAGGAAAGG + Intergenic
987163656 5:15171558-15171580 CTGTGTCCCAAGGTGACGTTAGG - Intergenic
988510955 5:31864332-31864354 CTGTTTACAGAGGTGCAGACCGG - Intronic
989051958 5:37330133-37330155 CTGTGTAAAAAGAGGAATATTGG + Intronic
989290284 5:39756541-39756563 CTGGGTACTACGGTGATGATGGG + Intergenic
989512961 5:42309614-42309636 CTGTGTGCTAATGAGAAGATTGG - Intergenic
991050349 5:62266429-62266451 CTGTCTACAAAGGAAAAGAGAGG - Intergenic
992413279 5:76528530-76528552 CTTTGAAAAAAGGAGAAGATTGG - Intronic
996292694 5:121872193-121872215 CTGTGTACTATGGTGCAGATGGG - Intergenic
997632619 5:135380220-135380242 CTGTATACAAAGGTGAGGGAGGG + Intronic
998753977 5:145355588-145355610 CTGTGAACATAGGTAAACATAGG - Intergenic
999512175 5:152263476-152263498 CTGGGTACAAAGGTGATGAGAGG - Intergenic
999694900 5:154180082-154180104 CTGTTTAAAAAGGTGAGGCTGGG - Intronic
1003708200 6:8559263-8559285 CTACTTACAAAGGTGTAGATGGG + Intergenic
1007794560 6:44337322-44337344 CTATTTACAGAGGTGAAGGTGGG + Intronic
1009847100 6:69147716-69147738 ATGTGTCCAACGGTGAAAATTGG + Intronic
1011057915 6:83226048-83226070 CTGTAGGCACAGGTGAAGATAGG - Intronic
1011639382 6:89404855-89404877 CTGTGTAAGGAGGTGAACATTGG - Intronic
1014100339 6:117504943-117504965 CTGGGTGCAAAGGTCAAGACAGG - Intronic
1014293404 6:119587904-119587926 CTATGTACAGAGGTGCAGAAGGG + Intergenic
1015952121 6:138563918-138563940 GTGTGTACAAAGGTGAAAGCAGG + Intronic
1017121815 6:151031064-151031086 CTGAGTACAAAGTTGAGGCTGGG - Intronic
1023240432 7:38140696-38140718 CTTTCTACAAATGTGAAAATTGG + Intergenic
1024780720 7:52845403-52845425 GTGTGTAGAAAGGTTAAGAAAGG - Intergenic
1025298885 7:57800260-57800282 CTGTGTACAATGGTGTAGCCAGG + Intergenic
1025717299 7:63972460-63972482 ATGTGTACAGAGTTGAATATTGG + Intergenic
1025727115 7:64076124-64076146 ATGTGTACAGAGTTGAATATTGG - Intronic
1029020554 7:97360286-97360308 TGGTGTACAAAGGTTAAGTTTGG - Intergenic
1030803855 7:113889053-113889075 CTGTATATGGAGGTGAAGATGGG + Intronic
1031859442 7:126961169-126961191 CTATGTAAAAAGGTTAAGCTTGG + Intronic
1034398748 7:150847556-150847578 CTATATACAAAGGTGGAGCTAGG - Intronic
1035218455 7:157389701-157389723 CTGTTTAAAAAGGTGAAAAGAGG + Intronic
1035995385 8:4540651-4540673 CAGTGTACAAAGGTCAGGAAAGG + Intronic
1036426269 8:8647590-8647612 GTGTGTACAAAGGTGTACATTGG + Intergenic
1038692450 8:29775502-29775524 CTTTGGAAAAAGGGGAAGATGGG + Intergenic
1039701175 8:39963197-39963219 CTGGGTATAAATGTGAAGAAGGG - Intronic
1039969356 8:42308185-42308207 CTGTGTAGAAATGGGAAGAGAGG - Intronic
1040456343 8:47601813-47601835 CTGTGTACAAAGATGAACTTTGG + Intronic
1041723436 8:60996969-60996991 CTGTGTACTAAGGTGGGGACGGG - Intergenic
1042746015 8:72106850-72106872 CAGTGTCCAAAGCTGAAGAAAGG - Intronic
1047085635 8:121512434-121512456 GTGTGTAGTAATGTGAAGATGGG - Intergenic
1047644339 8:126854017-126854039 CTGAGTACAATGATGAAGTTGGG - Intergenic
1048206179 8:132417166-132417188 CTATTTACAAAGGTGAGGAAAGG + Intronic
1049453492 8:142675308-142675330 CTGGGCACTAAGGTGGAGATGGG - Intronic
1050152203 9:2628181-2628203 CTGTGTCTAAAGGTGAAAAATGG + Intronic
1050532344 9:6601416-6601438 CTGTATATAAAAGTGAAGACTGG + Intronic
1051108058 9:13603503-13603525 GTGTGTAGAGAGGTGAAGCTGGG + Intergenic
1052390838 9:27877430-27877452 TTGTGAACCAAGGTGAAGACAGG + Intergenic
1053366272 9:37524679-37524701 CTGTGTACAATGGGGAAGTCAGG + Intronic
1053460160 9:38262525-38262547 CTGTATACCAAGGTAAAGATGGG - Intergenic
1057026576 9:91738631-91738653 CTATGTTCAAAGGTGATGGTAGG + Intronic
1059147071 9:111909394-111909416 CTGTGTAGAAATCTGTAGATTGG + Intronic
1059903829 9:118959452-118959474 TTGTGTTCAAAGGGCAAGATTGG + Intergenic
1059915571 9:119095853-119095875 CTCTGTACAAACATGAAGATAGG + Intergenic
1061533792 9:131235180-131235202 CTGTGTTCACAGGTGAAGTGGGG + Intergenic
1186321672 X:8433518-8433540 ATGTGTCCAACGGAGAAGATGGG + Intergenic
1187847760 X:23558508-23558530 CAGTGGACTAAGCTGAAGATGGG - Intergenic
1190591234 X:52003853-52003875 TTGAGTACAGAGGTGAAGAAAGG + Intergenic
1192699532 X:73453180-73453202 CTGTGAAAATAGGTCAAGATGGG + Intronic
1196903873 X:120412703-120412725 GTGTGTAAAATGGTGCAGATGGG - Intergenic
1198177341 X:134169886-134169908 TTGTGTACAGAGGATAAGATTGG - Intergenic
1198676600 X:139137929-139137951 CTGTCTGCAAAGATGATGATTGG - Intronic
1199109743 X:143916739-143916761 CAGTGTTCAAGGGTGAAGAGAGG - Intergenic
1200363221 X:155633422-155633444 CTGTGATCAAAGGAGAGGATAGG + Intronic
1200883342 Y:8243479-8243501 CTCTGTAGAAAGGTGAAACTGGG + Intergenic
1201425189 Y:13842540-13842562 CTTTGCACAAAAGTGAACATTGG - Intergenic
1202251894 Y:22881571-22881593 CTCTGTCCAAAGGTGAAATTGGG - Intergenic
1202265121 Y:23010087-23010109 CTCTGTCCAAAGGTGAATTTGGG + Intergenic
1202404882 Y:24515320-24515342 CTCTGTCCAAAGGTGAAATTGGG - Intergenic
1202418112 Y:24643829-24643851 CTCTGTCCAAAGGTGAATTTGGG + Intergenic
1202452674 Y:25026257-25026279 CTCTGTCCAAAGGTGAATTTGGG - Intergenic
1202465897 Y:25154762-25154784 CTCTGTCCAAAGGTGAAATTGGG + Intergenic