ID: 1087528868

View in Genome Browser
Species Human (GRCh38)
Location 11:99353610-99353632
Sequence ATGGCTAAGTCAAAAGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 239}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087528868 Original CRISPR ATGGCTAAGTCAAAAGAGGA GGG Intronic
900289527 1:1918003-1918025 ATGGCCAAGCCCAGAGAGGAAGG - Exonic
902932307 1:19740253-19740275 ATGGCTGAGTCTAGAGGGGATGG - Intronic
904106764 1:28091134-28091156 ATGGGAAAGTACAAAGAGGATGG - Intergenic
906663535 1:47599823-47599845 TTGATTAATTCAAAAGAGGATGG + Intergenic
907645137 1:56234893-56234915 ATGGTGAAGTAAAAAGAGCACGG - Intergenic
910148333 1:84109391-84109413 ATGGCTAAAGCAAAAGTGAAAGG - Intronic
911183973 1:94885482-94885504 ATGGCTTAGTGGAAAGAGGCTGG - Intronic
911906896 1:103580944-103580966 ACTGCTAAATCAAAAGAGGGAGG - Intergenic
914886564 1:151589837-151589859 ATTAATAGGTCAAAAGAGGAAGG - Intergenic
915302762 1:154961076-154961098 ATGGCTGAGAGAAAAGAGGTTGG - Intronic
915538248 1:156550667-156550689 ATGGCTGAGGCATAAGAGCAGGG - Intronic
915883363 1:159697341-159697363 ATGGGTGAGGCAAGAGAGGAAGG - Intergenic
917843782 1:179003609-179003631 ATGCCTAGGACAAATGAGGAAGG + Intergenic
918014048 1:180615660-180615682 ATGGTCGAGCCAAAAGAGGAGGG - Intergenic
919407429 1:197202101-197202123 AAGGCTGAGACAAAATAGGATGG + Intergenic
919607696 1:199706394-199706416 ATGGCGCAGTCAAAATGGGATGG + Intergenic
920885882 1:209927547-209927569 AAGGCTAAATCAAAAGGGAATGG + Intergenic
922187413 1:223287789-223287811 ATGGTTAAATAAAAAGAGAAAGG + Intronic
922550030 1:226488087-226488109 AGGGCTGAGTCAACACAGGAAGG - Intergenic
923184135 1:231553449-231553471 AAGGCTAAGACAGAAGGGGAAGG + Intronic
923449564 1:234103901-234103923 ATGGCTAAGGGAAAAGAACACGG - Intronic
923893437 1:238241047-238241069 TTAACTAAGTCAAGAGAGGAGGG + Intergenic
923934944 1:238749222-238749244 ATGGCTATGCTAAGAGAGGAGGG - Intergenic
924855320 1:247869703-247869725 ATGGCTAAGTCAAACTATCAAGG + Intronic
1063050306 10:2439954-2439976 ATGGCAGAGTCTGAAGAGGATGG - Intergenic
1063531054 10:6831713-6831735 ATTGATAAGTCAAGAAAGGAAGG - Intergenic
1065962504 10:30745298-30745320 ATGGCTGAGTCAAAGGAGATAGG + Intergenic
1066480614 10:35792194-35792216 AGGGGGGAGTCAAAAGAGGAGGG + Intergenic
1067818040 10:49498046-49498068 ATGGCAAAGTGAAAAGAAGGTGG + Intronic
1069247276 10:66221458-66221480 ATTTTTAAGTCAAAAGAGCATGG + Intronic
1069399775 10:68030529-68030551 ATTGCTAAGTGAAAAGAGCAAGG - Intronic
1069959591 10:72072057-72072079 ATGGCTAATTCATAAGGAGAGGG + Intronic
1074297201 10:112201277-112201299 ATGCCTGAGACCAAAGAGGATGG + Intronic
1074600392 10:114907978-114908000 AGGGCTTAGTCCAAAGGGGAAGG + Intergenic
1074871163 10:117577238-117577260 ATGGCTAAAGCATTAGAGGAGGG + Intergenic
1075082848 10:119395494-119395516 ACAGCTATTTCAAAAGAGGAAGG - Intronic
1075117583 10:119639890-119639912 ATTGTTAAGTAAAAAGAGGAAGG + Intergenic
1075235260 10:120721981-120722003 GTGGCAAAGTCAAGAGAGCATGG + Intergenic
1077036155 11:495499-495521 ACGGGTCAGACAAAAGAGGATGG + Intronic
1078670941 11:13364550-13364572 AGGGCTGAGTCATAAGAGCAAGG + Intronic
1081765946 11:45610247-45610269 GTGGCTAAGTCACAAGAAGAGGG - Intergenic
1082895345 11:58184151-58184173 ATGGCTAAGGCCAAGGAAGATGG + Intergenic
1083017650 11:59472501-59472523 ATGACTGAGACAGAAGAGGATGG + Intergenic
1084433550 11:69124633-69124655 GAGGCTAAGTCAGAGGAGGAGGG + Intergenic
1085688829 11:78649490-78649512 AGGGCTGAGTGAAGAGAGGAAGG - Intergenic
1086219355 11:84423072-84423094 ATGGCAAGGTCAAATGGGGAAGG + Intronic
1087528868 11:99353610-99353632 ATGGCTAAGTCAAAAGAGGAGGG + Intronic
1089402892 11:118174764-118174786 ATGGCTAAGTAAAGATAGAAAGG - Intronic
1090249041 11:125238238-125238260 ATGGCTAACACCAAAGGGGAGGG + Intronic
1090898250 11:131000215-131000237 ATGGTTAAGTTAAAAGTGAAAGG - Intergenic
1091518135 12:1207789-1207811 ATGGCAAATTCAACAGAGAAGGG + Intronic
1092312376 12:7371813-7371835 ATTGCTAAATCAAAAGAGCAGGG + Intronic
1092600921 12:10063444-10063466 TTGGTTAATTAAAAAGAGGAGGG + Intronic
1093001109 12:13997119-13997141 ATGGCTAAGTGGAAATAGGAAGG + Intergenic
1093745151 12:22731740-22731762 ATGTCAAAGACAAATGAGGAGGG + Intergenic
1096793292 12:54058460-54058482 ATGGCTAAGTAAAAAGAAGACGG + Intergenic
1097247129 12:57612781-57612803 CTGGCCAACTCAAATGAGGATGG + Intronic
1098829647 12:75345470-75345492 ATGGGTAAGTCTAGAGAAGAAGG - Intronic
1101155872 12:101927038-101927060 ATTGCTATGTCAAAAAAGTAAGG - Intronic
1102423707 12:112824266-112824288 ATGGCTAATGAATAAGAGGAGGG - Intronic
1105273921 13:18903925-18903947 ATGGCTTAGTGAAAAGACGGTGG - Intergenic
1105483434 13:20801939-20801961 ATGGCTAGATGAAGAGAGGAAGG - Intronic
1106712514 13:32353257-32353279 AGAGATAAGTGAAAAGAGGAGGG - Intronic
1107284451 13:38774719-38774741 ATTACTAAGTCAAAAAAGAATGG - Intronic
1108045496 13:46380193-46380215 ATGGGTAAGTAAGAAGGGGAAGG + Intronic
1112022458 13:95383623-95383645 ATGGCATAGTCAAAGGAGAAGGG + Intergenic
1112116726 13:96363698-96363720 ATGGAAAAGTCAAAAGAGTAAGG + Intronic
1114329961 14:21626954-21626976 ATGGCTGGGTCAAAATGGGAAGG - Intergenic
1115650594 14:35400079-35400101 ATGTCAAAGTCAAAAGAATATGG - Intergenic
1116635827 14:47393961-47393983 GTGGCTTAGTCAGAAGAAGAAGG + Intronic
1117484616 14:56181716-56181738 CAGGCTAAGTCAAATGAGGATGG + Intronic
1118163309 14:63312415-63312437 ATTGCTCAGTTAAAAGGGGAAGG + Intergenic
1118177134 14:63452058-63452080 ATTGCTAAGTGAAAAAAGCAAGG + Intronic
1118474913 14:66107700-66107722 ATTGCTGAGGCAAATGAGGAGGG + Intergenic
1120200779 14:81535819-81535841 ATGGCTAAGTGAAAGAAGCAAGG - Intergenic
1120248287 14:82031170-82031192 ATGACTACTTAAAAAGAGGAGGG + Intergenic
1120758572 14:88266391-88266413 TTGGCTGAGACTAAAGAGGATGG - Intronic
1121873627 14:97431442-97431464 ATGGCTCAGGCAACAGAGAATGG - Intergenic
1122169230 14:99858114-99858136 ACTGCTAAGTAAAAAGAGCAAGG - Intronic
1124037831 15:26072632-26072654 ATGGATAAATAAAAAGATGATGG - Intergenic
1124199948 15:27670658-27670680 ATGGCAAAGTCAACAGTGGAGGG + Intergenic
1126869863 15:52976377-52976399 ACGGCAAAGTCAAATGTGGATGG + Intergenic
1128998132 15:72311879-72311901 ATGACTTAGTCAATAGAGCATGG + Intronic
1131807836 15:96141492-96141514 ATGGCTGAGACAAAGGGGGAAGG + Intergenic
1134032854 16:11006421-11006443 ATGTCTATCTCAAAATAGGATGG - Intronic
1135077714 16:19408692-19408714 ATGGCTTAGAGAAAGGAGGAGGG - Intergenic
1135497523 16:22965460-22965482 ATGGCCAAGGCAAGAGAGCAGGG - Intergenic
1135545476 16:23362989-23363011 ATGGCTAAGTCTACAGGGTAGGG - Intronic
1137035987 16:35570399-35570421 AAGGCCAACGCAAAAGAGGAGGG + Intergenic
1140611443 16:76604022-76604044 ATGATTAAGTAAAAAAAGGAAGG + Intronic
1142716840 17:1751808-1751830 CTGGCAAAGTCACAAGAGGGAGG + Intronic
1144006741 17:11107156-11107178 CTTGCTCAATCAAAAGAGGAAGG + Intergenic
1145307818 17:21685104-21685126 ATGGCTCTTTCAAAGGAGGAGGG - Intergenic
1147755973 17:42768134-42768156 ATGGTTCATTGAAAAGAGGAAGG + Intergenic
1147852786 17:43454956-43454978 ATAGTTAGGTGAAAAGAGGAAGG - Intergenic
1148711751 17:49686849-49686871 ATGGTCCAGGCAAAAGAGGATGG - Intergenic
1149031252 17:52085082-52085104 ATGGATAAGTCTAAATAAGATGG - Intronic
1149374630 17:56031697-56031719 ATGGCTGAGTAAAATGAGGAAGG + Intergenic
1153720426 18:7896183-7896205 ATGTCTAAATCAAAGGAGGCAGG - Intronic
1155758531 18:29533729-29533751 ATGGAAAAGACAAGAGAGGATGG + Intergenic
1156448356 18:37253255-37253277 ATAGCTCAGTGAAGAGAGGAAGG - Intronic
1157128692 18:44982485-44982507 ATGACAAACTCAGAAGAGGAGGG - Intronic
1158244323 18:55413645-55413667 ATGACTCAATCAAGAGAGGAAGG + Intronic
1161772182 19:6236817-6236839 ATGGCAAAGTCAAAGGTGGCTGG + Intronic
1164153881 19:22576842-22576864 ATTGATAAGTCAAGAAAGGAAGG + Intergenic
1165654385 19:37520540-37520562 ATGGCTAAATGAAGGGAGGATGG + Intronic
1166031108 19:40129293-40129315 ATGTCTGAGTCCAAAGAGTAGGG - Intergenic
1168588927 19:57616741-57616763 ATGGCAACCTCACAAGAGGAGGG - Intronic
925954164 2:8945108-8945130 ATGGCGATGTCAGGAGAGGAGGG - Intronic
926794595 2:16608473-16608495 ATGGCCAAGTGGAATGAGGACGG + Intronic
926860468 2:17303441-17303463 ATGGCTATCTTAAAAGAGAAAGG + Intergenic
927493247 2:23534505-23534527 CTGGCTAAGGCCAAACAGGAAGG - Intronic
928295205 2:30076804-30076826 GTGGCTGAGGCAAAAGTGGATGG + Intergenic
929582106 2:43087931-43087953 ATGGGCAAGGCAGAAGAGGAGGG + Intergenic
929697426 2:44130956-44130978 ATGGCTAAATTAAAAGTGAAAGG + Intergenic
931495034 2:62796472-62796494 ATGGTTAAATGAAAAAAGGAAGG - Intronic
932294580 2:70613626-70613648 ATGGCTAAGCCAGGAGCGGAAGG - Intronic
932699400 2:73983170-73983192 AATGTTAAGTTAAAAGAGGATGG + Intergenic
933062090 2:77750366-77750388 ATGTCTAACTAAATAGAGGAAGG - Intergenic
939360835 2:141170486-141170508 ATGGCTAAGTAAAAGGAAGTGGG - Intronic
939720455 2:145644151-145644173 ATGGGTCTCTCAAAAGAGGAAGG - Intergenic
940152595 2:150618635-150618657 ATGGCTGAGACAAAAGATGCTGG - Intergenic
941087598 2:161135436-161135458 ATGCCAAAGTAAATAGAGGAGGG + Intergenic
942540478 2:177010049-177010071 ATTGGTAAGTCAAAAGACAATGG + Intergenic
944153291 2:196585072-196585094 ATGGCAAAGACAAACAAGGAAGG - Intronic
945335657 2:208589826-208589848 TTGGATAAGAGAAAAGAGGACGG + Intronic
947367567 2:229412825-229412847 CTGGCTGAGTCAGAAGTGGAAGG + Intronic
948292085 2:236833076-236833098 AGGACTAAGTCAGAAGAGTAGGG + Intergenic
1169034618 20:2439379-2439401 ATGGCTTAAGCAAAAGGGGATGG - Intergenic
1170129644 20:13005342-13005364 ATGGATAAGTAAAACCAGGAAGG + Intergenic
1170169637 20:13396042-13396064 ATGACTAAGTCCAGAGAGAAAGG + Intronic
1173291800 20:41721779-41721801 ATGGCTGAATCACCAGAGGAAGG - Intergenic
1173607147 20:44339521-44339543 ATCACTAAGACAAAAGAGCAAGG + Intronic
1173991440 20:47306833-47306855 ATGCCAAAGTCAAAAGAACATGG + Intronic
1174437853 20:50523981-50524003 AAGGTTAAGACCAAAGAGGAAGG - Intronic
1175295455 20:57905597-57905619 AAAGCTGACTCAAAAGAGGATGG + Intergenic
1175363738 20:58435909-58435931 ATGGCATAGTGAAAAGAGCATGG + Intronic
1177304213 21:19291733-19291755 ATGGGTAAGTCTAAATAAGAAGG - Intergenic
1177870767 21:26570409-26570431 ATAGCTAAGATAAGAGAGGAAGG + Intronic
1178072447 21:28983674-28983696 ATGGCTAATTGAAAGGAGGAAGG + Intronic
1179606205 21:42517092-42517114 ATTGTAAATTCAAAAGAGGAAGG - Intronic
1181308813 22:21932635-21932657 GTGGCTAAGTTCACAGAGGAGGG + Intronic
1181512684 22:23395873-23395895 GTGGCTTAGTCTAAAGAGGTTGG + Intergenic
1183355531 22:37357067-37357089 ATAGCAAAGTAACAAGAGGAGGG - Intergenic
950031772 3:9858514-9858536 TTGGCTAAGTGGAAAGATGAAGG - Intergenic
950174488 3:10863238-10863260 AGGGCTAAGTAGAAGGAGGAAGG + Intronic
952393074 3:32897525-32897547 ATGTGAAAGCCAAAAGAGGAGGG - Exonic
955663453 3:61325978-61326000 ATGGGGGAGTCAAGAGAGGAAGG - Intergenic
957631164 3:82717249-82717271 ATAGTCAAGTCAAAAGAGGCAGG + Intergenic
957690460 3:83559215-83559237 TTGCCTAGGTAAAAAGAGGAAGG + Intergenic
958635258 3:96736273-96736295 ATGGCTTTCTCAGAAGAGGAAGG - Intergenic
960635440 3:119780506-119780528 ATGGCTAAAGCCAAAGAGGGTGG - Intronic
963321296 3:143812464-143812486 ATTGTCAAGTCAAAAGAGCAAGG + Intronic
963386484 3:144601179-144601201 ATGTATAAGACAAAAGAGAATGG - Intergenic
964779127 3:160315687-160315709 ATGGCAAAGGGAAAAGAGGGTGG - Intronic
965462015 3:168977659-168977681 AAGGGAAAGTCAAATGAGGAAGG + Intergenic
965653968 3:170964200-170964222 ATGGATAAGTGAAAAGGGTAGGG + Intergenic
967605434 3:191439786-191439808 ATGGAAAAGTCAAAAGATGTTGG - Intergenic
970938693 4:21605940-21605962 ATTTCTAAGACAACAGAGGATGG - Intronic
971037620 4:22711943-22711965 ATTCATTAGTCAAAAGAGGATGG + Intergenic
971424076 4:26499490-26499512 ATTACTAAGTAAAAAGAGAAGGG - Intergenic
973338087 4:48976518-48976540 AAGGCTGAGCCACAAGAGGAAGG - Intergenic
973927752 4:55757044-55757066 TTGGCTAAATGAAAGGAGGAGGG - Intergenic
974100462 4:57410659-57410681 ATGCCTATGTTAAAAGAGGTTGG - Intergenic
974343078 4:60639268-60639290 ATTTCTAAGTCAAATGTGGAAGG - Intergenic
974750185 4:66129511-66129533 ATGGCTCAGGCAACAGAGGATGG - Intergenic
977587009 4:98785143-98785165 ATGGCTACCTCCAAAGAGGCTGG + Intergenic
978405474 4:108374078-108374100 ATGCAAAAGTCAAAAGAAGATGG - Intergenic
978780189 4:112544043-112544065 ATGTCTAATACAAAAGAGGTTGG + Intronic
979733391 4:124052472-124052494 ATGGGTGAGCCAAAGGAGGAAGG + Intergenic
981185064 4:141791692-141791714 AGTTCTAAGTGAAAAGAGGATGG + Intergenic
983458436 4:167995360-167995382 ATGCCTACATCAAAAGAGAAGGG - Intergenic
984093545 4:175406187-175406209 CTGGTTAAGTCAGAACAGGAAGG + Intergenic
984588717 4:181592361-181592383 ATGACTAAGTTTAAAGAGGCTGG + Intergenic
985237498 4:187892012-187892034 ATGGATAAGTAGACAGAGGAAGG + Intergenic
985247549 4:187993140-187993162 ATGGCCAGGTCAGAACAGGAGGG - Intergenic
989299763 5:39876972-39876994 ATGGCAGAGAAAAAAGAGGAAGG + Intergenic
990448487 5:55914768-55914790 ATGGCTGAGTCAAAAGAGTGAGG - Intronic
992301765 5:75389344-75389366 ATGGCCTAGTCAAAACAGAAAGG + Intronic
992442162 5:76806466-76806488 GTGGATGAGCCAAAAGAGGAGGG - Intergenic
992596481 5:78352686-78352708 ATGGCTAAGACATAAGAATAGGG - Intergenic
992818856 5:80473362-80473384 ATGGGTAACTGAAGAGAGGAAGG - Intronic
993284731 5:85978165-85978187 TTGGCTAAGTCAACTGATGACGG - Intergenic
993467601 5:88268230-88268252 ATGGCTAAGTGTAAAGAATAAGG + Intronic
994820077 5:104638040-104638062 ATACCTAATTCAAAAAAGGAAGG + Intergenic
996151067 5:120035557-120035579 ATGGCTAAAAAAAAAGATGAAGG - Intergenic
996867627 5:128144710-128144732 ATGACTAAAGCAAAAGAGTAGGG - Intronic
997008066 5:129843864-129843886 ATGCCTCAGTCAAAAGGAGAAGG - Intergenic
997718161 5:136057452-136057474 GTGGCTAAGAAAAATGAGGAAGG + Intronic
997802095 5:136873733-136873755 AAGGGTAAGTTAAAAGAAGAGGG + Intergenic
998157046 5:139792956-139792978 AAGACTCAGTCAAAAGAAGAAGG - Intergenic
999652273 5:153779178-153779200 ATATCTAAATCAAAAGATGAGGG - Intronic
999864529 5:155686098-155686120 ACAGCTAAGACAAAACAGGATGG + Intergenic
1001165983 5:169367650-169367672 ATGGCTTTGTGAAAAGATGATGG + Intergenic
1001609130 5:172985738-172985760 AGGGCTAAGTGGAAACAGGATGG - Intronic
1002012737 5:176296870-176296892 ATGGCTATGAAAAAAGGGGAAGG + Intronic
1002215103 5:177625864-177625886 ATGGCTATGAAAAAAGGGGAAGG - Intergenic
1005118972 6:22369628-22369650 ATAACTAAGTCAAATCAGGAAGG - Intergenic
1008706598 6:54168018-54168040 TGGGCAAAATCAAAAGAGGATGG - Intronic
1009393975 6:63175914-63175936 ATGGGTAAGACTAAAGAGAAGGG - Intergenic
1012211729 6:96526956-96526978 ATGGTGAAGTCAAAAGATGTTGG - Intronic
1013055676 6:106580327-106580349 ATGGGTAAGTAAAGAGAGAAGGG + Intronic
1013282082 6:108647996-108648018 AGAGCTAAGTGGAAAGAGGAGGG + Intronic
1016850987 6:148618838-148618860 ACGGCTAATTCAAAAGGTGATGG + Intergenic
1017447520 6:154520854-154520876 ATGGCTAAATCAAACTAAGAGGG + Intergenic
1018542889 6:164902128-164902150 ATGGCAAAGTGGAAAGAGGGTGG + Intergenic
1019102342 6:169641420-169641442 CTGGCCAACTGAAAAGAGGAGGG - Intronic
1021263440 7:18488208-18488230 ATAGCTTAGTCAACATAGGATGG + Intronic
1024303421 7:47905348-47905370 ATGTCTATGTCAACATAGGAGGG + Intronic
1026159302 7:67854514-67854536 CTGACTAAGTGAAAGGAGGAAGG - Intergenic
1027795799 7:82691639-82691661 ATGCCTAAGTAGACAGAGGAAGG - Intergenic
1030645763 7:112059715-112059737 ATGGACATGTCAAAAGAGGGGGG + Intronic
1031696178 7:124857682-124857704 AAGGGGAAGTGAAAAGAGGATGG - Intronic
1032448405 7:132004343-132004365 ATGACCAAGCCCAAAGAGGAGGG - Intergenic
1033741033 7:144276156-144276178 ACTGCTAAGTGAAAAGATGAAGG - Intergenic
1034134112 7:148749772-148749794 ATGATTAAGCCAAATGAGGAAGG + Intronic
1036636075 8:10550337-10550359 ATGGCCAAGTCAATGAAGGAAGG + Intronic
1037656515 8:20888496-20888518 ATGTCTGAGACAAAACAGGAAGG + Intergenic
1040279214 8:46029557-46029579 ATGCCTAAGTCACAGCAGGATGG + Intergenic
1041683221 8:60614797-60614819 ATGGCTAAGGAAGAAAAGGAAGG + Intronic
1041742728 8:61174322-61174344 AAAGTTAAGTCATAAGAGGAAGG + Intronic
1042386440 8:68180653-68180675 AGGGCAAAGTCAAAAGGGCAAGG + Intronic
1042413913 8:68497728-68497750 ATTGCTAAATGAAAAAAGGAAGG + Intronic
1042471554 8:69195310-69195332 ATGGCTGAGTAAAAAGGGTATGG + Intergenic
1043054705 8:75423246-75423268 AGAGCTAAGCCAAAAGAAGAGGG - Intronic
1043363405 8:79502378-79502400 GTGGCTAAGTTTAAAGAGCAGGG + Intergenic
1045331732 8:101161340-101161362 ATGGTTAAGTCCAAAGACAAAGG - Intergenic
1046158353 8:110324349-110324371 AAGGCAAAATCAAAAGAGTATGG + Intergenic
1046414864 8:113899508-113899530 ATAGCTAAGACACAAGAAGATGG - Intergenic
1046826920 8:118701863-118701885 AAGGCCAAGTCAAAAAGGGATGG - Intergenic
1047153123 8:122286995-122287017 ATGGCATAACCAAAAGAGGATGG - Intergenic
1047672279 8:127161230-127161252 ATGGCTCAGTTAAAAGAGAGTGG + Intergenic
1050156632 9:2673748-2673770 ATGGCTAAGTGAAAAAATGCAGG - Intergenic
1052278785 9:26708752-26708774 CTGTCTAAGTCAAAAGAAAATGG + Intergenic
1052395638 9:27934809-27934831 ATGGCAGAGTGGAAAGAGGATGG + Intergenic
1056343714 9:85667513-85667535 ATCACTAAGTGAAAAGTGGATGG + Intronic
1056462594 9:86822831-86822853 ATGACTAAGTCAGAACAAGAAGG - Intergenic
1056999510 9:91494464-91494486 ATGGAAAAGTCAAAAGGAGAGGG - Intergenic
1058379981 9:104367072-104367094 AGGGATAAGGAAAAAGAGGAGGG - Intergenic
1059332584 9:113545134-113545156 ATGCCAAATTCAAAAGGGGAAGG - Intronic
1060098949 9:120820563-120820585 AGGGCTAGGTTAATAGAGGATGG + Intronic
1060275709 9:122180775-122180797 ATGGCTAAGTGCTAAGAGGTAGG - Intronic
1061783495 9:133009135-133009157 ATTGCCAAGTGAAAAAAGGAAGG + Intergenic
1185858213 X:3555233-3555255 ATGGCTAGGCTAAAACAGGAAGG + Intergenic
1185960477 X:4542582-4542604 ATGGCTAGGCTAAAACAGGAAGG + Intergenic
1187930577 X:24290184-24290206 ATGGTTAAATTACAAGAGGAGGG + Intergenic
1187980848 X:24755741-24755763 ATGTCTACGTCACTAGAGGAGGG - Intronic
1188438295 X:30188016-30188038 ATCACAAAGTCAAAGGAGGAAGG + Intergenic
1189811242 X:44782481-44782503 ATGCCTTAGGCAAATGAGGATGG - Intergenic
1190552655 X:51600547-51600569 AGTGCTAATTCAAAAGAGCAAGG - Intergenic
1197760876 X:130027237-130027259 TGGGCTGAGGCAAAAGAGGAAGG - Intronic
1201345269 Y:12976649-12976671 ATGGCTAAGTCAAAGAACAAGGG + Intergenic
1201581587 Y:15515990-15516012 ATGGCTAGGTTAAAACAGTAAGG - Intergenic