ID: 1087533443

View in Genome Browser
Species Human (GRCh38)
Location 11:99413201-99413223
Sequence TGTTAAAGAGAGCAAGGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 533
Summary {0: 1, 1: 0, 2: 0, 3: 49, 4: 483}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087533437_1087533443 22 Left 1087533437 11:99413156-99413178 CCTGAAAAAAATACTTAGAGTCA 0: 1
1: 0
2: 2
3: 39
4: 381
Right 1087533443 11:99413201-99413223 TGTTAAAGAGAGCAAGGAAGAGG 0: 1
1: 0
2: 0
3: 49
4: 483
1087533436_1087533443 23 Left 1087533436 11:99413155-99413177 CCCTGAAAAAAATACTTAGAGTC 0: 1
1: 0
2: 1
3: 28
4: 324
Right 1087533443 11:99413201-99413223 TGTTAAAGAGAGCAAGGAAGAGG 0: 1
1: 0
2: 0
3: 49
4: 483

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087533443 Original CRISPR TGTTAAAGAGAGCAAGGAAG AGG Intronic
900079583 1:845733-845755 TGGTAAAGAGAGATAGGAATAGG - Intergenic
900869651 1:5292950-5292972 TGTTAATGAGAGAAAGGAGATGG + Intergenic
900938034 1:5779529-5779551 TAGGAAAGAGAGAAAGGAAGTGG + Intergenic
901177462 1:7315006-7315028 TGAAAAAGAGAGCAGGGATGAGG + Intronic
902202200 1:14842071-14842093 TGAGAAAGAGAGCAGGGAGGGGG - Intronic
902709302 1:18227684-18227706 TGTTGAAGAGAGGGAAGAAGAGG + Intronic
903095240 1:20965991-20966013 TGTGAAATAGAACAGGGAAGAGG - Intronic
903303322 1:22394206-22394228 TGAGAAAGAGAACAAGAAAGGGG + Intergenic
904192352 1:28755688-28755710 TCAGAAAGAGAACAAGGAAGGGG + Intronic
905111690 1:35599568-35599590 TGTAAAGGAGGGAAAGGAAGTGG + Intronic
905892000 1:41523575-41523597 TGGTATAGAGAGAACGGAAGGGG + Intronic
906815810 1:48877206-48877228 TGTCAAAGAAAGCAAGGTAGTGG + Intronic
908250246 1:62260083-62260105 TGTTGAGGAGAGCAGGGAGGTGG - Intronic
908335277 1:63116272-63116294 TGGTAAAGGGGGCCAGGAAGTGG + Intergenic
908884105 1:68767808-68767830 TGTTACAGACATCTAGGAAGGGG + Intergenic
909268909 1:73598491-73598513 TGTTACAGAGAGAAATAAAGAGG - Intergenic
909283093 1:73782158-73782180 TTTTAAAGAGATAAAGGCAGAGG + Intergenic
909385879 1:75056174-75056196 TGTTAAAAATAGCTAAGAAGAGG + Intergenic
910000498 1:82335706-82335728 TGTCATAGAGAGAAAGGTAGTGG + Intergenic
910931737 1:92449285-92449307 TATTAGAGAGAGCTAGAAAGAGG - Intergenic
912238227 1:107875996-107876018 TGTGGAATAGAGCAAAGAAGAGG + Intronic
912589265 1:110798328-110798350 TGGTAAAGGGAGCACAGAAGCGG + Intergenic
912969023 1:114262971-114262993 TTAAAAAGAGAGAAAGGAAGAGG + Intergenic
913475721 1:119235394-119235416 TGGGAAAGAGAGCAAAGGAGTGG + Intergenic
914258179 1:145977374-145977396 TTTAAAGGAGAGGAAGGAAGGGG - Intronic
915630187 1:157147934-157147956 TGTGGAAGAAAACAAGGAAGTGG - Intergenic
916352960 1:163873004-163873026 TGTGACAGAGAGCAAGGCAGTGG + Intergenic
916702314 1:167310180-167310202 TGTTAGAGAGGGGAAGAAAGGGG + Intronic
917121525 1:171648503-171648525 TGTTGAACAGAGCCTGGAAGAGG - Intronic
917208595 1:172606294-172606316 TCTTAATGAAAGCATGGAAGGGG - Intronic
917537037 1:175881836-175881858 TTTTACAGAGAGCAAGAAACAGG + Intergenic
918181565 1:182089155-182089177 TGTTAAGGAAAGGGAGGAAGAGG - Intergenic
918725241 1:187913285-187913307 TGTTCCAGATAACAAGGAAGGGG - Intergenic
920273878 1:204789227-204789249 TGTGAAAGAGAGCAAGAAGGAGG - Intergenic
920413489 1:205781369-205781391 TGTTGAATAGACCAAGGAGGAGG + Intergenic
920441126 1:205980902-205980924 TGTCAAAGAAAGGAAGAAAGGGG - Intronic
920560386 1:206934420-206934442 AGTTGAAGAGAGGAAGGCAGCGG - Exonic
920973918 1:210767898-210767920 TGTGGAAGAGAGGAAGGAGGAGG - Intronic
921989177 1:221345840-221345862 TTTTAGAGAGAAAAAGGAAGAGG + Intergenic
922474558 1:225898338-225898360 TGTTAACGAGAGCACTGTAGGGG + Intronic
923769801 1:236928533-236928555 AGATAAAAGGAGCAAGGAAGAGG - Intergenic
924874748 1:248090021-248090043 TTTTAAAGGGAGGGAGGAAGAGG - Intronic
1062974417 10:1672767-1672789 TGTTAGAGGGAGGGAGGAAGGGG - Intronic
1063138870 10:3239399-3239421 TGTGAAAGCGAGGATGGAAGGGG + Intergenic
1063870017 10:10406804-10406826 TTTTCAAGAGAGGAAGAAAGAGG - Intergenic
1064021008 10:11809143-11809165 TTTTAAAGAGCTTAAGGAAGAGG + Intergenic
1064425287 10:15224456-15224478 GGTAGAAGAGAGGAAGGAAGTGG - Intronic
1064500592 10:15968493-15968515 TGTGAAATAGAGCTAGGAAGAGG - Intergenic
1065555228 10:26908446-26908468 TGTGTCAGAGAGCAAGTAAGTGG + Intergenic
1065595625 10:27308360-27308382 TGTGTCAGAGAGCAAGTAAGTGG - Intergenic
1068503003 10:57864032-57864054 TGGTAATGAGAGTAAGAAAGTGG + Intergenic
1069455715 10:68552224-68552246 TCAAAAAGAGAGAAAGGAAGGGG + Intergenic
1069656900 10:70096677-70096699 GGGTAAAGTGAGCAAAGAAGGGG + Intronic
1070066988 10:73045620-73045642 TGTTAAAAACAGCAAGAAAGAGG + Intronic
1070765793 10:79055513-79055535 TGTTAAAAAGAGGCAGGGAGAGG + Intergenic
1071195595 10:83155457-83155479 TGTAAATGAAAGAAAGGAAGGGG - Intergenic
1072559366 10:96556710-96556732 TGCTAAAGGGAGCAAAGAAATGG - Intronic
1072625470 10:97108277-97108299 GGTTAAAGTGACAAAGGAAGTGG - Intronic
1072791098 10:98318469-98318491 TGTTGAAGACAGAGAGGAAGAGG + Intergenic
1073510834 10:104041346-104041368 TGCAGAAGAGAGCAAGGAAGAGG + Intronic
1074155017 10:110790369-110790391 TTTCAAAGAGAGCAAAGAGGAGG + Intronic
1074292287 10:112147161-112147183 TGTTAAAGTGATCAAGTAAACGG - Intergenic
1075900194 10:126036859-126036881 TTAGAAAGAGAGGAAGGAAGGGG - Intronic
1076577292 10:131477836-131477858 TGTAAAAGGCAGCGAGGAAGAGG - Intergenic
1077548334 11:3186809-3186831 TGTTCACGAGAGCAAAGACGTGG - Intergenic
1078632597 11:13016888-13016910 TGTTTGAGATAGCAAGGAATTGG - Intergenic
1079914168 11:26347886-26347908 TTTTACAGAGAGCAAGAAAAGGG + Intronic
1080516162 11:33022759-33022781 TGTTGAACAGAGCAAGAATGAGG - Intronic
1080759335 11:35233048-35233070 AGTTACACAGAGTAAGGAAGGGG - Intergenic
1081221364 11:40467235-40467257 TTTTAAACAGAGAAAAGAAGTGG - Intronic
1081731409 11:45374403-45374425 GGTTACAGACAGCAAGGGAGGGG - Intergenic
1081835547 11:46150324-46150346 TGTGAAAGAGGGAAAGGAAATGG - Intergenic
1082053853 11:47796503-47796525 TGAGAGAGAGAGGAAGGAAGGGG + Intronic
1082873688 11:57967143-57967165 TGATAAAAGGAACAAGGAAGAGG + Intergenic
1086366927 11:86116493-86116515 TGTTACAGAGAACAAGTAGGGGG + Intergenic
1086740094 11:90356273-90356295 TTTTAACAGGAGCAAGGAAGAGG + Intergenic
1086970265 11:93073843-93073865 TGTCTCAGAGAGAAAGGAAGAGG - Intergenic
1087273503 11:96137433-96137455 TGTTGAAGAGACAAAGGAATTGG - Intronic
1087311893 11:96554315-96554337 TGATAGAGTGAGCCAGGAAGTGG + Intergenic
1087533443 11:99413201-99413223 TGTTAAAGAGAGCAAGGAAGAGG + Intronic
1088030711 11:105246036-105246058 TTTTAAACAGATCAAGGCAGTGG - Intergenic
1088058294 11:105611211-105611233 TGCAAAGGAGAGAAAGGAAGAGG - Intronic
1088277303 11:108101453-108101475 GGGGAAAGAGAGCAGGGAAGAGG - Intronic
1089349990 11:117816755-117816777 TTGTACAGGGAGCAAGGAAGGGG - Intronic
1089712120 11:120323147-120323169 TGTTAAGGAGAGCAGGGGACAGG - Intergenic
1089787447 11:120918173-120918195 TGGGAAGGAGAGCAAGGCAGAGG - Intronic
1091637630 12:2209444-2209466 TGTGAAAGGGAGCGAGGGAGTGG + Intronic
1092173702 12:6389084-6389106 TGCTAAACAAAGCAGGGAAGGGG + Intronic
1092254216 12:6917425-6917447 TTTTCAAGAGAGCATGGATGAGG + Intronic
1093233736 12:16580395-16580417 TATTAAAGAGACCATAGAAGTGG - Intronic
1093499793 12:19798731-19798753 GGAGAAAGAGAACAAGGAAGAGG - Intergenic
1094597097 12:31875329-31875351 TGGGAAAGAGAGGAAGGAAGAGG + Intergenic
1095343519 12:41120954-41120976 TGTTATAGTTAGCAAGGGAGAGG + Intergenic
1096569995 12:52517074-52517096 ATTGAAAGAGGGCAAGGAAGGGG - Intronic
1096651705 12:53065081-53065103 TGGTAAAGAAAGGATGGAAGGGG + Exonic
1096947052 12:55418710-55418732 TGTTAAAGGCAGCTAGGAAGAGG - Intergenic
1097789633 12:63801238-63801260 TGTTAAAAAAAGCAAGGATTAGG - Intronic
1098246103 12:68519512-68519534 TGTTAAAATTAGCAAGGAATAGG - Intergenic
1099488330 12:83255512-83255534 TGTTAAATTGAGGAAGCAAGGGG - Intergenic
1100024378 12:90109803-90109825 TGTGTAAGAGAGAAAGGTAGAGG + Intergenic
1100234458 12:92645400-92645422 TGGTAAAGAGAGGAAGAAAAGGG + Intergenic
1101388935 12:104282630-104282652 TGTGAAGGAGAGCAATGAAATGG + Intronic
1102608661 12:114091287-114091309 TGTAAAAGAGAGATAGGCAGGGG - Intergenic
1103411327 12:120713868-120713890 TGTAAAAGAGAGCAAGAAGATGG - Intronic
1104224664 12:126819841-126819863 TTTTAAAGAGAGCAGGGATATGG - Intergenic
1104275691 12:127325369-127325391 TGGTAAAGAGAGCATGGAGGAGG - Intergenic
1104362173 12:128144308-128144330 TAACAAAGCGAGCAAGGAAGGGG - Intergenic
1104398885 12:128459405-128459427 GGTTTGAGAGACCAAGGAAGTGG + Intronic
1104832932 12:131766736-131766758 AATTAAAGAGAAAAAGGAAGAGG + Intronic
1106511282 13:30414873-30414895 AGATAGAGAGAGCAAGGCAGGGG - Intergenic
1107026492 13:35807111-35807133 TTTTAAAAAGAGCAATGAAAAGG + Intronic
1107438623 13:40404175-40404197 TGTTAAAGAAAGGTAGAAAGAGG - Intergenic
1107457510 13:40568377-40568399 TGTAAAAGAGAGGAAGGAGGAGG - Intronic
1107619559 13:42212191-42212213 ATTTAAAGAGAGTAAGGAATGGG - Intronic
1107895511 13:44958074-44958096 TGTGAGAGAGAGCAAGAAAAAGG - Intronic
1108240030 13:48454655-48454677 TGTGAAAGAGAGAAACGGAGAGG + Intronic
1108714134 13:53062011-53062033 TGATAGGCAGAGCAAGGAAGGGG - Intergenic
1108816792 13:54302189-54302211 TGGAAAAGAGAGCAAGAAAAGGG + Intergenic
1109634847 13:65101732-65101754 TGTTAAAGTGGGCATGGAATAGG + Intergenic
1109739852 13:66539191-66539213 TGTTAAAGAGGTGAAGGTAGTGG - Intronic
1110278387 13:73663764-73663786 TGTTAATCAGAGACAGGAAGGGG + Intergenic
1110776216 13:79411189-79411211 TTTGAAAAAGAGCAAAGAAGAGG - Intergenic
1111705160 13:91739704-91739726 TCTAAGAGAGAGCAAGGCAGAGG + Intronic
1112740217 13:102464653-102464675 TATTAAAAAGAGAAGGGAAGTGG + Intergenic
1113110434 13:106817365-106817387 TGTTAATGGTAGCATGGAAGTGG - Intergenic
1115131776 14:30062241-30062263 TGATAAAGAGATCAATTAAGAGG - Intronic
1115674902 14:35662244-35662266 TGATAAAGAGAGGCAAGAAGAGG + Intronic
1116369475 14:44110838-44110860 TGGTAAAAGGAGCAAGCAAGTGG - Intergenic
1117047730 14:51829609-51829631 TCTAAAAGAGAGCAAGGGAATGG - Intronic
1117114438 14:52495375-52495397 AAATAAAGAGAGCAAGGCAGAGG + Intronic
1117881228 14:60315508-60315530 AGTTAGGGAGAGCAAGGCAGGGG + Intergenic
1118375618 14:65174565-65174587 TGAGAAAGAGAGCAGGGGAGGGG - Intergenic
1118632784 14:67721489-67721511 TGGTAAAGAGCCCAAGGTAGGGG - Intronic
1118683949 14:68272287-68272309 TGAGAAATAGAGCCAGGAAGAGG - Intronic
1119145736 14:72312370-72312392 TAGTAAAGAGAGCTATGAAGTGG + Intronic
1119179368 14:72594659-72594681 AGTTGAGGAGAGCGAGGAAGTGG - Intergenic
1119201443 14:72755828-72755850 TGTTGAGGAGGGCAAGGAAGGGG - Intronic
1119750511 14:77074216-77074238 GGTTCAAGAGAGCAGGGAGGAGG + Intergenic
1120080543 14:80211385-80211407 AGTCATAGAGAGCCAGGAAGAGG + Exonic
1120421396 14:84290662-84290684 TGCTTAAAAGAGTAAGGAAGAGG - Intergenic
1120421788 14:84296089-84296111 TATCAAAGAGAGGAAGAAAGAGG - Intergenic
1120989588 14:90363349-90363371 AGTTAAAGAGACAAAGGAAGTGG - Intergenic
1121622627 14:95360914-95360936 AGTGAAAGAGATCATGGAAGAGG + Intergenic
1122325618 14:100879427-100879449 TGTCAAAGAGAGGACAGAAGAGG - Intergenic
1122815348 14:104309477-104309499 TGGGAAAGACAGTAAGGAAGGGG - Intergenic
1124182508 15:27490045-27490067 TGTTAAAGGTTGTAAGGAAGGGG + Intronic
1124583512 15:30984061-30984083 TCTGGAAGAGACCAAGGAAGCGG + Intronic
1124808440 15:32909479-32909501 TGTGAAAATGAGCAAGGAATTGG + Intronic
1124881334 15:33645634-33645656 TTCTATAGAGAGCAAAGAAGAGG + Intronic
1125293287 15:38173558-38173580 AGTTAAAGAGAGAAAAGAAGAGG - Intergenic
1125340363 15:38669502-38669524 TGTTCATGAGACCAAGAAAGTGG + Intergenic
1125777406 15:42229387-42229409 TATAAAAAAGAGAAAGGAAGAGG + Intronic
1125875942 15:43144713-43144735 TGTTAATGTGAGAAAGGAAGAGG + Intronic
1126365202 15:47886847-47886869 GGTCAAAGAGAGGAAAGAAGTGG - Intergenic
1127253087 15:57262920-57262942 TGTTAAAAAGCACAAGGATGTGG + Intronic
1128190291 15:65687084-65687106 TCTTAAAGAGGCCAAGAAAGGGG - Intronic
1129069881 15:72941958-72941980 TGTTACAGAAAGTAAGAAAGAGG + Intergenic
1129084628 15:73075855-73075877 TGGAAAAGAGAGGAAGGAAGGGG - Intronic
1129877306 15:78984100-78984122 TGATAAAGAGAACAATGAGGGGG + Intronic
1130043235 15:80423753-80423775 TGTGAAAGAGAGGGAGAAAGAGG + Intronic
1130677511 15:85966429-85966451 TGCTAAAGAGGTAAAGGAAGAGG - Intergenic
1130901181 15:88207855-88207877 TTTTAAAGGCAGCCAGGAAGGGG - Intronic
1131548374 15:93334466-93334488 TTTTAAAGGAAGCAAGAAAGAGG - Intergenic
1131599271 15:93830161-93830183 AGAGAAAGAGAGCAGGGAAGGGG - Intergenic
1133477744 16:6139701-6139723 TGAGGAAGAGAGCAAGAAAGAGG - Intronic
1133538637 16:6726110-6726132 TGTTACACAGAGCCAGGAGGGGG + Intronic
1135523848 16:23198402-23198424 TATGAAAGAGAGAAAGGGAGAGG - Intronic
1137268907 16:46889925-46889947 TGCTCAAGACAGCAAGGCAGAGG - Intronic
1137622420 16:49884640-49884662 GGATAAAGAAAGGAAGGAAGGGG + Intergenic
1137822799 16:51461852-51461874 TTTGAAGGAGAGCAAGGAGGGGG - Intergenic
1138006701 16:53343840-53343862 GGTTAGAGAGAGGAAGTAAGAGG - Intergenic
1139025304 16:62809452-62809474 TCTTAAAAACAGCAAGAAAGAGG - Intergenic
1139052630 16:63144986-63145008 TGAGAAAGAGAGCATGGAACAGG - Intergenic
1139818944 16:69703906-69703928 TGGAAGAGAGAGAAAGGAAGGGG - Intronic
1141527558 16:84621509-84621531 TGTAAAAGAAAGAAAGGATGAGG + Intergenic
1141841557 16:86577162-86577184 TGTCAAAGAGATGAGGGAAGGGG - Intronic
1143557795 17:7673290-7673312 TGTTAAAGAGAGCATGAAAATGG - Intronic
1144065675 17:11622113-11622135 TGTTACTGGGAGCAAGAAAGAGG + Intronic
1146809649 17:35892885-35892907 TGGTGAAAAGAGCAAGGAATGGG + Intergenic
1147968519 17:44207112-44207134 TTTTAAAGAAAGAAAGAAAGTGG + Exonic
1148249568 17:46064387-46064409 TGTAAAAGAGAGCAGAGAATGGG - Intronic
1148332412 17:46820333-46820355 GTTGAAAGAGAGGAAGGAAGGGG + Intronic
1148584751 17:48769476-48769498 TGTGAATGAGAACCAGGAAGTGG + Intronic
1150920083 17:69473645-69473667 TGTTGAAGAGTGCAAGAAATTGG + Intronic
1151035755 17:70797318-70797340 TGATAAAGAAAGGAAGGAAATGG - Intergenic
1151573449 17:74938825-74938847 AGTCCAAGAGAGCAAGGAAGGGG + Intronic
1151719946 17:75849258-75849280 TTTTCATGAGAGCCAGGAAGAGG - Intronic
1151737816 17:75955954-75955976 TATCAAAGAGAACAAGGGAGGGG + Intronic
1152541622 17:80979612-80979634 GCTTGAAGAGAGCCAGGAAGGGG - Intergenic
1153181129 18:2434964-2434986 GGTGAGAGAGAGCAAGCAAGAGG - Intergenic
1154296468 18:13154361-13154383 TGTTAAAAAAAGAAAGAAAGTGG - Intergenic
1155346691 18:24864329-24864351 TGTTCACCAGAGCAAGGATGGGG - Intergenic
1155660862 18:28246866-28246888 TGTTCACCAGAGAAAGGAAGTGG + Intergenic
1155671777 18:28380164-28380186 TGAAAAAGAGAACAATGAAGGGG - Intergenic
1155885791 18:31206617-31206639 TGCCAAAAAGAGAAAGGAAGGGG - Intergenic
1157303623 18:46499756-46499778 TGTAATAGGGAGAAAGGAAGGGG - Intronic
1157483448 18:48070640-48070662 TGTTTAAGGGAGCAATGAATGGG - Intronic
1158367902 18:56760340-56760362 TGTAAAAGAAAGAAAAGAAGTGG - Intronic
1158826483 18:61225928-61225950 GTTTAAAGAGAGAAAAGAAGAGG + Intergenic
1158998392 18:62947202-62947224 TGTTAAAGAAAGAAAAGAATTGG + Intronic
1159345122 18:67192178-67192200 TGAGACAGAGAGCAAAGAAGAGG - Intergenic
1159411805 18:68086284-68086306 AGTTAAAGCGAGAAAGGAATAGG - Intergenic
1159574860 18:70162944-70162966 AGTTAAAGAAAGCAAAGAAAAGG + Intronic
1159871358 18:73762347-73762369 AGATAAAGAGAGAGAGGAAGGGG - Intergenic
1159942805 18:74421465-74421487 TGTTTGAGAGAGAAGGGAAGGGG - Intergenic
1160257740 18:77261643-77261665 TGGGAAAGACAGGAAGGAAGTGG + Intronic
1162192399 19:8957216-8957238 TGGTAAAGACAGAAGGGAAGAGG + Exonic
1162433155 19:10641550-10641572 GGTTAAAGAAAGCAAGGGTGAGG + Intronic
1162891612 19:13737324-13737346 AGCTGAAGAGAGCAAAGAAGTGG - Intronic
1163991613 19:21003781-21003803 AGTGAAAGAGAGAAAGAAAGAGG + Intergenic
1164426024 19:28142604-28142626 AGGGAAAGAGAGGAAGGAAGAGG + Intergenic
1164785813 19:30929747-30929769 GGGTAAAGAGAGCTAGGAGGTGG - Intergenic
1165239339 19:34451910-34451932 TGTTAAACAGAGCACAGTAGAGG + Intronic
1166348592 19:42182631-42182653 AGCAAAAGAGAGAAAGGAAGAGG + Intronic
1167561145 19:50226770-50226792 AGGTAGAGGGAGCAAGGAAGTGG + Intronic
1167776467 19:51560851-51560873 TGGTAAAGATAGCAGGAAAGAGG - Intergenic
1167867642 19:52341136-52341158 TCTTAAATAGAGCATGCAAGAGG - Intronic
1167970398 19:53185864-53185886 TCTTAAATAGAGCATAGAAGAGG + Intronic
925351948 2:3207292-3207314 TGTTAAGGAGTGGCAGGAAGGGG + Intronic
925874741 2:8302192-8302214 TGTTGAAGAGAGAGAGGCAGAGG - Intergenic
926937235 2:18098200-18098222 TGTAAAACAAAACAAGGAAGAGG - Intronic
927059991 2:19408164-19408186 TGAGAAAGAGAGGAAAGAAGAGG + Intergenic
927363532 2:22266140-22266162 TTATAAAGATAGCCAGGAAGTGG - Intergenic
928123938 2:28603255-28603277 TGTAACAGAAAGCAAGGAAAAGG + Intronic
928177098 2:29041829-29041851 TGGTAGAGAGACCAATGAAGAGG - Intronic
929043156 2:37766166-37766188 TGTTAATTAGTGAAAGGAAGGGG + Intergenic
929399473 2:41563346-41563368 AGTGAATGGGAGCAAGGAAGAGG - Intergenic
929423405 2:41818725-41818747 TGTTATAAATAGAAAGGAAGTGG + Intergenic
929746852 2:44667955-44667977 TGTTGAAGTGAGAGAGGAAGGGG - Intronic
930117766 2:47733348-47733370 TGTGAAAGGGAGAAAGAAAGAGG - Intronic
930547407 2:52785882-52785904 TGGTAAAGTGAGCAAGGAGCAGG - Intergenic
930868543 2:56146783-56146805 AGTTAAATTGAGCAAGGAACAGG - Intergenic
931147265 2:59533153-59533175 TATAAAAGAGGGCAAGGGAGAGG - Intergenic
931450704 2:62365469-62365491 TGTTAATGAGAGAGAAGAAGAGG - Intergenic
931772914 2:65514353-65514375 TGTTAAAGAAAGGATGGAATGGG + Intergenic
932850710 2:75182147-75182169 TGTTTCAGACAGCAAGAAAGGGG + Intronic
933640028 2:84748959-84748981 TGTGAGAGAGAGCAAGAAAGAGG + Intronic
934104294 2:88681744-88681766 TGTTAATAAGGGCATGGAAGTGG - Intergenic
935205754 2:100895481-100895503 TGTGAAAGGGAGAAAGGCAGTGG - Intronic
935473065 2:103482808-103482830 TTTTAAAGGGAGCAAGTGAGTGG + Intergenic
935825870 2:106948692-106948714 TGAGAAAGAAAGCAAGGAATGGG - Intergenic
936683538 2:114802482-114802504 TCATAAAGAGAGCAGGGAAGAGG - Intronic
936747259 2:115592282-115592304 TATAAGAGAGAGAAAGGAAGAGG + Intronic
937158942 2:119742002-119742024 TGTAAAAGTGTGCAAGGGAGTGG - Intergenic
937393406 2:121513441-121513463 TTTTAAAGAGAAGAAGGAGGGGG + Intronic
937763274 2:125630962-125630984 GGTGAGAGAGAGCAAGGGAGGGG + Intergenic
937964446 2:127491742-127491764 TATTAAAAATAGCAAGTAAGAGG - Intronic
938101826 2:128502866-128502888 TGTTGAACAGAGCAAGGAAAGGG - Intergenic
938135656 2:128754494-128754516 TGTAAAGGACAGCAAGCAAGTGG - Intergenic
938703713 2:133901417-133901439 TCTAAAATAGAGCAAGGAATGGG - Intergenic
938756149 2:134381006-134381028 TTTTAAAAAGAGCAAGAAAGGGG - Intronic
939548355 2:143581898-143581920 GGGTAAAGGGAGGAAGGAAGAGG + Intronic
940320287 2:152369717-152369739 TGTGAAAGAATGCAAGGATGTGG + Intronic
940460578 2:153958809-153958831 TGTGGAAGAGAGAAAGGAAAGGG + Intronic
940686273 2:156855178-156855200 TGGTAAGGGGAGCAAGGAAGAGG + Intergenic
940720864 2:157280321-157280343 TATAAAAGAGAGCCAGGCAGAGG + Intronic
940764996 2:157780602-157780624 TGCAAAGGAGAGAAAGGAAGGGG + Intronic
941039491 2:160604681-160604703 TGAAAAAGAGGGCAAGGAACAGG - Intergenic
941135463 2:161712044-161712066 TGATAAAGAGATTAAGGGAGAGG - Intronic
941163784 2:162063778-162063800 TGGTAAAGAGAGCAGAGAAAGGG + Intronic
941164099 2:162066808-162066830 TGAGAAAGAAAGCAAGAAAGAGG + Intronic
941469504 2:165866951-165866973 TGTAAAAGAGAGAAAGGCTGTGG + Intronic
941507969 2:166371347-166371369 TGATAAAGTGGGGAAGGAAGAGG - Intronic
941698137 2:168575431-168575453 TTTTAAAGAGAGTGAGGAAGTGG - Intronic
942818838 2:180086238-180086260 TGTTGGAGAGAGAATGGAAGAGG - Intergenic
943382322 2:187166493-187166515 TGAAAAAGAAAGCAAAGAAGGGG - Intergenic
945321630 2:208430863-208430885 TCTTAAAGAGAGCCAGACAGAGG - Intronic
945417293 2:209590122-209590144 TGCTAATGAGAGCATGGATGGGG - Intronic
947021010 2:225675571-225675593 TGTTCACAATAGCAAGGAAGTGG - Intergenic
948313279 2:237006046-237006068 TGTGAAAGAGAGCAAATGAGGGG - Intergenic
948681453 2:239637925-239637947 TGATAAGGACAGCAAGGAAAGGG - Intergenic
1169385759 20:5148106-5148128 TGTTGAAGAGAGCTAGTAATGGG + Intronic
1172180217 20:32998667-32998689 TGTTAAATAGAACTAGCAAGAGG - Intronic
1172758518 20:37305421-37305443 TCTTAAAGAGAACAATAAAGGGG - Intronic
1172783276 20:37449968-37449990 TGTTAATGAGAACAGGAAAGGGG - Intergenic
1173438978 20:43058301-43058323 GGTGAAAGAGGGCAAGAAAGAGG + Intronic
1175200213 20:57271666-57271688 GGTTAAAGCAAGGAAGGAAGGGG - Intergenic
1175346212 20:58278315-58278337 TCTTAAAGAAAGCAAGGAAAGGG + Intergenic
1176673543 21:9756035-9756057 TGTTGAAGAGAGGAACGCAGGGG - Intergenic
1176898526 21:14412921-14412943 TGTTAATGAGATCAGGGAGGTGG + Intergenic
1177477844 21:21646530-21646552 AATTAAATAGAGCACGGAAGAGG - Intergenic
1177657811 21:24041865-24041887 TGGTAAAGAGATCAAGAGAGAGG - Intergenic
1178280177 21:31275372-31275394 AGTTGAAGAGAGTAAGGATGTGG + Intronic
1178550292 21:33532374-33532396 TGTTGCAAAGAGCAAAGAAGAGG - Exonic
1179266542 21:39808362-39808384 TGAAAAAGAGAGCAAGAGAGAGG - Intergenic
1179448472 21:41451035-41451057 TGGTAAAGAGAAGAAGGGAGCGG + Intronic
1179521168 21:41946086-41946108 TAATAAAGACAGTAAGGAAGAGG + Intronic
1182558842 22:31143313-31143335 TGCGAAAGAGAGGAAGGAAGAGG + Intergenic
1182921289 22:34082166-34082188 TGATAAAGGGAGCAAGAGAGAGG + Intergenic
1183071105 22:35396905-35396927 TGACAAAGAAAGGAAGGAAGAGG + Intergenic
1183399770 22:37595755-37595777 TGTGACAGAGAGCAAGTCAGTGG - Intergenic
1184060493 22:42078358-42078380 TGTTAATGAAATGAAGGAAGTGG + Exonic
1184324251 22:43770754-43770776 TGTTTAAGAGAGGAAAGAATGGG + Intronic
1185363755 22:50424970-50424992 TATAAAAGAGAGGAAGAAAGTGG - Intronic
1203295325 22_KI270736v1_random:37665-37687 TGTTAATTAGTGAAAGGAAGGGG + Intergenic
949723333 3:7015814-7015836 TGTAAGAGAGAGCAAGAAGGAGG + Intronic
951056077 3:18147880-18147902 AGCTAAAGATAGCAAGTAAGGGG + Intronic
951165016 3:19474949-19474971 TATCAAAAAGAGCAATGAAGAGG + Intronic
951166749 3:19491324-19491346 TGCTAGAGAGAGCGGGGAAGGGG - Intronic
952081358 3:29761438-29761460 TGGTAGAGAGAGCAAGCATGTGG - Intronic
952395831 3:32919781-32919803 TGTTAAGAAGAGTATGGAAGCGG - Intergenic
952940528 3:38441001-38441023 AGTCAAAGAGAGAAAGAAAGAGG - Intergenic
955301415 3:57783642-57783664 TGTTTAAGAGAGCAAGCCAAGGG + Intronic
955391486 3:58525529-58525551 TGCTAAAGCGAGCAAGGTAGGGG + Intronic
956259086 3:67317305-67317327 TGATAAAGGGAGCCAGGGAGCGG + Intergenic
956748977 3:72331509-72331531 TGGCTAAGGGAGCAAGGAAGGGG - Intergenic
956903505 3:73741541-73741563 AGGTAAAGAGAGAAAGGAAGAGG + Intergenic
957111074 3:75958623-75958645 GGATATAGAGAGCAAGGAAGTGG + Intronic
957935125 3:86932419-86932441 TGCTAAAGCGAGCCAGGAACAGG - Intergenic
958265393 3:91432187-91432209 TGGTCAAGAGAGCAGGGATGGGG - Intergenic
958647907 3:96896432-96896454 TGTTAAAGTGGGCAATGAAATGG + Intronic
959633582 3:108536300-108536322 TGTTTAAGACAGAAAGGAGGAGG + Intergenic
960362570 3:116731808-116731830 TGTGAAAGAGAGAAAGAGAGAGG + Intronic
960378809 3:116935114-116935136 ACTTATAGAGAGCCAGGAAGGGG - Intronic
960795003 3:121476155-121476177 TGTTAGGGCAAGCAAGGAAGGGG + Intronic
960811254 3:121629552-121629574 TGCTACATAGAGAAAGGAAGAGG + Exonic
961111834 3:124290887-124290909 TGTTATGGAGAGAAGGGAAGAGG + Intronic
961145408 3:124588939-124588961 AGGTAAAGAGAGGAAGGAGGTGG + Intronic
962809420 3:138948159-138948181 TGTGAAAGAAAGGAAGAAAGGGG - Intronic
962916222 3:139906223-139906245 TGTCAATGAGAGCAAGAAAGTGG - Intergenic
964177217 3:153838527-153838549 TGGAAAAGAGAGAAAGTAAGTGG - Intergenic
964368928 3:155978827-155978849 TGTTTATGATAGCAAGGAACTGG - Intergenic
964911722 3:161790566-161790588 TGTTCATGAGGGGAAGGAAGAGG + Intergenic
965171319 3:165268259-165268281 TTTGAGAGAGAGCAAGGAACAGG - Intergenic
965513216 3:169592329-169592351 TGTGAAAGTCAGAAAGGAAGAGG - Intronic
965918978 3:173889410-173889432 TGACAAAGAGAGCAAAAAAGAGG + Intronic
966542651 3:181108813-181108835 TGTCAAAGAAAGCATGAAAGTGG - Intergenic
966547780 3:181170270-181170292 GGATAAAGAGAGAAATGAAGGGG - Intergenic
967210141 3:187161312-187161334 TGTTAAGGAGAAGAAGGAAGCGG - Intronic
967274769 3:187763501-187763523 GGTTAAAGAGAGGAAGTATGGGG + Intergenic
967452148 3:189637597-189637619 TGTTAAAGAGAGCTTTGAACTGG - Intronic
967662135 3:192125695-192125717 TGTTGGAGAGGGTAAGGAAGGGG + Intergenic
967828254 3:193896247-193896269 TTTGAAAGAGAGAAGGGAAGAGG + Intergenic
967903280 3:194478970-194478992 TTTTATAGGTAGCAAGGAAGGGG - Intronic
968739780 4:2321671-2321693 AGTGAAACAGAGCAGGGAAGGGG + Intronic
969110072 4:4839044-4839066 TGAGAAAGTGAGCAAGGGAGAGG + Intergenic
969178354 4:5417474-5417496 TTTTAAAGAAATGAAGGAAGAGG - Intronic
969907657 4:10412102-10412124 TGAGAAAGAGAACAAGGCAGGGG - Intergenic
970037452 4:11753835-11753857 GGTTAAAGAGAGAAAGGAAAAGG - Intergenic
970756433 4:19432273-19432295 TGCTAAAAAAAGCAAGAAAGTGG + Intergenic
970829862 4:20324384-20324406 TGGCAAAGAGAGCAGGGAAATGG - Intronic
971578671 4:28306887-28306909 TATTTAAGAGAGCAAGGTATAGG - Intergenic
971581490 4:28347139-28347161 TCTTAAAATGAGAAAGGAAGAGG - Intergenic
973887522 4:55337947-55337969 TGATAAATGGAGTAAGGAAGGGG + Intergenic
974134668 4:57800135-57800157 ACTTAAAGAAAGCAGGGAAGTGG - Intergenic
974234481 4:59163016-59163038 TCTTAAAGGGAGCAGGCAAGTGG - Intergenic
974269860 4:59635928-59635950 TGGAAAAGAGAAAAAGGAAGGGG + Intergenic
974316667 4:60290837-60290859 TGTTTCAGGGAGCAAGGCAGAGG + Intergenic
975415529 4:74099921-74099943 TTTCAAAGAGAGAAAGGATGGGG - Intergenic
975497121 4:75047041-75047063 AGTTATAGAGAGAAAGGGAGAGG + Exonic
975948759 4:79742425-79742447 TATTGAAGAGAGGAGGGAAGTGG + Intergenic
976541620 4:86284052-86284074 TGTTGAAAAGAGAAAGGAGGAGG - Intronic
978174931 4:105718386-105718408 TGCAAGAGAGAGCAAGGAAGAGG - Intronic
978357596 4:107893403-107893425 TGCTAAAGAGAGACAGGAAATGG + Intronic
979286341 4:118929178-118929200 AGGGAAAGAGAGAAAGGAAGAGG + Intronic
982171252 4:152663695-152663717 TTTTAAAGAGATAATGGAAGTGG + Intronic
982387112 4:154819917-154819939 TTTTTAAGACAGCAAGGAAATGG + Intronic
983001030 4:162413955-162413977 TGTTGTAGAAAGCAAGGAAAGGG + Intergenic
983645060 4:169981327-169981349 TGTTGAAGAGGGTAAAGAAGAGG - Intergenic
986212120 5:5683768-5683790 TGTTAGAGAGAGCCAGAGAGTGG - Intergenic
986363513 5:7005583-7005605 TGTAAAAGAAAGCATGGAAGAGG - Intergenic
987073343 5:14358303-14358325 TGTCAACGTGATCAAGGAAGGGG + Exonic
987705210 5:21454774-21454796 TGGTAGAGAGAACATGGAAGGGG - Intergenic
988912851 5:35862401-35862423 TGTTTGAGTGGGCAAGGAAGTGG - Intronic
989153883 5:38325816-38325838 TCTGGAAGAGAGGAAGGAAGAGG + Intronic
989359002 5:40578101-40578123 TGTTAAATAAAGCAAGAGAGAGG + Intergenic
989542623 5:42635283-42635305 TATTTCAGAGAACAAGGAAGGGG - Intronic
991399596 5:66239304-66239326 TGAAAAAGAAAGCAAGAAAGGGG + Intergenic
991455494 5:66799273-66799295 GGGTAAAGAGGGCAAGGAAGAGG - Intronic
992779259 5:80113456-80113478 TTTTCAGGAGAGCAAGGATGGGG + Intronic
992985204 5:82221210-82221232 TGCTAAAGAGAGAAATGCAGAGG - Intronic
993294472 5:86118143-86118165 TGAGAAAGAGAGCAAGGTATAGG - Intergenic
993981448 5:94547257-94547279 CCTTAAAGAGAGAAAGAAAGGGG + Intronic
994863257 5:105227215-105227237 TGATAAAGAGAGCAATGCACTGG - Intergenic
996394954 5:123004454-123004476 TGCTAGAGAGTGGAAGGAAGTGG - Intronic
997084119 5:130776308-130776330 TGGTAAAGAGAGACAGGAAATGG + Intergenic
997371961 5:133367676-133367698 TGTTAAGAAGTGCAAGGAAGCGG + Intronic
998462542 5:142320452-142320474 TGTGAAAGAGAGAAGAGAAGAGG - Intronic
998595879 5:143529859-143529881 TATTAAATAGAGCAAGAAAGTGG + Intergenic
998676840 5:144418694-144418716 TGTTAAAGTGAGAAAAGAATTGG - Intronic
999326212 5:150645274-150645296 TGCTAATGAGGGCAAGGGAGGGG + Intronic
1000109367 5:158093324-158093346 GGTTTAAAAGAGAAAGGAAGGGG - Intergenic
1000812810 5:165883796-165883818 GGGTAACAAGAGCAAGGAAGAGG + Intergenic
1001549816 5:172594771-172594793 TATTATAAAGAGGAAGGAAGGGG - Intergenic
1001947033 5:175787801-175787823 AGTTAAAGAGAGAAGGAAAGGGG - Intergenic
1002675907 5:180912367-180912389 AGATAAAGAGAGAAAGGAAGAGG - Intronic
1002914380 6:1517293-1517315 TGGTCAAGAGAGGCAGGAAGTGG + Intergenic
1003943062 6:11047200-11047222 TATTAAATAGAAAAAGGAAGTGG + Intergenic
1004289535 6:14353517-14353539 AAAGAAAGAGAGCAAGGAAGTGG - Intergenic
1004771925 6:18793571-18793593 TGGAAAAGAGAGCAAGGAAATGG + Intergenic
1005277728 6:24238087-24238109 TTTTAAAGAAAGAAGGGAAGGGG + Intronic
1006510305 6:34517751-34517773 TGTAAAGGAAAGCAAGGCAGGGG - Intronic
1006627437 6:35407231-35407253 TGGTGATGAGAGCCAGGAAGAGG - Intronic
1006671597 6:35732690-35732712 TGGTAAAGAGAATGAGGAAGGGG + Intergenic
1006853294 6:37114971-37114993 GGTTAAAGAGAGAATGGAAGGGG - Intergenic
1007560651 6:42805699-42805721 TGCTAAAGAGGACAAGGAACGGG + Intronic
1007852713 6:44820757-44820779 TGAAAAAGAAAGCAAGGAAAGGG + Intronic
1007870610 6:45033119-45033141 TGTTAAGAAGAACAAGTAAGGGG + Intronic
1008313001 6:50001179-50001201 TGGGAAGGAGAGTAAGGAAGAGG + Intergenic
1008393314 6:50978338-50978360 TGGTAATGACAGCAGGGAAGGGG - Intergenic
1009051892 6:58285447-58285469 TGTAAAAGAGAAGAAGCAAGAGG - Intergenic
1010910055 6:81542633-81542655 TGGGAAAGAGAGCAGGGAGGGGG + Intronic
1011480356 6:87787657-87787679 TCTTTAAGAGAGAAAAGAAGAGG - Intergenic
1011535288 6:88370062-88370084 TGAGAAAGAGAGAAAGGAAAAGG + Intergenic
1012832844 6:104227625-104227647 GCTTAAAGAGAGGCAGGAAGGGG - Intergenic
1014190823 6:118494688-118494710 TGGTAAAGTGTGCAGGGAAGGGG - Intronic
1014677853 6:124389921-124389943 TGTTGAAGAGGGCATGGAAATGG + Intronic
1016308601 6:142709967-142709989 TGGTAAAGAGACAAAGGAAATGG - Intergenic
1016508334 6:144810564-144810586 TGTGAAATAGAGCAAGGTAATGG + Intronic
1016998613 6:149979078-149979100 TGCTGAAGAGAACAAGTAAGTGG + Intergenic
1018569996 6:165199570-165199592 TGTGAAAGTGAGAAAGGATGGGG + Intergenic
1018606217 6:165600571-165600593 GGTTAAAGGGAGAGAGGAAGAGG - Intronic
1018700519 6:166422547-166422569 TGGTAAAGAGAGGAAGGGAAGGG - Intronic
1020634060 7:10674892-10674914 TGTTAAAGAGAGAGAAAAAGTGG + Intergenic
1020977052 7:15019520-15019542 TGTTACAGAGAGAAACGGAGTGG + Intergenic
1021497798 7:21295114-21295136 TGTGAAAGAGGGGAAGGGAGAGG + Intergenic
1023156253 7:37255602-37255624 TGGTAAAGACAGCAAAGCAGGGG - Intronic
1023379160 7:39588687-39588709 TGTTAATAAGACCAAGTAAGTGG - Intronic
1023482105 7:40645271-40645293 TGTTCTAGAGAGCAAGTGAGAGG + Intronic
1025009941 7:55388538-55388560 TGTTAAAGAAAGGAATGGAGAGG + Intronic
1025839596 7:65133261-65133283 TGTTACTGAGTGGAAGGAAGAGG + Intergenic
1025883471 7:65562704-65562726 TGTTACTGAGTGGAAGGAAGAGG - Intergenic
1025889974 7:65639902-65639924 TGTTACTGAGTGGAAGGAAGAGG + Intergenic
1026213489 7:68327569-68327591 TGAGAAAGAGAGAAAGGAAGAGG - Intergenic
1026326575 7:69315694-69315716 GGTTAAAGAGAACAGGGAGGTGG - Intergenic
1026658873 7:72281177-72281199 TGTTAGAGAGAGAATGAAAGAGG - Intronic
1027683058 7:81244337-81244359 AGTCAGACAGAGCAAGGAAGGGG + Intergenic
1028012132 7:85659358-85659380 TGTTAAACAGGGCAAGGAGGAGG - Intergenic
1028250156 7:88530663-88530685 TGGTAAATAGAGGAAGGAATAGG + Intergenic
1029130994 7:98330802-98330824 TGTGAGAGGGAGCAAGGGAGTGG + Intronic
1029259736 7:99293651-99293673 TGACAAATAGAGCCAGGAAGGGG - Intergenic
1029991619 7:104967576-104967598 TGTCCAATAGAGGAAGGAAGGGG + Intergenic
1030568153 7:111186924-111186946 TTTTAAAAAAAGCAAGGACGAGG - Intronic
1030787538 7:113681190-113681212 TGTTAAAAACAACAAAGAAGAGG + Intergenic
1031075577 7:117209132-117209154 TGTAGAAGATAGCAATGAAGAGG + Intronic
1031152717 7:118073345-118073367 AGTGAATGAGAGCAAGCAAGAGG - Intergenic
1031196012 7:118614693-118614715 TGATGAAGAGGGCAGGGAAGTGG + Intergenic
1031852502 7:126882083-126882105 TGTTACTGAGTGGAAGGAAGAGG - Intronic
1033113902 7:138608267-138608289 TCTGAAAAAGAGCAATGAAGTGG + Intronic
1033466431 7:141594489-141594511 CCTTAAAGAGAGAAAGAAAGGGG - Intronic
1033529691 7:142249209-142249231 TTTTACAGAGAGCAAGAAGGAGG - Intergenic
1033911307 7:146266597-146266619 TGTTAAAGAGAAAAAAGAAAAGG + Intronic
1033970187 7:147029428-147029450 AGTTTAAGAGAGCATGGAAGAGG + Intronic
1035108103 7:156458824-156458846 AGTTAAAAAGAGCCAGGATGTGG - Intergenic
1036190168 8:6662932-6662954 TGGAAAAGAGACCAAGGGAGAGG + Intergenic
1036503236 8:9332542-9332564 AGTTAAAGACAGCAAGGGAGAGG - Intergenic
1036928132 8:12927431-12927453 TACTAAAGAGATCATGGAAGAGG - Intergenic
1036977815 8:13434513-13434535 TGTTTAAGAGAGAAAGCAAGAGG + Intronic
1036987107 8:13546018-13546040 TGTTAAAGAGAATGGGGAAGTGG + Intergenic
1037880239 8:22570090-22570112 TGTTCTAGAAAGCAGGGAAGTGG + Intronic
1038043519 8:23746851-23746873 TGTTAAAAATTGCAAGGCAGGGG - Intergenic
1038235665 8:25751623-25751645 TATTCAAGAGAGCAAGAAATAGG - Intergenic
1038486956 8:27942632-27942654 AGTTAAAGTGGGGAAGGAAGTGG - Intronic
1038695327 8:29801479-29801501 GGTGAAAGAGAGAAAGGAAGAGG + Intergenic
1038762120 8:30393990-30394012 TGCTAAAGAGAAAAAGGAAATGG + Intronic
1039200628 8:35089381-35089403 AGTGAAAGAGAGAAAGAAAGAGG - Intergenic
1039223866 8:35366076-35366098 TGGGAAAGAGAGGAAAGAAGAGG + Intronic
1040793254 8:51258530-51258552 ACTTAAAGAGAGAAAGGAAATGG + Intergenic
1040884373 8:52243860-52243882 TGTGAAAGAGAGAAAGAGAGAGG + Intronic
1041703460 8:60818103-60818125 TATAAAAGAGAGGGAGGAAGGGG - Intronic
1042871819 8:73406653-73406675 TGTTAAAGAGAGAATGAATGAGG + Intergenic
1043514667 8:80985081-80985103 TGTGAAAGAGATCAAGGAGGTGG - Exonic
1043915394 8:85916990-85917012 TGTAACAGAGAGAAAGTAAGAGG - Intergenic
1044483076 8:92715823-92715845 TGTTAAAGTAATCAAGGAAAGGG - Intergenic
1044997838 8:97854131-97854153 TGATTAAGAGAGGAAGGAAGGGG + Intergenic
1045701426 8:104871076-104871098 TGTTAAAAAAACCAAAGAAGGGG + Intronic
1045866691 8:106874253-106874275 AATTAAAAAGAGGAAGGAAGGGG + Intergenic
1047534111 8:125703723-125703745 TGTTAGAGATAGCAAGTAAAGGG + Intergenic
1048317297 8:133371629-133371651 AGGAAAAGAGAGAAAGGAAGAGG + Intergenic
1048838942 8:138547743-138547765 GGTTAAAGAAAGCAAGGAGATGG - Intergenic
1049479989 8:142818060-142818082 TGTTAAGGAGAGGAAGGAGATGG - Intergenic
1050513153 9:6414817-6414839 TTTTAAAGAGAGAAGGAAAGGGG - Intronic
1050611902 9:7361997-7362019 GGGTAAAGGGACCAAGGAAGTGG - Intergenic
1050811726 9:9756685-9756707 TGTTAAAGTGAACAATGCAGTGG - Intronic
1050922648 9:11224749-11224771 TGTTACAGAGAGTAAGACAGAGG + Intergenic
1051718038 9:20005784-20005806 TGCTAAAGAGAGCATGTAAATGG + Intergenic
1052083720 9:24238507-24238529 TGTGAAAGAAGGGAAGGAAGAGG - Intergenic
1052099153 9:24422476-24422498 TATCTAAGAGAGCAAGGAATAGG + Intergenic
1052483896 9:29070453-29070475 TGGTAATGAGAACAAAGAAGAGG + Intergenic
1052641204 9:31167457-31167479 TGCTGAAGAGAGCCAGGGAGGGG - Intergenic
1053051009 9:34960235-34960257 TGTGGAAGAAAGCAGGGAAGGGG - Intronic
1053612152 9:39725007-39725029 TTTTAAAGAGAGAAAGGATAGGG + Intergenic
1053870185 9:42483000-42483022 TTTTAAAGAGAGAAAGGATAGGG + Intergenic
1054086104 9:60746149-60746171 TTTTAAAGAGAGAAAGGATAGGG - Intergenic
1054241366 9:62617386-62617408 TTTTAAAGAGAGAAAGGATAGGG - Intergenic
1054555494 9:66651909-66651931 TTTTAAAGAGAGAAAGGATAGGG - Intergenic
1055254649 9:74354149-74354171 TGTTCAAGAGAGTAAGCCAGTGG - Intergenic
1055677545 9:78680200-78680222 TGTTAAAGAGCACAAGGGACTGG + Intergenic
1055707595 9:79023335-79023357 TGTTCAAGACAGGGAGGAAGAGG + Intergenic
1055807057 9:80107665-80107687 AGGTAAGTAGAGCAAGGAAGAGG + Intergenic
1055876542 9:80949767-80949789 TGTTAAAAACAGAAAGGAATAGG - Intergenic
1056530952 9:87487148-87487170 TCTGAAAGAAAGTAAGGAAGAGG - Intergenic
1057233741 9:93342177-93342199 TGTTAAACAAAACAAAGAAGAGG + Intronic
1057565032 9:96160013-96160035 GGCAAAAGAGAGCAAGAAAGAGG + Intergenic
1059908930 9:119021086-119021108 CTTTGAAGAGAGCTAGGAAGTGG + Intergenic
1060077949 9:120611359-120611381 TGATGAAGAGAGCAATGAAATGG + Intronic
1060332013 9:122681370-122681392 TGAGGGAGAGAGCAAGGAAGCGG + Intergenic
1060447798 9:123707593-123707615 TGTCAAACAGATCAAGAAAGAGG + Intronic
1186490212 X:9966160-9966182 TATGAAAGCAAGCAAGGAAGTGG + Intergenic
1186645184 X:11499475-11499497 TGTTTAAGAAAGCAAAGGAGTGG - Intronic
1187082628 X:16007155-16007177 AGTGAGAGAGAGCAAGGAGGAGG + Intergenic
1187282424 X:17867956-17867978 TGTTAAAGAGGACAATGGAGTGG + Intergenic
1187302011 X:18059787-18059809 TGTTAAAGAGGACAATGGAGTGG + Intergenic
1187668370 X:21641706-21641728 TGTTATAAACAGCAAGGACGAGG - Intronic
1188361060 X:29254450-29254472 TGTGAGAGAGAGCAAAGAGGGGG + Intronic
1189014702 X:37085237-37085259 TGCTAAAGAGAAAAAGGAAATGG + Intergenic
1189076004 X:37915249-37915271 TGTTAAGGAAAGCAAGGAGTAGG - Intronic
1189370044 X:40420760-40420782 TGTTAGAGAGAGGAAATAAGGGG + Intergenic
1190710476 X:53064718-53064740 TGACAAAGAGAGAAGGGAAGTGG + Intronic
1191841746 X:65518212-65518234 TGTTAATGATGTCAAGGAAGAGG - Exonic
1191998618 X:67124058-67124080 TGTTAAATAGTGAGAGGAAGAGG - Intergenic
1192033395 X:67539023-67539045 TGTTGAAGATAGCCTGGAAGAGG + Intergenic
1192063646 X:67857615-67857637 TATAAAAGGGAGAAAGGAAGAGG + Intergenic
1192262076 X:69511449-69511471 TGGTAACGAGAGAAGGGAAGTGG - Intronic
1192276455 X:69636251-69636273 TGAGAAAGGGAGCAAGGAAGAGG - Intronic
1192737104 X:73860112-73860134 TGGTGAAGAGTGCAAGAAAGAGG - Intergenic
1193367067 X:80647370-80647392 TATTAAAGACAACAAGTAAGGGG - Intergenic
1193999600 X:88411422-88411444 TGTTAAAGTGAGAGAGGAAGAGG + Intergenic
1194363829 X:92989019-92989041 TGCTAAAAATAGCAAGAAAGAGG + Intergenic
1194417805 X:93635318-93635340 TATTAGAGAGGGAAAGGAAGAGG + Intergenic
1194560689 X:95415945-95415967 TGTTAAAGGGAGAAAAGGAGGGG + Intergenic
1194755927 X:97739765-97739787 TGTGACAAAGATCAAGGAAGGGG - Intergenic
1195128953 X:101836436-101836458 TGTACAACAGTGCAAGGAAGTGG + Intronic
1197498007 X:127209554-127209576 AGTTAAAGCCAGCAAGGAAAAGG - Intergenic
1198408660 X:136342919-136342941 TGTGAGAGAGAGAGAGGAAGGGG + Intronic
1198629569 X:138620035-138620057 TGTTCAAAAGAGCAAAGATGTGG + Intergenic
1198977457 X:142352736-142352758 TGTAAAAGAGAGTAAGAAATAGG - Intergenic
1199733388 X:150660157-150660179 TGTTAAATAAAGCAATAAAGAGG - Intronic
1200672061 Y:6105256-6105278 TGCTAAAAATAGCAAGAAAGAGG + Intergenic
1201114588 Y:10825776-10825798 TGTAAAAGAAAGGAAGAAAGTGG - Intergenic
1201360703 Y:13145244-13145266 TGTTAAAAGTAGCAAGGAAAAGG + Intergenic
1202282823 Y:23208312-23208334 TTTTAAAAAAAGGAAGGAAGTGG + Intergenic
1202434497 Y:24822697-24822719 TTTTAAAAAAAGGAAGGAAGTGG + Intergenic