ID: 1087539450

View in Genome Browser
Species Human (GRCh38)
Location 11:99496754-99496776
Sequence CTCAAGAGGTGGTAAGTAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 108}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087539450 Original CRISPR CTCAAGAGGTGGTAAGTAAC TGG Intronic
900848445 1:5122331-5122353 CTCAAGGGGTGGTTAGAATCTGG - Intergenic
901009095 1:6188726-6188748 CTGAAGAGATGGTTAGTAGCAGG - Intronic
903912817 1:26740558-26740580 TTCCAGGGGTGGGAAGTAACAGG + Intronic
905730676 1:40297247-40297269 GTCAGGAGGTGGTAAGTGGCTGG + Intergenic
908058437 1:60319203-60319225 CTCATCAGGTGGTAATTCACAGG - Intergenic
916256310 1:162790988-162791010 CTCTTGAGGTGCTCAGTAACTGG + Intronic
916582339 1:166120256-166120278 CTCAAGAGAAGTTAAGTAACTGG + Intronic
917640851 1:176981994-176982016 GTCAACAGGAGGTAACTAACTGG + Intronic
921056944 1:211549531-211549553 CTCATGAGGTGGTACGTGCCTGG - Intergenic
922407330 1:225328785-225328807 CTCACTAGGTCGTAAGTAACAGG + Intronic
1064102239 10:12473764-12473786 ATGGAGAGGTGTTAAGTAACAGG + Intronic
1064875167 10:19985824-19985846 CTAAGGAGGTGGAAAGTCACTGG - Intronic
1064927247 10:20582473-20582495 CACAACAGGTGGAAAGTAACAGG + Intergenic
1066722772 10:38356641-38356663 CTCTTGAGGTGCTCAGTAACTGG + Intergenic
1068191522 10:53658693-53658715 CACAATAGGTGTTAAGTAAATGG - Intergenic
1068725128 10:60292301-60292323 CTCAAGAGGTAATCAGAAACAGG - Intronic
1069776230 10:70928890-70928912 CTCCAGGGGTGGCAATTAACAGG - Intergenic
1073644951 10:105292310-105292332 CTTAAGAGTTTCTAAGTAACAGG + Intergenic
1078624032 11:12937101-12937123 CTTAACAGGTGGTAACAAACAGG + Exonic
1079567110 11:21896659-21896681 CTAAAGATGTAGTAAGTAAACGG - Intergenic
1080170561 11:29296961-29296983 CTCAATAGGTGGTGAGTCAAAGG + Intergenic
1086796562 11:91112034-91112056 CTCAACAGGTGATAATGAACAGG + Intergenic
1087539450 11:99496754-99496776 CTCAAGAGGTGGTAAGTAACTGG + Intronic
1087880533 11:103410346-103410368 CTCATGAGGTGGGAAGAAATGGG - Intronic
1089086263 11:115819483-115819505 CACAAGAGGTGGTATGCCACAGG - Intergenic
1089569032 11:119390221-119390243 CTCAAGAGGTCCAAAGTGACAGG - Intergenic
1091137449 11:133204692-133204714 CTAAAGGGCTGGTGAGTAACAGG + Intronic
1091236781 11:134027311-134027333 TTCTAGATGTGGTAACTAACTGG + Intergenic
1093158765 12:15719902-15719924 GTCAAGAGGTGGTATGTTATGGG + Intronic
1094367919 12:29703811-29703833 CCCAAGAGGTGTTAAGTGGCAGG - Intronic
1109140438 13:58708038-58708060 CTCAAGAGGAGCTAGGTAATGGG + Intergenic
1113128110 13:107003066-107003088 CTGAAAAGATGGGAAGTAACGGG - Intergenic
1113159251 13:107361337-107361359 CTCAGGAAATAGTAAGTAACAGG + Intronic
1116117837 14:40679859-40679881 TTCAGGAGGTTGTAAGTAACTGG + Intergenic
1116318651 14:43431327-43431349 TTCAAGTGCTAGTAAGTAACTGG + Intergenic
1118498294 14:66330899-66330921 CTGAAGAGCTGGTAAGTATTAGG + Intergenic
1119999795 14:79289903-79289925 CTCAATAGCTGGTAAGCAAGAGG - Intronic
1122901740 14:104784854-104784876 CTCAGGAGGTGGTCAGTCCCGGG - Intronic
1124597219 15:31101434-31101456 CTCAAGAGGAGATGAGTAACAGG + Intronic
1131508700 15:93037078-93037100 CCCTCGAGGTGGTCAGTAACGGG + Intronic
1131739048 15:95366907-95366929 CTCATGAGGTTGTAAGTGAATGG - Intergenic
1133199678 16:4195674-4195696 CTCAAGGGGTGAGAAGGAACGGG + Exonic
1140151176 16:72368031-72368053 CTCATGTGGTTGTAATTAACTGG + Intergenic
1141222440 16:82083729-82083751 CTCAGGAGCTAGTAAGTGACGGG - Intronic
1143095950 17:4478494-4478516 CTCCACAGGTGGGAAGCAACAGG + Intronic
1144139058 17:12329786-12329808 TTCAATAGGTGGAAAATAACAGG + Intergenic
1144688015 17:17238944-17238966 CTGAGGAGGTAGTAAGTTACAGG + Intergenic
1145044146 17:19599318-19599340 CTCATGAGGTGGCAAGAAATGGG + Intergenic
1146607180 17:34270765-34270787 CTGCAGAGGTGGTACGTATCAGG + Intronic
1150546438 17:66162738-66162760 TTCAAGAGGTGATAAATGACTGG + Intronic
1155909281 18:31489543-31489565 CTGAAGGAGAGGTAAGTAACTGG + Intergenic
1164583907 19:29453522-29453544 CTGAGGAGGTGGGAAGGAACTGG + Intergenic
1165541640 19:36496995-36497017 CTCAGGAGGTTGTAAGTCATTGG + Intergenic
1168363222 19:55760691-55760713 CTCATGAGGTGATAAAAAACCGG - Intronic
1168364171 19:55770693-55770715 CTCATGAGGTGCTAAAAAACCGG - Intronic
926353551 2:12019497-12019519 CTATGGAGGTGGTAAGTCACAGG + Intergenic
927184161 2:20470135-20470157 CTAAAGAGTTGGAAAATAACTGG - Intergenic
930037828 2:47098845-47098867 CTCAAGAGGTGGTGTGTGGCAGG + Intronic
930867282 2:56134249-56134271 CACAAGAGGGGGTAGGGAACGGG + Intergenic
934792714 2:97075997-97076019 GACAAGAGGTAGTAAGTAAGAGG - Intergenic
934813902 2:97307686-97307708 GACAAGAGGTAGTAAGTAAGAGG + Intergenic
934823793 2:97400796-97400818 GACAAGAGGTAGTAAGTAAGAGG - Intergenic
935214792 2:100967582-100967604 CTAAAGAGGTGCTAAGTTCCAGG + Intronic
939566343 2:143790431-143790453 CACAAGAGGTGGCAGGCAACAGG + Intergenic
941802933 2:169681022-169681044 CTCAAGAAGTGGTAAAACACTGG - Exonic
943547768 2:189302436-189302458 CTGAACAGGTGGTAAGTGGCAGG + Intergenic
948519159 2:238524629-238524651 CTCTTGAGGTGGGAAGTGACGGG - Intergenic
1175445674 20:59017980-59018002 CTCAAGAGGTGGTTGCTCACCGG + Intergenic
1175623427 20:60470062-60470084 CTCAAGAGTTAGAAAGTAACAGG + Intergenic
1179292537 21:40031189-40031211 CTCGAGAGGTGGAAAGTGATGGG + Intronic
1183152931 22:36052310-36052332 CTCAAAACATGGTAAGTAAAAGG + Intergenic
951503338 3:23415025-23415047 CTCAAGAGGTGTGAAGCTACTGG + Intronic
952111542 3:30129510-30129532 CTGAAGAGGTGGTAATGAAAGGG - Intergenic
955648578 3:61167742-61167764 ACCAAGAGGTGGAAAGGAACAGG + Intronic
959915399 3:111811132-111811154 CTCAGGAGGATTTAAGTAACTGG + Intronic
962060978 3:131927050-131927072 CTTAATAGGTGGTCAGTAAATGG - Intronic
962966885 3:140363950-140363972 ACCAAGAGGTGATAAGTTACAGG + Intronic
965681079 3:171252225-171252247 CCCAACAGGTTGTAACTAACTGG - Intronic
966444606 3:179987693-179987715 CTCAGGTGCTGCTAAGTAACTGG + Intronic
966605316 3:181815635-181815657 CTCAAGAGGTGGTTAGTATATGG - Intergenic
970120424 4:12747051-12747073 GTGAAGAGGTGGCAAGTACCTGG + Intergenic
973039094 4:45448194-45448216 CTCAAGAGGAGGCAAGAAACTGG - Intergenic
982211826 4:153043489-153043511 CTGAAGAGGTGGGATGGAACTGG + Intergenic
990206355 5:53433735-53433757 CTTAACAGGTGGTTAGAAACTGG + Intergenic
997697399 5:135872456-135872478 TTCAGGAGGTGGTGAGTAGCAGG - Intronic
999017997 5:148129432-148129454 CTTGAGAGGTGGTAAGATACTGG + Intronic
1000761010 5:165224467-165224489 CTCAGGAGGAGGGATGTAACAGG + Intergenic
1000911735 5:167030835-167030857 AGGAAGAGGTGGTAAATAACAGG - Intergenic
1005263797 6:24089905-24089927 CTGATGAGGTGCTAAGTGACTGG + Intergenic
1011424723 6:87213956-87213978 ATCAAGAGATGGGAAGAAACAGG + Intronic
1012812431 6:103977176-103977198 CCCAAGAGATGTTAAGTAAGTGG - Intergenic
1012861389 6:104564101-104564123 CTCAAAGGGTGGAAAGTAAAGGG - Intergenic
1013190253 6:107797279-107797301 CTCAAGAAGTCTTAAGTAAATGG - Intronic
1018787492 6:167119407-167119429 CCCAAAAGGTGGGAAGTAAATGG + Intergenic
1019876117 7:3812430-3812452 CCCAAGCGGTGGTAAGTTGCAGG - Intronic
1021294805 7:18891547-18891569 CTTAAGAGCTAGTAAGTACCAGG + Intronic
1022882355 7:34601283-34601305 CTCAAGAGGAGGTAAGTTGAGGG - Intergenic
1023002275 7:35822608-35822630 CACAAGAGGAGGTAAGTGGCGGG - Intronic
1023762640 7:43480892-43480914 CTGAAAAAGTGGTAAATAACTGG - Intronic
1024127253 7:46312169-46312191 CACAACAGGTGGTAAGTGGCAGG - Intergenic
1028363571 7:89998490-89998512 CTCAAGAGGTAGTAAATGAGTGG - Intergenic
1033674671 7:143528582-143528604 ATCAAGAGAAGGTAAGTAAATGG - Intergenic
1033697165 7:143800858-143800880 ATCAAGAGAAGGTAAGTAAATGG + Intergenic
1037077265 8:14735715-14735737 CTCCAGAGGGAGGAAGTAACAGG - Intronic
1037839315 8:22232543-22232565 CTCTAGAGTTGGTAAGAAAATGG - Intergenic
1038189258 8:25304051-25304073 CTCATGAGGTGCTAAGGAAGGGG - Intronic
1042544772 8:69941530-69941552 CTGGCGAGGTGGTAAGTCACTGG - Intergenic
1044050782 8:87500990-87501012 CTCAATAGGTGATATATAACAGG - Intronic
1044537136 8:93370127-93370149 AGAAAGAGGAGGTAAGTAACAGG - Intergenic
1050386048 9:5092141-5092163 CTCATGAGGTGGCAAGAAATGGG + Intronic
1051960530 9:22756508-22756530 CTCAAGAGGTGGAAAGTCAAGGG + Intergenic
1052979119 9:34434765-34434787 CTCAACAGGGAGTAAGAAACAGG + Intronic
1054725385 9:68645034-68645056 CTTTAGAGGGGTTAAGTAACTGG - Intergenic
1056297146 9:85204684-85204706 CTCAAGATGAGGCATGTAACGGG - Intergenic
1059166515 9:112081437-112081459 ATGAACAGGTGGTAAGGAACAGG + Intronic
1061464166 9:130764655-130764677 CTTAAGAGGAGGCAAGTAAAAGG + Intronic
1199215981 X:145260858-145260880 CTGAAGAGGTGGTAACAAATGGG - Intergenic
1201156329 Y:11134821-11134843 CCCATGAGGTGGTAAGAAATAGG + Intergenic