ID: 1087542791

View in Genome Browser
Species Human (GRCh38)
Location 11:99542496-99542518
Sequence GGCAAAACCCACAATTATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 6, 2: 14, 3: 30, 4: 231}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087542791 Original CRISPR GGCAAAACCCACAATTATTT TGG (reversed) Intronic
901412169 1:9092128-9092150 GACAAAAGCCACATTTCTTTAGG + Intergenic
903842009 1:26249807-26249829 GGCAAAACCCCAAAGTTTTTGGG + Intronic
905426828 1:37892376-37892398 GGCCCAACCCAGAAATATTTTGG + Intronic
907993104 1:59601879-59601901 AGAAAAACCCACAATAATCTTGG + Intronic
909132317 1:71753283-71753305 GATAAAACCCAAAATAATTTAGG - Intronic
909351261 1:74656044-74656066 GGCAAAACCCACAGCTGGTTGGG - Intronic
909999644 1:82327079-82327101 TGCAAAACCTAAAATTTTTTAGG + Intergenic
911703419 1:100982707-100982729 GGCCAAAGCCAAAATTGTTTGGG - Intergenic
915910619 1:159912816-159912838 GCCAGAAGCCACAATAATTTAGG - Intergenic
916954148 1:169814374-169814396 GGCAAAAACTGCAATTACTTTGG - Intronic
916999921 1:170346439-170346461 GACAAAAACTACAATAATTTGGG - Intergenic
917786096 1:178458866-178458888 GGCAAAACCAGCTATTATTTTGG + Intronic
918877515 1:190067912-190067934 GGCCAAACCCACAATCACATGGG + Intergenic
919248431 1:195019674-195019696 GGCAAAAGCCACAATTATTTTGG - Intergenic
919316746 1:195980160-195980182 GGCTAAAAACACACTTATTTGGG + Intergenic
919405565 1:197177759-197177781 GGTAAAATCAACACTTATTTTGG - Intronic
919681351 1:200437931-200437953 GAGAAAACCCACAATTAGTTTGG - Intergenic
920603539 1:207355009-207355031 GGGGAAACCCAAAATTTTTTAGG + Intronic
923683602 1:236139403-236139425 GCAAAAAGCCACAATTACTTTGG + Intergenic
1063008741 10:2001422-2001444 AGCAAAAACCACAATTACTTTGG - Intergenic
1064268648 10:13846241-13846263 GGCAAAAACCACAATTACTTTGG - Intronic
1064732158 10:18343415-18343437 GCCAAATCACACCATTATTTAGG - Intronic
1064985462 10:21205634-21205656 GGAAAAAAACACAATTACTTTGG + Intergenic
1066779971 10:38933721-38933743 TGCAAAACCCAGAATTTTTGGGG + Intergenic
1070122363 10:73590760-73590782 GGCAAAATCCACTAAGATTTTGG - Intronic
1070221062 10:74445639-74445661 TGAAAACCCCACAATTATATAGG + Intronic
1072084219 10:92062604-92062626 GGCAAAAACCACAAATGGTTTGG - Intronic
1072516914 10:96193447-96193469 GGCAATACTCACAAATATTCAGG - Intronic
1074087886 10:110222499-110222521 GGCAAAGCCCTCAATTCTTAAGG - Intronic
1074981558 10:118624023-118624045 GGCAAACATCACAATTACTTTGG - Intergenic
1077823204 11:5773063-5773085 GGCAAACCAAACAAATATTTTGG - Intronic
1079784068 11:24648865-24648887 GGCAAAACCCGCAATTACTTTGG + Intronic
1080437354 11:32257646-32257668 GGACAAAGCCAGAATTATTTTGG + Intergenic
1082738671 11:56885853-56885875 GGCAAAAACAGCAATTACTTTGG - Intergenic
1086315397 11:85586214-85586236 GGTAAATCCCAGAATGATTTAGG + Intronic
1087542791 11:99542496-99542518 GGCAAAACCCACAATTATTTTGG - Intronic
1088013212 11:105028697-105028719 GGTAAAACCCACTTTAATTTAGG + Intronic
1088016337 11:105065021-105065043 GGTAAAACCCACTTTAATTTAGG + Intronic
1088018887 11:105094995-105095017 GGTAAAACCCACTTTAATTTAGG + Intronic
1089366321 11:117923151-117923173 GGCAAAGCACACAAATGTTTTGG - Intronic
1090178986 11:124676907-124676929 GGAAAAAACTAAAATTATTTGGG + Intronic
1090492387 11:127176255-127176277 GGAAAAACCCACACATGTTTTGG + Intergenic
1091521945 12:1254439-1254461 GGCAAAAACCACAATTACTTTGG + Intronic
1093656335 12:21698736-21698758 GGAAAAACCTATAATTTTTTTGG + Intronic
1093666434 12:21818850-21818872 AGCAAAACCCACAATTACTTTGG + Intronic
1093701284 12:22224604-22224626 CTAAAAACCGACAATTATTTGGG - Intronic
1095235691 12:39792699-39792721 TGCAAAACCCACATATACTTTGG - Intronic
1095380645 12:41586879-41586901 AGCAAAACCCACAAAAATTCTGG - Intergenic
1095723605 12:45427777-45427799 GGCAAAACCCAAAATTAGCCGGG + Intronic
1098523260 12:71457745-71457767 GGAAAAACCAACAATGCTTTAGG - Intronic
1099287418 12:80731688-80731710 GGCATTACTCACAGTTATTTGGG - Intergenic
1104066981 12:125314320-125314342 GGCAAAACCTCCAATTACTCTGG - Intronic
1106060716 13:26288712-26288734 GGTATAACCCCCATTTATTTAGG + Intronic
1106610202 13:31271797-31271819 GGAAAAATCCACCATTATTATGG - Intronic
1106628413 13:31444222-31444244 GGCAAAACCTTCAAATATGTAGG - Intergenic
1106641415 13:31587964-31587986 GGCAAAAACCACAATTATTTTGG - Intergenic
1106779325 13:33041369-33041391 GGCAAAAACTGCAATTACTTTGG - Intronic
1106779328 13:33041406-33041428 GGCAAAAACTGCAATTACTTTGG + Intronic
1107168349 13:37310292-37310314 GACAAAACCCACATTGGTTTAGG + Intergenic
1108157183 13:47597421-47597443 GGCAAAACCCACATGGATTATGG - Intergenic
1108539591 13:51427472-51427494 AACAAATCCCATAATTATTTAGG + Intronic
1108923702 13:55710107-55710129 GGAATAAACCACATTTATTTTGG + Intergenic
1108940589 13:55948135-55948157 GGCAAAACCCCCATCTATCTGGG + Intergenic
1110507443 13:76304115-76304137 GGCAAAAACCACAATTGCTGAGG + Intergenic
1112024592 13:95400462-95400484 GACAAAACCCACAGTACTTTAGG + Intergenic
1112461052 13:99604257-99604279 GGCAAAAACCGCAATTACTTTGG + Intergenic
1112636460 13:101222900-101222922 GACAAAAGCCACATTTCTTTAGG + Intronic
1114049447 14:18910841-18910863 GGCAAAACTTACAAATAGTTTGG + Intergenic
1114113116 14:19491090-19491112 GGCAAAACTTACAAATAGTTTGG - Intergenic
1114952635 14:27775550-27775572 GGCAAAAGCCACATTTAAATAGG - Intergenic
1115058137 14:29156029-29156051 TGTAAAAGCCACTATTATTTTGG + Intergenic
1116438318 14:44920408-44920430 GGCAAAAAGCACAATTACATTGG + Intergenic
1118310392 14:64688151-64688173 GGCAAAAACCACAGTTACTTTGG - Intergenic
1121222192 14:92294439-92294461 TGCAAAACCCACACTTCCTTTGG - Intergenic
1121959330 14:98244360-98244382 GGCAAAAACCACAATTACTTTGG - Intergenic
1122472239 14:101977460-101977482 GGAAATACACACAAGTATTTAGG - Intronic
1125088613 15:35763152-35763174 GACAAAACACACAACTACTTGGG - Intergenic
1125158076 15:36612415-36612437 GGTATAATCCACAGTTATTTGGG + Intronic
1125402721 15:39321387-39321409 GGCAATACCCAGATTGATTTTGG - Intergenic
1125979895 15:43990606-43990628 AGCAAAAACTACAAGTATTTAGG + Intronic
1126043511 15:44616539-44616561 GGTAAAACCTTAAATTATTTGGG - Intronic
1126791549 15:52226220-52226242 GCCAAAACCCACAGTTATGAAGG - Intronic
1127271075 15:57402582-57402604 CGGAAAACCCAAAATAATTTTGG - Intronic
1130067085 15:80613873-80613895 TGCGACACCCACAAATATTTTGG - Intergenic
1132333515 15:101028697-101028719 GGCAAAATCCACAAATAATGAGG + Intronic
1133424328 16:5674624-5674646 GGCAAAACCCACAATAACTTTGG - Intergenic
1133862697 16:9611202-9611224 GGCATTAACCAGAATTATTTTGG - Intergenic
1135854988 16:26001247-26001269 AGCAATACCTACAAGTATTTCGG + Intronic
1137866152 16:51898723-51898745 TGCAAAGCCCAAAATAATTTAGG + Intergenic
1137968606 16:52961488-52961510 GGCAAAACACAAATTTTTTTTGG - Intergenic
1138760411 16:59536965-59536987 AGCAAGAACAACAATTATTTTGG - Intergenic
1138966067 16:62085464-62085486 AACAAAACCCACAAATACTTGGG + Intergenic
1140293289 16:73684555-73684577 CTCAAAACCCACAAATATGTTGG + Intergenic
1140736653 16:77904055-77904077 GGCAAAAACCACAATGACTTTGG + Intronic
1141024084 16:80527697-80527719 GGCAAAACCTAGTATTATTTTGG - Intergenic
1143789893 17:9286334-9286356 CACAACACACACAATTATTTTGG + Intronic
1143960941 17:10719002-10719024 GGAAAAAGCCACAATCATCTTGG - Intronic
1144374582 17:14626669-14626691 GGGAAAACCCACACACATTTTGG + Intergenic
1145709280 17:26954411-26954433 TGCAAAACCCAGAATTTTTGGGG + Intergenic
1149405817 17:56349983-56350005 AGCAATACCCACAGTTATTGTGG + Intronic
1150554759 17:66244421-66244443 AACAAAACCCAAAATTAGTTGGG - Intronic
1150719453 17:67602100-67602122 GGAAAACGCCACAATTATGTAGG - Intronic
1153091306 18:1347025-1347047 GGCAAAAACCGCAATTACTGTGG - Intergenic
1153136009 18:1918302-1918324 GGCACAACCCACCAGTATTAAGG + Intergenic
1154518973 18:15206333-15206355 TCCAAAACCCAGAATTTTTTGGG - Intergenic
1155241056 18:23863973-23863995 AGCAGAACTCACAATAATTTGGG + Intronic
1155275222 18:24180899-24180921 AGCAAAACCCACTAATATCTAGG + Intronic
1156170479 18:34478440-34478462 GGCAAAAACTGCAATTACTTTGG - Intergenic
1157146801 18:45171764-45171786 GGCCAAACCAACAATTTATTAGG + Intergenic
1159141446 18:64400125-64400147 GACAAAAACCACAATTACTTTGG - Intergenic
1159834385 18:73319678-73319700 GGGAAAAAACAAAATTATTTTGG + Intergenic
1161516327 19:4698586-4698608 TACAAAACCCACAATTAGTTAGG + Intronic
1163514552 19:17755191-17755213 GGTAAGACCCACTCTTATTTAGG + Exonic
1164323898 19:24175694-24175716 GAGAAAACCCTCAAATATTTGGG + Intergenic
1168571023 19:57469974-57469996 AGCAAAATCCCCAAATATTTAGG + Exonic
1202682426 1_KI270712v1_random:19293-19315 GGAAAAATCCAAAATTATATTGG - Intergenic
925563795 2:5227278-5227300 GTCAAAACCCACACCTATTTGGG + Intergenic
925582966 2:5432114-5432136 GGAATAACCCACAGTTATTGTGG - Intergenic
926495319 2:13579733-13579755 GGCAAAAACTGCAATTACTTTGG + Intergenic
928011188 2:27609344-27609366 TGCAAAACCCACATTTAAATTGG - Intronic
928355085 2:30605129-30605151 GGCAATACACACAAACATTTTGG - Intronic
928428198 2:31196679-31196701 TGCAAAACCCGCATTTCTTTAGG + Intronic
929337756 2:40771495-40771517 GGCAAAAACTGCAATTACTTTGG + Intergenic
930321142 2:49856246-49856268 GGCAAAACCTGCAATTCTTTTGG - Intergenic
931065683 2:58583911-58583933 GACAAAGGACACAATTATTTTGG - Intergenic
931194802 2:60041402-60041424 GGCACAACACACAACTTTTTTGG + Intergenic
931389629 2:61830296-61830318 GGCAGATCCAAAAATTATTTAGG + Intronic
931833534 2:66076056-66076078 GTCAAAACCCACTATGACTTTGG - Intergenic
931974896 2:67632625-67632647 GGGAAAACATCCAATTATTTGGG - Intergenic
933214145 2:79607620-79607642 GGAAAATCCCCCAAATATTTGGG + Intronic
934484622 2:94693417-94693439 GGCAAAAGCCACATTTAAATAGG + Intergenic
934904786 2:98189402-98189424 AGGAAAATCCACAAATATTTGGG - Intronic
935310713 2:101780473-101780495 GACAAAACACAGAATTATGTGGG - Intronic
936665581 2:114591482-114591504 GGAAAAACTCTCACTTATTTGGG - Intronic
939141984 2:138364842-138364864 GAATAAACCCAGAATTATTTTGG + Intergenic
940036268 2:149315074-149315096 GGGAAAACTAACAAGTATTTTGG - Intergenic
941991047 2:171557340-171557362 GACAGAAGCCATAATTATTTTGG - Exonic
942594467 2:177579949-177579971 GGCAAGACCCACAATGCTCTGGG - Intergenic
943400740 2:187407317-187407339 AGTAAAACCCACATATATTTAGG + Intronic
943407176 2:187504152-187504174 GTCAGAACCAATAATTATTTAGG + Intronic
943746793 2:191470358-191470380 AGCAAATCCCCCAAATATTTGGG + Intergenic
945693667 2:213075357-213075379 GGCAAAAACCACAGTTACTTTGG - Intronic
946580274 2:221120778-221120800 GGCAAAGACCACAATTACTTTGG - Intergenic
946580277 2:221120803-221120825 GGCAAAAACCGAAATTACTTTGG + Intergenic
1169498432 20:6136272-6136294 AACAAAAACCACAATTACTTTGG + Intergenic
1169599706 20:7243421-7243443 GGCAAATCCTACAAACATTTTGG - Intergenic
1169624251 20:7545565-7545587 GATAAAAACCACAATTACTTTGG - Intergenic
1169886253 20:10401533-10401555 GACAAAACATACAATTAGTTAGG - Exonic
1172846645 20:37933579-37933601 ATCAAAACTCACACTTATTTTGG - Exonic
1175485948 20:59346396-59346418 GGCAAAAACCGCAATTGCTTTGG - Intergenic
1175795235 20:61766712-61766734 GGCAGACACCACCATTATTTGGG - Intronic
1181175832 22:21034638-21034660 GGCAAAATACCCAAGTATTTTGG - Intergenic
1182364499 22:29769078-29769100 CCCAAAACACACAATTATTAAGG - Intronic
1184711388 22:46251108-46251130 AGCAAAACCCTCAAATCTTTGGG - Intergenic
949924003 3:9026559-9026581 AGCAAAAGCCACAATTACTTTGG + Intronic
951223234 3:20091837-20091859 GGCAAAAACCGCAATTATTTTGG - Intronic
952952329 3:38534991-38535013 ACCAAAACACACAAGTATTTAGG - Intronic
955832804 3:63022609-63022631 GGCAAAACACACACATAGTTAGG + Intergenic
957142163 3:76374346-76374368 TCAAAAACCCACATTTATTTAGG + Intronic
958080932 3:88745275-88745297 GAAGAAACTCACAATTATTTTGG - Intergenic
958188961 3:90159483-90159505 GGCAAAAACCACAATCGCTTTGG - Intergenic
958888642 3:99758000-99758022 GGCAAAAACCATGATTACTTTGG - Intronic
958994311 3:100884813-100884835 GGCAAAAGCTGCAATTATTTTGG + Intronic
960392969 3:117102084-117102106 GGCAAAACCCGCAATTACTTTGG + Intronic
963830309 3:150000499-150000521 GGCAGAAGCTACAATGATTTTGG + Intronic
965591066 3:170360108-170360130 GGCAAAACGAACAATTTTATAGG + Exonic
966158058 3:176939347-176939369 GACAAAAGCCAAAACTATTTTGG - Intergenic
966477477 3:180366896-180366918 GGCAAAACCCACAAAAGTGTGGG + Intergenic
967279949 3:187812314-187812336 GGCAAAACCCAGAATTCTGAGGG - Intergenic
969152180 4:5178837-5178859 GGCAAAACCAACAAGTCTCTAGG + Intronic
970404365 4:15748208-15748230 GGCAGATCCTACAATTCTTTTGG + Intergenic
971033094 4:22662311-22662333 AGAAAATCTCACAATTATTTAGG - Intergenic
971651724 4:29284664-29284686 GGAAAAACTCACAATTAATGGGG - Intergenic
971653737 4:29313883-29313905 GTAAAAAGCTACAATTATTTTGG + Intergenic
972863909 4:43206393-43206415 GGCAAAAACTGCAATTACTTTGG + Intergenic
972979188 4:44675439-44675461 GGAAAAACACACAATAAATTGGG - Intronic
973268383 4:48234335-48234357 AGCAAAAACCACAAGAATTTAGG + Intronic
973848044 4:54933127-54933149 GGAGAAAGCCAAAATTATTTTGG + Intergenic
974515844 4:62908889-62908911 GGCAAAAACCACCATTATTTTGG + Intergenic
976268076 4:83204243-83204265 GACAAAAGCCACATTTCTTTAGG + Intergenic
977251102 4:94690083-94690105 GGCAAAACCTGCTATTACTTTGG + Intergenic
981334525 4:143555281-143555303 GGTAAAAGCTACAATGATTTTGG - Exonic
981829095 4:148979701-148979723 GACAAAACCCATAATAATGTGGG + Intergenic
983051275 4:163050324-163050346 AGTAAAATTCACAATTATTTTGG - Intergenic
983350852 4:166586467-166586489 TTCAAAACCCAGTATTATTTTGG + Intergenic
986849332 5:11792911-11792933 GGCAGAAGCCACATTTATTTAGG + Intronic
987848814 5:23323019-23323041 AGCAAAAACCGCAATTACTTTGG + Intergenic
988364438 5:30277880-30277902 GGCAAAAAGCACAGTTACTTTGG + Intergenic
990343944 5:54852872-54852894 GGCAAAAACCACAATCACTTTGG - Intergenic
990343946 5:54852907-54852929 GACAAAAACCGCAATTACTTTGG + Intergenic
990399211 5:55420459-55420481 GGCAAAAACCACAATTACTTTGG - Intronic
990916391 5:60910516-60910538 GGAATACCCCACATTTATTTAGG + Intronic
991643911 5:68781544-68781566 GGCAAAAACCACAATTACTCGGG + Intergenic
992188869 5:74270540-74270562 GGAAAAACCAACAATTTTTGAGG - Intergenic
994747569 5:103697698-103697720 GGTAAAACACACAAATATGTGGG - Intergenic
994799567 5:104354975-104354997 GCCTAAACCTAAAATTATTTTGG + Intergenic
994866872 5:105284883-105284905 GGTAAGTCCCACAATTACTTCGG + Intergenic
994950950 5:106461553-106461575 GGCAAAACCCACAATTACTTTGG + Intergenic
994957920 5:106558649-106558671 GGCAAAAATGACAATTACTTTGG - Intergenic
996517707 5:124391607-124391629 GGCCATACTCTCAATTATTTTGG - Intergenic
996895083 5:128471332-128471354 GGCAGTACCCAAAATTATATGGG + Intronic
998932765 5:147199612-147199634 GGCAAAAACTGCAATTACTTTGG + Intergenic
999344139 5:150800058-150800080 GGCAAAATCTGCAATTTTTTTGG - Intergenic
1000630076 5:163582947-163582969 GGCAAAACACACAAGCATTCAGG - Intergenic
1001879289 5:175229289-175229311 GGGAAAACCCACACTCATTTTGG + Intergenic
1006196978 6:32250028-32250050 GGCATAGCTGACAATTATTTAGG + Intergenic
1009477839 6:64115922-64115944 GGCAAAACCCACAATTACTTTGG + Intronic
1010708668 6:79145599-79145621 AGCAAAAGCCACAATGAATTTGG + Intergenic
1010875082 6:81092990-81093012 GGCATAACCCTGCATTATTTGGG + Intergenic
1010883773 6:81212363-81212385 GCCAAAAACCACAATTACTTTGG - Intergenic
1011273834 6:85607999-85608021 GCTAAAACCCACAAATATATTGG + Intronic
1011756681 6:90507051-90507073 GGCAAAAATCGCAATTACTTTGG - Intergenic
1011756683 6:90507086-90507108 GACAGAAACCACAATTACTTTGG + Intergenic
1011915008 6:92493004-92493026 GGCAAAAACCACAATTACTTTGG - Intergenic
1012604169 6:101136495-101136517 GGTAAAACTCACAATTGTTGAGG + Intergenic
1015248533 6:131102724-131102746 GGCAAAATCCACAATTACCTTGG - Intergenic
1016782081 6:147970001-147970023 TGAAAAACCTACAATTTTTTTGG - Intergenic
1021495093 7:21265770-21265792 GGCAAAGCCCAGAATTAGTATGG + Intergenic
1022463577 7:30635432-30635454 GGCAAAAACCGCAACTACTTTGG - Intergenic
1023388555 7:39685060-39685082 GGCCAAAACCGCAATTACTTTGG + Intronic
1023610979 7:41970499-41970521 GGCAAAACCCACAGTTACTTTGG - Intronic
1023610981 7:41970534-41970556 GACAAGACCCACAATTACGTTGG + Intronic
1024863344 7:53872890-53872912 GGCAAAACCCTCAATAAAATAGG + Intergenic
1025228622 7:57183876-57183898 GGGAAAATCCCCAATTACTTTGG - Intergenic
1025879169 7:65518120-65518142 TCCAAAACCCAGAATTTTTTGGG - Intergenic
1026623951 7:71975931-71975953 GGCAAAAACTGCAATTACTTTGG + Intronic
1027426529 7:78066973-78066995 GGCAAAACCCAAAATTGATGTGG - Intronic
1028194165 7:87886183-87886205 GCCATAACCAACAATTATTTTGG - Intronic
1028324625 7:89506949-89506971 AGCAAAACCCCATATTATTTTGG + Intergenic
1029036068 7:97523304-97523326 GACAAAACTCACAAAAATTTGGG + Intergenic
1029046685 7:97636844-97636866 GGCACATTCCACAAGTATTTTGG - Intergenic
1029119647 7:98258664-98258686 GACAAAAACCACAATTTCTTTGG + Intronic
1029941756 7:104488228-104488250 GGCAACACTTACAAATATTTTGG + Intronic
1031897498 7:127368221-127368243 CTTAAAACCTACAATTATTTTGG - Intronic
1032105290 7:129023836-129023858 GGCAACAACCACAATTACTTTGG + Intronic
1035815524 8:2535714-2535736 AGCAAAACCCTCTCTTATTTGGG - Intergenic
1037718929 8:21425205-21425227 GGCAAAACCCACAATTACTGTGG + Intergenic
1039132002 8:34275711-34275733 GGTAAAACTCACAAGTGTTTGGG - Intergenic
1042518604 8:69685742-69685764 GGCAAGCCCCACAATCATTGAGG + Intronic
1045065719 8:98442155-98442177 GGCAGATCCCAGAACTATTTAGG - Intronic
1045292058 8:100842184-100842206 GACAAAACCCACAATTATTTTGG + Intergenic
1045816598 8:106283824-106283846 GTGAAACCTCACAATTATTTAGG + Intronic
1046852287 8:118988201-118988223 AGCAAAACCCACAAACTTTTAGG - Intergenic
1047034759 8:120925218-120925240 GGCAAAAACTGCAATTACTTTGG - Intergenic
1047319288 8:123764483-123764505 GGCAAAAGCCCCTATCATTTGGG + Intergenic
1047671585 8:127153273-127153295 GACAAGCCCCACAATTATTCTGG - Intergenic
1047754428 8:127907775-127907797 TCCAAAATCCACAATTATTAGGG - Intergenic
1048000986 8:130379532-130379554 GGCAACCCCCACAATTCTGTGGG - Intronic
1048013627 8:130478760-130478782 GCCAAAAACCACAATTACTTTGG - Intergenic
1048277190 8:133075733-133075755 GGCAAAAACCACAATCATTGTGG + Intronic
1050167697 9:2783275-2783297 TACAAAACCGTCAATTATTTGGG - Intronic
1050975905 9:11937810-11937832 AGCAAAACCCACATATATGTAGG + Intergenic
1052315798 9:27115643-27115665 GGCAATATTCACAACTATTTAGG - Intronic
1053673169 9:40390967-40390989 GGCAAAAGCCACATTTAAATAGG - Intergenic
1053922979 9:43017333-43017355 GGCAAAAGCCACATTTAAATAGG - Intergenic
1054384273 9:64531033-64531055 GGCAAAAGCCACATTTAAATAGG - Intergenic
1054511458 9:65985316-65985338 GGCAAAAGCCACATTTAAATAGG + Intergenic
1054867509 9:70017588-70017610 TGCAAAAACCGCAATTACTTTGG + Intergenic
1058348562 9:103994072-103994094 GGCAAGTCACACAATTTTTTTGG + Intergenic
1059442021 9:114313302-114313324 GACAAAAACCGCAATTACTTTGG - Intergenic
1059442023 9:114313338-114313360 GGCAAAAACCGCAATTACTTTGG + Intergenic
1060271157 9:122142884-122142906 GGCAAAACCCACTAACGTTTTGG - Intergenic
1061641517 9:131961160-131961182 GGCAAAACCCTCACTTACTTTGG - Intronic
1062391980 9:136337508-136337530 GGCAACACCCACTATTTGTTGGG + Exonic
1203581913 Un_KI270746v1:15021-15043 TCCAAAACCCAGAATTTTTTGGG + Intergenic
1185837656 X:3360360-3360382 GGCAAAAACCACGATTACTTTGG - Intergenic
1185928970 X:4181006-4181028 GGCAAAATAAATAATTATTTTGG + Intergenic
1186170911 X:6875557-6875579 GGCAAAACCCGCAATTACCCTGG - Intergenic
1186282257 X:8005703-8005725 GGCAAAGCAAACATTTATTTTGG + Intergenic
1187430476 X:19219553-19219575 GGCAATACCCAAAAACATTTAGG - Intergenic
1188817627 X:34734911-34734933 ATCTAATCCCACAATTATTTAGG - Intergenic
1189849232 X:45162527-45162549 GTGCAAACCCACAATTATATTGG + Intronic
1190406223 X:50090464-50090486 GACAAAGCCCACAAGTCTTTGGG - Exonic
1192828277 X:74722322-74722344 GGCAAAAACCACAATTACTTTGG - Intergenic
1193317014 X:80076539-80076561 GGCAGGCCCCACAATGATTTGGG - Intergenic
1193583513 X:83293334-83293356 ATCAAAACCCACAATAAATTAGG + Intergenic
1195208577 X:102627706-102627728 GGCAAAACTCACAAAGATTTGGG + Intergenic
1195601381 X:106752234-106752256 GGCAAAACCCAGAACTATGCTGG + Intronic
1199118968 X:144028610-144028632 GGCAAAACTTACAATTATGGTGG - Intergenic
1201238167 Y:11931375-11931397 GGCAAAAACCGCGATTATTTTGG + Intergenic
1201488339 Y:14513993-14514015 GGCAAAAACCACAATTATTTAGG - Intergenic
1201946419 Y:19515288-19515310 GACAAAACCCACAACTCCTTGGG + Intergenic