ID: 1087543606

View in Genome Browser
Species Human (GRCh38)
Location 11:99553374-99553396
Sequence TTAGGTTCCTACTAGATGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 4, 3: 20, 4: 245}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087543606_1087543608 18 Left 1087543606 11:99553374-99553396 CCTTGCATCTAGTAGGAACCTAA 0: 1
1: 0
2: 4
3: 20
4: 245
Right 1087543608 11:99553415-99553437 TATTGTCATTTCTTTGATGCAGG 0: 1
1: 1
2: 2
3: 28
4: 400

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087543606 Original CRISPR TTAGGTTCCTACTAGATGCA AGG (reversed) Intronic
900777344 1:4594791-4594813 TTGGGTCCCTACTCCATGCAAGG - Intergenic
902782611 1:18714409-18714431 TTAAGCTCTTACTAGATGCCGGG - Intronic
902935680 1:19762979-19763001 CTAAGTTCCTACTAGCTGAATGG + Intronic
903749217 1:25609916-25609938 TTTAGTTCCTACTATATGCCAGG + Intergenic
903801605 1:25972771-25972793 TTAGGCACCTACTATGTGCAAGG + Intronic
904212305 1:28893974-28893996 TTAGGATCCTACCATAAGCAGGG + Intronic
904459134 1:30665098-30665120 TTAAGTTCCTACTATATTCTGGG + Intergenic
904790663 1:33018014-33018036 TTAGGTCCCTACCAAATGCTGGG + Intronic
904794410 1:33048422-33048444 TTATATCCCTACTTGATGCATGG + Intronic
906162452 1:43660475-43660497 TTAGGTGCCTACTACGTGCCGGG - Intronic
906855876 1:49303852-49303874 TTAAGTTCCTTCTAGATTCTGGG + Intronic
906926766 1:50126025-50126047 TTAGATGCCTACTAGGTGCCGGG - Intronic
907289785 1:53406396-53406418 TTATGTGTCTACTACATGCAGGG + Intergenic
907697095 1:56742295-56742317 TTAGATACTTACTAGATGCTAGG + Intronic
907949379 1:59166732-59166754 TTAAGTTCCTTATAGATGCTGGG + Intergenic
909734112 1:78934672-78934694 TGAAGTTCCTAGTAGATGCTGGG - Intronic
910109049 1:83662330-83662352 TTGAGTGCCTACTATATGCAAGG - Intergenic
910361655 1:86418325-86418347 CTGTGTTCCTACTAGATGCCAGG - Intergenic
910779923 1:90919736-90919758 TTGAGTTCCTACTACATGCGAGG - Intronic
911312738 1:96315913-96315935 TTACGATTCTACTATATGCAAGG + Intergenic
911731737 1:101298638-101298660 TTATGTGCCTACTGCATGCAAGG - Intergenic
912950872 1:114119312-114119334 TTGAGTACCTACTGGATGCAAGG + Intronic
913058833 1:115186341-115186363 TTGAGTACCTACTAGATACAAGG - Intergenic
913523640 1:119669657-119669679 TTAGGCACCTGCTAGATGCTGGG + Intronic
913698261 1:121348656-121348678 TTAGGTGCTTACTATATGCAAGG + Intronic
914139287 1:144931384-144931406 TTAGGTGCTTACTATATGCAAGG - Intronic
914790211 1:150871147-150871169 TTAAGTTCCTTCTATATGCCAGG - Intronic
915760835 1:158310585-158310607 TTAAGTTCCTTATAGATGCTGGG - Intergenic
916506234 1:165430287-165430309 TTGAGTGCCTACTACATGCAAGG + Intronic
918430731 1:184457912-184457934 TTAAGTTCCTACTACGTGCTTGG + Intronic
920295268 1:204952233-204952255 TTAGGCACCTACTAGGTGGAAGG + Intronic
920485660 1:206367312-206367334 TTAGGTGCTTACTATATGCAAGG + Intronic
920890500 1:209980319-209980341 TTAAGTTCCTTGTAGATGCTAGG + Intronic
922092086 1:222405519-222405541 TTATGTTCCTATTTGATGCCAGG + Intergenic
922478552 1:225923419-225923441 TTAGGTACCTACTATGTGCCAGG + Intronic
922903583 1:229157087-229157109 TTGGGTTCCTACCAGATGCCAGG + Intergenic
923767407 1:236905081-236905103 TTAAGTTCCTACTATGTGCCTGG - Intergenic
924046044 1:240031833-240031855 TTGAGTTCCTACTGTATGCATGG - Intronic
1066189724 10:33045201-33045223 GTAGGTTCCTATTCTATGCAGGG + Intergenic
1067138646 10:43634959-43634981 TTAAGTTCCTGATAGATGCTGGG + Intergenic
1067347328 10:45446033-45446055 TTGGGTACCTACTATGTGCAAGG - Exonic
1067997086 10:51285876-51285898 TTAGGTTCCTCCTAGAATTACGG - Intronic
1068798127 10:61107029-61107051 CTGGGTTCCTAGTACATGCATGG - Intergenic
1069184184 10:65401986-65402008 TTAGGTTCCTACTATGTTCCAGG - Intergenic
1071755145 10:88529023-88529045 TTCTGTTCCTTCCAGATGCATGG - Intronic
1071800259 10:89052149-89052171 TTAACTTCCTACTTGATTCAAGG - Intergenic
1073178861 10:101571971-101571993 TTTGATTCCTACTAGATAGAAGG - Intronic
1073385496 10:103124168-103124190 TTATGCTTCTAATAGATGCAAGG - Intronic
1074266754 10:111911972-111911994 TCAAGTTCCTACTAGATGCCAGG + Intergenic
1075067333 10:119298228-119298250 TTGGGCTCCTACTATATACAAGG + Intronic
1077869031 11:6245967-6245989 TTGGGTACTTACTAGATGCCAGG - Intergenic
1079577600 11:22022222-22022244 TTAGGCTCCTTATAGATGCTGGG + Intergenic
1084041473 11:66545517-66545539 TTGGGAGCCTACTAGGTGCAAGG - Intronic
1084110259 11:67009686-67009708 GTCTGTTCCTACTAGATGCTGGG - Intronic
1084990121 11:72915014-72915036 TTAAGTTCCTTATAGATGCTGGG - Intronic
1086061772 11:82707415-82707437 TTGGGTTCTTACTAGGTGCTAGG - Intergenic
1086079875 11:82891755-82891777 TTAGGTGCCTACTATATTCGAGG - Intronic
1086607984 11:88719936-88719958 TTAGGTTCCTTATAGATACTGGG + Intronic
1086954488 11:92921607-92921629 TTAGGTTTCTACTGAATGCATGG + Intergenic
1087543606 11:99553374-99553396 TTAGGTTCCTACTAGATGCAAGG - Intronic
1087851029 11:103029428-103029450 CTAAGTTCCTACTAGATTCCAGG + Intergenic
1089562626 11:119352181-119352203 CTCAGTTCCTAATAGATGCAGGG + Intergenic
1090159751 11:124480363-124480385 TTAGGTTCCTTATAGAATCAAGG - Intergenic
1092661401 12:10742263-10742285 TTAGGGTCCTATTATGTGCAAGG - Intergenic
1093116526 12:15218709-15218731 AAAGGGTCCTACTAGATGCTAGG - Intronic
1094253418 12:28393641-28393663 TTAGTTTACTACTTGCTGCAAGG + Intronic
1095494319 12:42768887-42768909 TTAGCATTCTACTAGATGCTGGG + Intergenic
1097422314 12:59395292-59395314 TTAGGTTCCTTGTAGATACTGGG - Intergenic
1098168528 12:67721908-67721930 TTAGGGCCCTACTATGTGCAAGG + Intergenic
1104605690 12:130185808-130185830 AGAGGTGCCTACAAGATGCATGG - Intergenic
1104644152 12:130485227-130485249 TTAAGCACCTACTATATGCAGGG + Intronic
1106675086 13:31949893-31949915 TTAGGATTCTACTATATGCCGGG + Intergenic
1106701230 13:32231023-32231045 TTAAGTTCCTTATAGATGCTGGG + Intronic
1109018222 13:57048571-57048593 TTAAGTTCCTTATAGATGCTGGG + Intergenic
1111706026 13:91750419-91750441 TTAGGATCATAATAAATGCAGGG - Intronic
1114879393 14:26765170-26765192 TAAGATTCCTACTAAATGTATGG + Intergenic
1116160652 14:41263562-41263584 TTTGGATGCTACTTGATGCAAGG - Intergenic
1116504317 14:45660144-45660166 TTAAGTTCCTTATAGATGCTGGG + Intergenic
1116829931 14:49708660-49708682 TTGAGTGCCTACTATATGCAAGG - Intronic
1117572809 14:57065037-57065059 TTGGGTTCCTACTACATGTCAGG + Intergenic
1117736338 14:58772641-58772663 TTAGGTGCCTACTATGTGCCAGG - Intergenic
1117847652 14:59929190-59929212 TTAGGTTCCTTATAGATGCTGGG - Intronic
1118367800 14:65110429-65110451 TTAAATTCCTACTACATGCTAGG - Intergenic
1119101170 14:71881185-71881207 TTAGTTACTTCCTAGATGCAAGG - Intergenic
1119587530 14:75850553-75850575 TTAGGTGCCTAGTATATGCTAGG + Intronic
1119855192 14:77894638-77894660 TTTAGTTCCTACTACATGCCAGG - Intronic
1121074587 14:91057396-91057418 TTAAGTACCTACTATATGCCAGG + Intronic
1121513069 14:94527678-94527700 TTAAGTTCCTTATAGATGCTGGG - Intergenic
1122189169 14:100026278-100026300 TTAGATACCTACTGTATGCAAGG - Intronic
1124080612 15:26491404-26491426 TTTGGCTCTTACTAGATGCCAGG + Intergenic
1125683131 15:41545410-41545432 TTAAGGTCCTACTATGTGCATGG - Intergenic
1126042010 15:44600625-44600647 TTACTTTCCCCCTAGATGCATGG - Exonic
1127461812 15:59206114-59206136 TTGGGTGCCTACTGGATGCCAGG - Intronic
1128658191 15:69477969-69477991 TTAAGTACCTACCAAATGCAGGG + Intergenic
1128707355 15:69846602-69846624 TTAGGTCCCCACTATATGCCAGG - Intergenic
1130680173 15:85989742-85989764 TTAAGTGCCTACTGTATGCATGG + Intergenic
1131635679 15:94231168-94231190 GTAGGTCCCTAATAGATTCATGG - Intergenic
1131816262 15:96224135-96224157 TGTGGTTCCTACTAGATAAATGG - Intergenic
1134387921 16:13791621-13791643 TTGGGTTCCTACCAGAGCCAAGG - Intergenic
1138259776 16:55608644-55608666 TTAAGTTCCTTATAGATGCTGGG + Intergenic
1142610355 17:1106333-1106355 TTGGATTCCTACTAGCTGCCAGG + Intronic
1146532579 17:33622100-33622122 TCAGGATCCTACTAGGTGCCTGG + Intronic
1149008394 17:51829611-51829633 TTAGGTACCTAGTATATGCCAGG + Intronic
1149405047 17:56340176-56340198 TTAAGTTCCTTGTAGATGCTGGG + Intronic
1151956750 17:77383984-77384006 TTAGGCTTCTACTACATGCCAGG + Intronic
1153672421 18:7424766-7424788 TTAAGTTCCTTATAGATGCTGGG + Intergenic
1154402885 18:14058763-14058785 TTAGGTTCCTTATAGATTCTGGG + Intronic
1156834647 18:41537903-41537925 TTAGGTTCATACTTGTTTCAAGG - Intergenic
1159098944 18:63937205-63937227 TTCAGTTCCTCCTAGATGCCCGG + Intergenic
1159281141 18:66287801-66287823 TTATGCTCCTACTTGATGAAGGG - Intergenic
1159707023 18:71703340-71703362 TTATGTTTGTACTAAATGCAAGG + Intergenic
1165016293 19:32882653-32882675 TTAGGTTACCAGTTGATGCAGGG - Intronic
1166095449 19:40535986-40536008 TTAGGTACCTACTATGTGCCCGG + Intronic
927072263 2:19543051-19543073 TTAGGTTCCTAATGAAAGCATGG - Intergenic
930166781 2:48210863-48210885 TTAAGTCCCTACTATATGCTAGG - Intergenic
930258802 2:49121531-49121553 TTAGGTGTCTACTAGATTCCAGG + Intronic
933564039 2:83927410-83927432 TTAAGTTCCTAGAATATGCAAGG - Intergenic
933700696 2:85253475-85253497 TCAGGTTCCTACTAATTGCAAGG + Intronic
934723884 2:96602436-96602458 TTGAGTGCCTACTACATGCAAGG + Intronic
935059871 2:99597937-99597959 TTAGGTGCCTACGAGGTCCATGG - Intronic
935635195 2:105244506-105244528 TTAAGTGCCTACTAGGTGTAAGG + Intergenic
936156655 2:110051339-110051361 CTAGGTTCCTACCATATGCCAGG - Intergenic
936188037 2:110320105-110320127 CTAGGTTCCTACCATATGCCAGG + Intergenic
936833509 2:116678715-116678737 TTATGTTGTTACTACATGCAAGG - Intergenic
936921101 2:117689433-117689455 TTAAGTTCCTTATAGATGCTGGG - Intergenic
937363972 2:121247418-121247440 GTAGGTTCCTACTACATAAATGG + Intronic
937961846 2:127466138-127466160 TTAGGCACCTACTGGATGCTGGG + Intronic
939095982 2:137833929-137833951 TTAGGTGCTTACTATATGTAAGG + Intergenic
939525512 2:143288913-143288935 TCAGGGACCTTCTAGATGCAAGG + Intronic
940712096 2:157174891-157174913 TTAAGTCCCTACTACATGCTAGG - Intergenic
941034905 2:160557944-160557966 TTAAGTTCCTTATAGATGCTGGG - Intergenic
941135595 2:161714240-161714262 TTGGGTTCCTACCAGGTGAATGG - Intronic
941494326 2:166181466-166181488 TTAGGTTGCTATGAGATCCAGGG + Intergenic
942405998 2:175655809-175655831 TTAAGTTCCTTATAGATGCTGGG - Intergenic
943672160 2:190674608-190674630 TTAAGTGCCTATTAGGTGCAAGG - Intronic
943888261 2:193251166-193251188 TTAAGTTCTTATCAGATGCATGG - Intergenic
944775545 2:202960634-202960656 TTGGGTTTCTAACAGATGCATGG + Intronic
1168824691 20:801999-802021 TAATGTTCCTAATAGATACAGGG + Intergenic
1169938293 20:10909141-10909163 TTCCTTTCCTACTAGATGGATGG + Intergenic
1171727864 20:28642332-28642354 TTAAATTCGTACTAAATGCAAGG - Intergenic
1172064723 20:32211022-32211044 TTGGGTTCTTACTAGTTGCATGG + Intronic
1172529157 20:35618435-35618457 TTAGGTTCCTGTTGGATGAAGGG - Exonic
1174132311 20:48354421-48354443 TTTGGTTCCTACTGGGTCCAAGG + Intergenic
1175308731 20:57996189-57996211 TCAGGTTCACACTGGATGCATGG + Intergenic
1175340513 20:58226436-58226458 TTGGGCTCCTGCTATATGCAGGG + Intronic
1176314437 21:5228864-5228886 TTAACTTCCTACTAAATGCAAGG - Intergenic
1177043533 21:16142403-16142425 TTAAGTTCCTTATAGATGCTGGG + Intergenic
1178514723 21:33236818-33236840 GTAGGATCCTTCTAGCTGCAGGG + Intronic
1179092758 21:38282729-38282751 TTAAGTTCCTACCACATGCCAGG + Intronic
1180392222 22:12294838-12294860 TTAACTTCCTACTAAATGCAAGG - Intergenic
1180407523 22:12569933-12569955 TTAACTTCCTACTAAATGCAAGG + Intergenic
1181979413 22:26755461-26755483 TTAGGTGCCTACTAGATGCTGGG + Intergenic
1183901330 22:41008232-41008254 TCAAGTGCCTACTACATGCAGGG - Intergenic
949848707 3:8399036-8399058 GTAGGTGCTTACTAGATACAAGG - Intergenic
950067919 3:10128171-10128193 TTGAGTTCCTGCTATATGCAAGG + Intergenic
951274179 3:20664911-20664933 TTAAGTTCCTTATAGATGCTGGG + Intergenic
951538283 3:23759527-23759549 TAAGTTTCCTACTGTATGCAAGG - Intergenic
955214137 3:56971093-56971115 TTAAGCTCCTATTAGCTGCAAGG - Intronic
955522393 3:59787658-59787680 TTAGGTACTTACTACATGCCAGG + Intronic
955771906 3:62393685-62393707 TTGAGTGCCTACTACATGCAAGG + Intergenic
956899546 3:73700792-73700814 TTAGACTCCTACTAGATACTTGG + Intergenic
958012055 3:87892013-87892035 TTAGGTTTCTGCAAGATCCAGGG - Intergenic
959824923 3:110782592-110782614 TTAGGTACCTACTATATTCTAGG + Intergenic
960422196 3:117460644-117460666 TTAAGTTCCTTATAGATGCTAGG - Intergenic
963296829 3:143555775-143555797 TTAGTTTTCTACTGGAGGCAAGG - Intronic
963925865 3:150950431-150950453 TTAAGTTCCTCATAGATGCTGGG - Intronic
966395398 3:179497595-179497617 TTAGCTCCCTATTAGATACATGG - Intergenic
966788565 3:183642671-183642693 TTAAGTTTCTACAAGATTCAAGG + Intronic
967719561 3:192801078-192801100 TTATGTTCCTACTGCATGCACGG - Intronic
969242324 4:5908101-5908123 TTAAGTACCTACTATATGCCAGG + Intronic
971566952 4:28156736-28156758 TTAAGTTCCTTATAGATGCTGGG - Intergenic
973151569 4:46894757-46894779 TTAAGTTCCTTATAGATGCTGGG - Intronic
973322282 4:48822663-48822685 TTAAGTTCCTTATAGATTCAGGG - Intronic
973580186 4:52336212-52336234 TTAGGTTCATCCCAGATTCAAGG + Intergenic
974493122 4:62592090-62592112 TTAGAGTGCTACAAGATGCATGG + Intergenic
975347379 4:73308006-73308028 TTTGGTTGCTAGGAGATGCAAGG - Intergenic
975788550 4:77921953-77921975 TTGGGTACCTACTATATGCCAGG + Intronic
976452958 4:85213047-85213069 TTAAGTTCCTTATAGATGCTGGG + Intergenic
976926143 4:90499237-90499259 TTAAGTGCCTACTATATGCAAGG + Intronic
977421883 4:96811169-96811191 TTAAGTTCCTTATAGATGCTGGG + Intergenic
977581399 4:98729017-98729039 TGAGCTTCATCCTAGATGCAGGG - Intergenic
979342584 4:119543991-119544013 TTTAGTTCCTACTATATGCTAGG - Intronic
979531354 4:121772132-121772154 TTAGGTGCTTACTAAATGCCAGG - Intergenic
980073926 4:128273432-128273454 TTACGTTCCTACTTTATGCCAGG - Intronic
980890466 4:138809552-138809574 ATAGCTTCCTGCAAGATGCAGGG + Intergenic
982330742 4:154179287-154179309 TTAGGTCCCTACCAGTTGCTAGG + Intergenic
983620731 4:169758203-169758225 TCAGGTGTCTACTAGAGGCAAGG + Intergenic
985432684 4:189896534-189896556 TTAAGTTCCTACTAAATGCAAGG + Intergenic
986611754 5:9575359-9575381 TTAATTTCCTGCTAGATGCCAGG + Intergenic
987442781 5:17977346-17977368 TTGAGTTCCTACTGTATGCAAGG + Intergenic
988802852 5:34712970-34712992 TTTAGTACCTACTAGATGCAAGG + Intronic
990138137 5:52671763-52671785 TTGTGTGCCCACTAGATGCAGGG - Intergenic
991989874 5:72326923-72326945 CTGGGTTCCTACTATATGCTGGG + Intronic
992398598 5:76390620-76390642 CTGGGTGCCTACTATATGCAAGG + Intergenic
992986862 5:82239339-82239361 TTGAGTACCTACTAGATGAAAGG + Intronic
994069834 5:95588597-95588619 TTAAGTACCTACTAGCTGTAAGG + Intronic
994252115 5:97548303-97548325 TTGGGTTCCTACCAGCAGCAAGG - Intergenic
994387915 5:99153949-99153971 TTAAGTTCCTTATAGATGCTGGG - Intergenic
994598139 5:101865531-101865553 TTAAGTTCCTTATAGATGCTGGG - Intergenic
994803317 5:104408716-104408738 TTAGGTTGCTAATAGCTGGAGGG + Intergenic
995916270 5:117248879-117248901 TTAGATTCCTTCTTGCTGCATGG + Intergenic
996522861 5:124446920-124446942 TTAGGTTCCTATTACATGACTGG - Intergenic
998637833 5:143976062-143976084 TTGGGTTCCCACTATCTGCAAGG - Intergenic
999934114 5:156466591-156466613 TTGGGTTCTTACTAGATGTGTGG + Intronic
1000790146 5:165596165-165596187 TTGAGTGCCTACTATATGCAAGG + Intergenic
1000798697 5:165696967-165696989 TTAAGTTCCTTGTAGATGCTGGG - Intergenic
1001793753 5:174484129-174484151 TTGGGTACCTACTATATGCCAGG - Intergenic
1002025312 5:176392755-176392777 CTAGGTGCCTGCTAGGTGCATGG - Exonic
1002364459 5:178699222-178699244 GCAGGCTCCTGCTAGATGCAGGG - Intergenic
1004802709 6:19168252-19168274 TTAGGTATCTACTAAATGTATGG - Intergenic
1004884720 6:20040495-20040517 TGAGGTGCCTACTACATGCTAGG + Intergenic
1007475525 6:42117203-42117225 TTAGGCATCTACTAGGTGCAAGG + Intronic
1013166731 6:107600827-107600849 TTGGGTGCCTACTATGTGCAGGG + Intronic
1014898591 6:126934420-126934442 TTAAGTTCCTACGATATGCCAGG - Intergenic
1015448399 6:133335420-133335442 TGAGGATCCTACTAAATGCCAGG + Intronic
1016279965 6:142404930-142404952 TCAAGTTCCTACTACATGCCAGG + Intronic
1016662396 6:146596692-146596714 TTGAGTACCTACTACATGCAAGG - Intergenic
1017818984 6:158035932-158035954 TTAAGTTCCTTATAGATGCTGGG - Intronic
1018088983 6:160329403-160329425 TTAGGGACATACTAGCTGCAGGG + Intergenic
1018366013 6:163120594-163120616 TTAAGTGCCTACTATGTGCAAGG + Intronic
1019895520 7:3979482-3979504 TTAGGTTCCTACTGTATACCTGG - Intronic
1023065392 7:36372721-36372743 TTAAGTTCCTATTATATACAAGG + Intronic
1024733818 7:52281486-52281508 TTAGGTTCCTTATAGATGCTGGG + Intergenic
1027422115 7:78026919-78026941 TGAGGTACTTACTAGATGCCAGG + Intronic
1030615104 7:111730482-111730504 TTAGGCTCCTACTAAATGACAGG - Intronic
1030723750 7:112900368-112900390 GTAGGTTCCAGCTAGATGGAAGG + Intronic
1033246245 7:139718692-139718714 TTAAGTTCCTACTAAATACTTGG - Intronic
1035698263 8:1617584-1617606 TTAAGTTCCTTATAGATGCTGGG + Intronic
1036198674 8:6746907-6746929 TTAGGTTCCTACTAGGGTTAAGG - Intronic
1038170949 8:25131499-25131521 TTAGGTTCAGACTAGCTCCATGG - Intergenic
1038519183 8:28215137-28215159 TTAAGTTCCTTATAGATGCTGGG + Intergenic
1041133726 8:54733325-54733347 TTAAGCTCCTATTATATGCAGGG - Intergenic
1046109045 8:109699470-109699492 TTAAGTGCCTACTGTATGCAAGG - Intergenic
1048162659 8:132035289-132035311 TTAAGCTCCTACTACATGCTAGG + Intronic
1048398498 8:134039140-134039162 TTAAGTTCCTTATAGATGCTGGG + Intergenic
1048814905 8:138323353-138323375 TGAGGTTTCTCCTAGCTGCAAGG - Intronic
1051235279 9:14992997-14993019 TCAGGTGTCTACTAGAGGCAAGG - Intergenic
1053580772 9:39402035-39402057 TTAAGTTCCTTATAGATGCTGGG - Intergenic
1053721868 9:40954755-40954777 TTAAGTTCCTACTACATGCAAGG + Intergenic
1053845266 9:42230083-42230105 TTAAGTTCCTTATAGATGCTGGG - Intergenic
1054102358 9:60960840-60960862 TTAAGTTCCTTATAGATGCTGGG - Intergenic
1054344097 9:63897234-63897256 TTAAGTTCCTACTACATGCAAGG - Intergenic
1054583999 9:66946022-66946044 TTAAGTTCCTTATAGATGCTGGG + Intergenic
1054944275 9:70778427-70778449 TTGAGTGCCTACTATATGCATGG - Intronic
1055174982 9:73306591-73306613 TTAGTATCCTATTAGATGTAGGG - Intergenic
1056082386 9:83109205-83109227 TTAGGTTCCTACAATGTGCAAGG - Intergenic
1056146561 9:83736888-83736910 TTAAGTTCCTTATAGATGCTGGG + Intergenic
1056181436 9:84086859-84086881 TTAAGTTCCTTATAGATGCTGGG + Intergenic
1056329194 9:85507928-85507950 TTAGATTCCTACTAAATGGTTGG + Intergenic
1058160146 9:101561412-101561434 TTTTGTGCCTACTAGGTGCAAGG - Intronic
1058670161 9:107354555-107354577 TTGGGTGCCTACTCCATGCATGG - Intergenic
1060388586 9:123258142-123258164 TCGGGTTCCTACTAAATGCCAGG + Intronic
1061352284 9:130074916-130074938 TTGAGTGCCTACTAGATGCCAGG + Intronic
1203421119 Un_KI270448v1:7012-7034 TTAAATTCCTACTAAATGCAAGG + Intergenic
1203421690 Un_KI270521v1:6527-6549 TTAAATTCCTACTAAATGCAAGG + Intergenic
1187217792 X:17293921-17293943 TTAGGTGCATACTATATGCCAGG + Intergenic
1187935832 X:24334973-24334995 TTAAGTACCTACTATATGCCAGG + Intergenic
1188342778 X:29025569-29025591 TTGGGTTCCTACTATATTCTAGG + Intronic
1190485397 X:50918608-50918630 TTAAGGACCTACTAGATGCCAGG - Intergenic
1191940512 X:66475501-66475523 TTAAGTACCTACTACATACAAGG - Intergenic
1192383059 X:70637024-70637046 TTAGGTTCCTTGTAGATGCTGGG - Intronic
1192716899 X:73652505-73652527 TTAAGTTCCTAGTAGATTCTGGG - Intronic
1193701764 X:84771524-84771546 TTGAGGTCCTACTATATGCAAGG + Intergenic
1193987662 X:88265862-88265884 TTAAGTTCCTTATAGATGCTGGG - Intergenic
1196065058 X:111455071-111455093 TTAAGTTCCTTATAGATGCTGGG - Intergenic
1196191342 X:112797972-112797994 TTAGGTACCTATTATATCCAAGG + Intronic
1196290954 X:113940153-113940175 TTGGATTCCTACTATATGTATGG - Intergenic
1196768193 X:119268723-119268745 TTAAGTTCCTACTATATGTTAGG - Intergenic
1197636559 X:128921319-128921341 TTAGGTGCCTTCTATATGCTAGG - Intergenic
1199178574 X:144823663-144823685 TTGAGTTCCTAATAAATGCATGG - Intergenic