ID: 1087543849

View in Genome Browser
Species Human (GRCh38)
Location 11:99558585-99558607
Sequence CTGTATAATAGCTCTTTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 4, 3: 28, 4: 257}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087543849_1087543854 20 Left 1087543849 11:99558585-99558607 CCTGCAAAAGAGCTATTATACAG 0: 1
1: 0
2: 4
3: 28
4: 257
Right 1087543854 11:99558628-99558650 AAAATACTCAGCCTGATATGGGG 0: 1
1: 0
2: 1
3: 20
4: 153
1087543849_1087543852 18 Left 1087543849 11:99558585-99558607 CCTGCAAAAGAGCTATTATACAG 0: 1
1: 0
2: 4
3: 28
4: 257
Right 1087543852 11:99558626-99558648 CAAAAATACTCAGCCTGATATGG 0: 1
1: 0
2: 0
3: 24
4: 261
1087543849_1087543853 19 Left 1087543849 11:99558585-99558607 CCTGCAAAAGAGCTATTATACAG 0: 1
1: 0
2: 4
3: 28
4: 257
Right 1087543853 11:99558627-99558649 AAAAATACTCAGCCTGATATGGG 0: 1
1: 0
2: 1
3: 22
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087543849 Original CRISPR CTGTATAATAGCTCTTTTGC AGG (reversed) Intronic
901946246 1:12706434-12706456 CTGAATGGTAGCTCTTTTCCAGG - Intergenic
902052066 1:13571579-13571601 CTGCATGGTAGCTCTTTTCCAGG + Intergenic
902676716 1:18013836-18013858 CTGTAAAATAGATGTTTTGAGGG - Intergenic
906499270 1:46329323-46329345 CTGCATGGTAGCTCTTTTCCAGG - Intergenic
909475705 1:76078640-76078662 CTGTATATTAGTTATATTGCAGG + Intronic
912816065 1:112829639-112829661 CTGCATGGTAGCTCTTTTCCAGG + Intergenic
912980375 1:114365717-114365739 CTGCATGGTAGCTCTTTTCCAGG - Intergenic
916766493 1:167865870-167865892 CTGCATGGTAGCTCTTTTCCAGG + Intronic
917115872 1:171603034-171603056 CTGCATGGTAGCTCTTTTCCAGG + Intergenic
917311669 1:173685421-173685443 CTTTATGGTAGCTCTTTTCCAGG - Intergenic
918906664 1:190505288-190505310 CTGTATATTAGCCCTTTGTCAGG + Intergenic
921074684 1:211690817-211690839 CTGCATGGTAGCTCTTTTCCAGG + Intergenic
921571900 1:216789838-216789860 CTGTATTCCAGCTCTTTGGCAGG + Intronic
922235045 1:223716381-223716403 CTGGATAAGAGCTCTCTGGCAGG + Intronic
922680723 1:227593142-227593164 CTGCATGGTAGCTCTTTTCCAGG - Intronic
922690197 1:227682962-227682984 CTGCATGGTAGCTCTTTTCCAGG + Intergenic
924548455 1:245052121-245052143 CTGCAGAATAGCTGTTTTGAGGG + Intronic
924859029 1:247902086-247902108 CTGCATGGTAGCTCTTTTCCAGG - Intergenic
1064024811 10:11839528-11839550 CTTTATAATAACTCCTTGGCTGG + Intronic
1065802371 10:29364229-29364251 CTGCATAGTAGCTCTTTTGCAGG - Intergenic
1065931052 10:30479429-30479451 CTGCATGGTAGCTCTTTTCCAGG + Intergenic
1068249566 10:54420378-54420400 ATTTATACTAGCTCTTTTTCTGG - Intronic
1068671756 10:59730232-59730254 CTGCATGGTAGCTCTTTTCCAGG - Intronic
1068675758 10:59767709-59767731 CTGCATGGTAGCTCTTTTCCAGG - Intergenic
1069939290 10:71943439-71943461 CTGCATGGTAGCTCTTTTCCAGG + Intergenic
1070184651 10:74049434-74049456 CTGTATTATAGCTCTTTAATTGG - Intronic
1071283041 10:84120170-84120192 CTGCATGATAGCTCTTTTCCAGG - Intergenic
1072334842 10:94388833-94388855 CTGCATGGTAGCTCTTTTCCAGG + Intergenic
1073845636 10:107550725-107550747 CTGGATATTAGCTCTTTGTCAGG - Intergenic
1074092003 10:110269318-110269340 TTGTATAATAGCTCATTTTAAGG - Intronic
1076113724 10:127880917-127880939 CTGTATACAAGCCCTTCTGCAGG + Intronic
1077797346 11:5506442-5506464 GTACATAATAGCTCTTCTGCAGG + Intronic
1077951834 11:6967677-6967699 CTGGATATTAGCCCTTTTTCAGG + Intronic
1078931848 11:15918652-15918674 CTTTCTGATACCTCTTTTGCAGG + Intergenic
1079701999 11:23559517-23559539 CTTTTTAATAGCTTTTTTGGGGG - Intergenic
1083559733 11:63663797-63663819 CTATATAATAGATTTTTAGCTGG + Intronic
1085998786 11:81954194-81954216 CTGCATGATAGCTCTTTTCCGGG + Intergenic
1086037129 11:82430159-82430181 CTGAATAATAGCTCATTGTCTGG - Intergenic
1086538097 11:87873953-87873975 CTGCATAATAGTTCTTTGTCAGG + Intergenic
1086973421 11:93107273-93107295 CTGCATGGTAGCTCTTTTCCAGG - Intergenic
1087543849 11:99558585-99558607 CTGTATAATAGCTCTTTTGCAGG - Intronic
1087561525 11:99796533-99796555 CCGTATCATAGCTCATATGCTGG - Intronic
1087639987 11:100746384-100746406 CTGCATGGTAGCTCTTTTCCAGG - Intronic
1088175091 11:107044653-107044675 TTTAATAACAGCTCTTTTGCGGG - Intergenic
1088220292 11:107563606-107563628 CTCTAAAATAGCTCCTTTGAAGG - Intronic
1089108805 11:116037732-116037754 CTCTGGAAAAGCTCTTTTGCAGG + Intergenic
1089900741 11:121981082-121981104 AGGTCTAATAGCTCTTTTGTGGG - Intergenic
1090323776 11:125867392-125867414 CTGTATGGTAGCTCTTTTCCAGG - Intergenic
1093562462 12:20558457-20558479 ATTTAGAATAGCTATTTTGCTGG - Intronic
1093978274 12:25447993-25448015 CTGTAAAATATTTATTTTGCAGG + Intronic
1094487360 12:30935638-30935660 CTATATAATAGCACTTTAGGAGG - Intronic
1094942468 12:35788264-35788286 GTGTATAATATTTCTTTTGATGG + Intergenic
1094985360 12:36481628-36481650 GTGTATAATATTTCTTTTGATGG + Intergenic
1095007598 12:36841779-36841801 GTGTATAATATTTCTTTTGATGG + Intergenic
1095016384 12:36983870-36983892 GTGTATAATATTTCTTTTGATGG + Intergenic
1096207757 12:49737753-49737775 CTGCATGGTAGCTCTTTTCCAGG + Intronic
1096908052 12:54953996-54954018 CTGTATAATGCTTCTCTTGCTGG + Intronic
1097514639 12:60589546-60589568 CTGGATAATTTCTCTTTTTCAGG + Intergenic
1098248434 12:68544197-68544219 CTGCATGGTAGCTCTTTTCCAGG + Intergenic
1099246900 12:80202856-80202878 CTGCAGAATAGCTCTTTTTTTGG + Intergenic
1100709274 12:97237319-97237341 CTGTATAATGGAGTTTTTGCTGG + Intergenic
1101198023 12:102405535-102405557 CTTAATAATATCTATTTTGCGGG - Intronic
1101469337 12:104981970-104981992 CTGTATACTAGCACTTTGGGAGG - Intergenic
1103856680 12:123974871-123974893 CTTTAAAACAGCTTTTTTGCTGG + Intronic
1104203462 12:126614529-126614551 CTGTATGGCAGCTCTTTTCCAGG - Intergenic
1105225727 13:18429815-18429837 CTGTATGGTAGCTCTTTTCCAGG + Intergenic
1105695640 13:22886057-22886079 CTGCATGGTAGCTCTTTTCCAGG + Intergenic
1109058199 13:57580227-57580249 CTTTATAATATCTATTTTTCTGG + Intergenic
1109765230 13:66886615-66886637 CTGTATACTCCCTCATTTGCAGG + Intronic
1109967856 13:69724883-69724905 CTGCATAATAGATTTTTTACTGG - Intronic
1114010180 14:18358166-18358188 CTGTATGGTAGCTCTTTTCCAGG + Intergenic
1114146195 14:19980636-19980658 CTGCATGGTAGCTCTTTTCCAGG + Intergenic
1114235998 14:20824324-20824346 CTGCATGGTAGCTCTTTTCCAGG - Intergenic
1117179449 14:53177340-53177362 CTGCATGGTAGCTCTTTTCCAGG - Intergenic
1117955155 14:61117123-61117145 CTGCATGGTAGCTCTTTTCCAGG - Intergenic
1124533520 15:30525332-30525354 CTCTACAATAGCTGTGTTGCAGG + Intergenic
1124765135 15:32482313-32482335 CTCTACAATAGCTGTGTTGCAGG - Intergenic
1125375101 15:39020405-39020427 TTTGTTAATAGCTCTTTTGCTGG + Intergenic
1125690412 15:41591596-41591618 CTGCATGGTAGCTCTTTTCCAGG + Intergenic
1132155056 15:99489801-99489823 CCTTATAGTTGCTCTTTTGCAGG + Intergenic
1133960984 16:10493219-10493241 CTCTATGGTAGCTCTTTTCCAGG + Intergenic
1135031435 16:19041919-19041941 CTGTAGAATAGCTCCTATTCTGG + Intronic
1138617802 16:58184825-58184847 ATGTATCATAGGTCTTTTGGGGG + Intronic
1139073587 16:63415229-63415251 CTGTACAAGGGCTCATTTGCTGG + Intergenic
1146764204 17:35504596-35504618 CTGCATGGTAGCTCTTTTCCAGG + Intronic
1148509097 17:48153673-48153695 GTGCATAATAGCTCTTTGACAGG + Intronic
1148523930 17:48311454-48311476 CTAAATAATTGCTTTTTTGCGGG + Intronic
1153830427 18:8917635-8917657 CTGCATGGTAGCTCTTTTCCAGG + Intergenic
1154014096 18:10601159-10601181 CTGCATGGTAGCTCTTTTCCAGG - Intergenic
1154460573 18:14580823-14580845 GTGTATAAGAGATCTTTTTCTGG + Intergenic
1154463323 18:14618212-14618234 CTGCATGGTAGCTCTTTTCCAGG + Intergenic
1154527651 18:15309706-15309728 CTGTATGGTAGCTCTTTTCCAGG - Intergenic
1155739851 18:29275517-29275539 ATGTATAAGAGCTCTTTTGTTGG + Intergenic
1155812959 18:30261316-30261338 CTGTATAATTTCTCTGCTGCCGG + Intergenic
1158157786 18:54444703-54444725 CTTTATAATAGCTGTATTGAAGG + Intergenic
1163867047 19:19782249-19782271 CTGCATGGTAGCTCTTTTTCAGG - Intergenic
1163934478 19:20429884-20429906 CTGCATGATAGCTCTTTTCCAGG - Intergenic
1163991896 19:21006611-21006633 CTGCATGGTAGCTCTTTTCCAGG + Intergenic
1167906926 19:52668828-52668850 CTGGATGCTAGCTCTTTTCCAGG + Intronic
1167935409 19:52902339-52902361 CTGCATGGTAGCTCTTTTCCAGG - Intergenic
926028870 2:9568343-9568365 CTGCAAAATAAATCTTTTGCAGG + Intergenic
926491411 2:13529724-13529746 CTGCATGGTAGCTCTTTTCCAGG - Intergenic
928220086 2:29396210-29396232 CTGGATAATAACGCTGTTGCAGG + Intronic
928680784 2:33700190-33700212 CTTCATTATAGCTCTTTTGCTGG + Intergenic
933389385 2:81651508-81651530 CTGCATGGTAGCTCTTTTCCAGG - Intergenic
935721449 2:105982866-105982888 CTGCATGGTAGCTCTTTTCCAGG - Intergenic
935871555 2:107456007-107456029 CACTCTCATAGCTCTTTTGCTGG + Intergenic
937162227 2:119775328-119775350 CTGGACAATAACTCTTTTTCTGG + Intronic
937364586 2:121252340-121252362 CTATATAATAGCTCTTGTCTGGG - Intronic
938526746 2:132141163-132141185 CTGTATGGTAGCTCTTTTCCAGG - Intergenic
941407934 2:165115144-165115166 CTGTATCTTAGAGCTTTTGCAGG - Intronic
942316280 2:174699363-174699385 CTGGATAATAACTCCTTTGAGGG - Intergenic
943408138 2:187514358-187514380 CTGCATGGTAGCTCTTTTCCAGG + Intronic
943483077 2:188446302-188446324 CTGGATAATAGCTATTTTCTGGG + Intronic
944108457 2:196104911-196104933 CTCTCTAATTGCTCTTTTCCTGG - Intergenic
944108537 2:196105969-196105991 CTGGATCATTGCTCTTTTCCTGG - Intergenic
945289780 2:208115774-208115796 CTGCATGGTAGCTCTTTTCCAGG + Intergenic
945338139 2:208617387-208617409 CTGTATAATATCTATTTCTCTGG + Intronic
945720327 2:213410808-213410830 CTGCATGGTAGCTCTTTTCCAGG + Intronic
946781812 2:223199126-223199148 TTGTATAGTAGCTCTTTTTTTGG - Intergenic
1168824282 20:798931-798953 CTGCATGGTAGCTCTTTTCCAGG + Intergenic
1173225329 20:41159301-41159323 CTGGAGTCTAGCTCTTTTGCAGG + Intronic
1175513835 20:59555336-59555358 CTGCATAGTAGCTCTTTTCCAGG - Intergenic
1176769781 21:13058838-13058860 CTGTATGGTAGCTCTTTTCCAGG + Intergenic
1176810539 21:13533181-13533203 ATGTATGATAGGTCTTTTGAAGG + Intergenic
1176811203 21:13540161-13540183 CTGCATGGTAGCTCTTTTCCAGG - Intergenic
1177161964 21:17557746-17557768 CTGTAGATTAGCTCTTCTTCTGG - Intronic
1177382962 21:20369564-20369586 CTATATACCAGCTATTTTGCTGG - Intergenic
1179670841 21:42946515-42946537 CTGCATGGTAGCTCTTTTCCAGG - Intergenic
1180434678 22:15288967-15288989 CTGTATGGTAGCTCTTTTCCAGG + Intergenic
1180516887 22:16152781-16152803 CTGTATGGTAGCTCTTTTCCAGG + Intergenic
1182188630 22:28435066-28435088 CTGCATATAAGCTTTTTTGCTGG - Intronic
949276182 3:2284667-2284689 CATTTTAATAGCTCTATTGCAGG - Intronic
949610905 3:5702514-5702536 CTGCATGGTAGCTCTTTTCCAGG - Intergenic
949743625 3:7264062-7264084 CTGCATCATAGCTCCTGTGCTGG - Intronic
950594203 3:13964647-13964669 CCGTATGGTAGCTCTTTTCCAGG - Intronic
952372195 3:32733451-32733473 CTGTACAATTCCTTTTTTGCTGG - Exonic
952685093 3:36138432-36138454 CTCTCTTATAGCTCTTTTCCTGG + Intergenic
954604836 3:51901227-51901249 CTGCATGGTAGCTCTTTTCCAGG + Intronic
955168918 3:56543890-56543912 CTGGATATTAGCCCTTTTTCCGG - Intergenic
956655335 3:71544795-71544817 TTGGATAATAGTTCTTTTCCAGG + Intronic
957546706 3:81647256-81647278 CTGTATAAAAGCTACCTTGCAGG - Intronic
957999879 3:87737331-87737353 CTGCATGGTAGCTCTTTTCCAGG - Intergenic
959293961 3:104511962-104511984 CTGTGGAATATTTCTTTTGCTGG + Intergenic
960720269 3:120618591-120618613 CTGCATGGTAGCTCTTTTCCAGG - Intergenic
962097412 3:132306633-132306655 CTGCATAGTAGCTCTTTTCCAGG + Intergenic
963287338 3:143446005-143446027 ATGAATTATAGCTCTTTTGAAGG + Intronic
964020823 3:152008193-152008215 CTGGATATTAGCTCTTTGTCAGG + Intergenic
964611955 3:158624589-158624611 CTGTATAGTAGCTCTTTTCCAGG - Intergenic
964794665 3:160483820-160483842 CTGTATAAGGCCTCTTATGCTGG + Intronic
966489914 3:180516538-180516560 CTGCATCATAGCTCCTGTGCTGG + Intergenic
967715166 3:192754211-192754233 CAGTACAAAAGCTCTTTTGATGG - Intronic
972217095 4:36909604-36909626 CTGCATGGTAGCTCTTTTCCAGG + Intergenic
972274982 4:37548974-37548996 CTGCATGGTAGCTCTTTTCCAGG + Intronic
972785070 4:42319012-42319034 CTGCATGGTAGCTCTTTTCCAGG + Intergenic
972886344 4:43494140-43494162 TTGTATAATATTTCTTTGGCAGG - Intergenic
972991185 4:44823872-44823894 CTGCATGGTAGCTCTTTTCCAGG - Intergenic
974347660 4:60702572-60702594 CTGGATAATAGGTATTATGCTGG - Intergenic
974739058 4:65980568-65980590 CTGTATTATAGCACTTTGGGAGG - Intergenic
976831230 4:89317016-89317038 CTGTATAAAAGCTCTGAGGCAGG + Intergenic
976990293 4:91356894-91356916 CTGTATGGTAGCTGTTTTCCAGG - Intronic
977043530 4:92042165-92042187 CTGCATGGTAGCTCTTTTCCAGG - Intergenic
979052524 4:115953042-115953064 CTGCATGGTAGCTCTTTTCCAGG + Intergenic
979399174 4:120226856-120226878 CTGTCTGATTGCTCTCTTGCTGG + Intergenic
979967938 4:127098454-127098476 CTGTATTTTAGGCCTTTTGCTGG - Intergenic
980073042 4:128263893-128263915 CTGCATGGTAGCTCTTTTCCAGG + Intergenic
980257709 4:130403316-130403338 CTGCATCATAGCTCCTGTGCTGG - Intergenic
980636503 4:135511231-135511253 CTGTTTAACAGCTCTTTTTAGGG + Intergenic
981076514 4:140597962-140597984 CTGTATAGTAGCTCTTTTCCAGG - Intergenic
981983480 4:150825901-150825923 CTTTACAATAGTTCTTATGCGGG - Intronic
982601410 4:157455368-157455390 CTGGATATTAGCTCTTTCTCAGG + Intergenic
982662727 4:158225950-158225972 CTGCATGGTAGCTCTTTTCCAGG - Intronic
983708479 4:170687064-170687086 CTGCATGGTAGCTCTTTTCCAGG + Intergenic
983898013 4:173102480-173102502 CTGCATGGTAGCTCTTTTCCAGG + Intergenic
985173705 4:187178378-187178400 CAGGCCAATAGCTCTTTTGCTGG + Intergenic
988278320 5:29112693-29112715 CTTTATAATATCTATTTTTCTGG + Intergenic
989096005 5:37781842-37781864 CTGCATGGTAGCTCTTTTCCAGG - Intergenic
991200965 5:63991999-63992021 CAGGCTAATAGTTCTTTTGCGGG + Intergenic
992989645 5:82271036-82271058 CTGCATGGTAGCTCTTTTCCGGG - Intronic
995788945 5:115862944-115862966 CTTTACAATAGTCCTTTTGCTGG - Intronic
995894678 5:116998249-116998271 CTGTACCATAGCTCCTGTGCTGG + Intergenic
995931947 5:117456098-117456120 CTGTAGGAGAGCTCCTTTGCTGG - Intergenic
998114759 5:139527969-139527991 CTGCATGGTAGCTCTTTTCCAGG + Intronic
998808579 5:145942563-145942585 CTGTATCACAGCTCTATTACAGG - Intronic
998938536 5:147256351-147256373 CTGCATGGTAGCTCTTTTCCAGG - Intronic
999807799 5:155100001-155100023 CTGCATAATATTTCTTTTGTGGG + Intergenic
999931292 5:156435605-156435627 CTCTTGAATATCTCTTTTGCAGG + Intronic
1000604856 5:163316821-163316843 CTGCATGGTAGCTCTTTTCCAGG - Intergenic
1000642463 5:163718718-163718740 CCACATCATAGCTCTTTTGCTGG + Intergenic
1000714043 5:164618762-164618784 CTGTATAATATCTGTTTTAAAGG + Intergenic
1001558400 5:172652263-172652285 CTGCATGGTAGCTCTTTTCCAGG - Intronic
1002782236 6:375925-375947 CTGTCTAAACTCTCTTTTGCCGG + Intergenic
1002999076 6:2314155-2314177 CTGCATGGTAGCTCTTTTCCAGG - Intergenic
1003123919 6:3340106-3340128 CTGGATAATACCGCTTTTGTGGG - Intronic
1006032134 6:31184211-31184233 CTGCATGGTAGCTCTTTTCCAGG - Intergenic
1006325732 6:33352450-33352472 CTGCATGGTAGCTCTTTTCCAGG - Intergenic
1010317800 6:74470832-74470854 CTGCATGGTAGCTCTTTTCCAGG + Intergenic
1010336141 6:74685335-74685357 CTGCATCATAGCTCCTGTGCTGG + Intergenic
1010620431 6:78067348-78067370 CTGTAGAATATCTTTTTTACAGG - Intergenic
1010917385 6:81637046-81637068 CCTTGTAATAGCTCTTTTACAGG - Intronic
1011211899 6:84964486-84964508 CTGTATGGTAGCTCTTTTCCAGG - Intergenic
1011238174 6:85240755-85240777 CTGTATAATACATCTGTTGGTGG - Intergenic
1011570464 6:88729013-88729035 CTGCATGGTAGCTCTTTTCCAGG + Intronic
1012253680 6:97008275-97008297 CTTTACCATAGCTCCTTTGCTGG - Intronic
1013419085 6:109949885-109949907 CTCGGTAATAGCTCCTTTGCGGG - Intergenic
1013559251 6:111287954-111287976 CTGCATGGTAGCTCTTTTCCAGG - Intergenic
1016238438 6:141896932-141896954 ATGTATCATAGCTCTTTTAAAGG + Intergenic
1016561943 6:145405782-145405804 CTGTTGAATAGCTGTTTTCCAGG + Intergenic
1018191291 6:161311277-161311299 CTGCATGATAGCTCTTTTCCCGG - Intergenic
1021597591 7:22333807-22333829 CTGTATAGGTGCTCTTGTGCTGG + Intronic
1023337975 7:39189734-39189756 CTGAATAATAATTCTTCTGCAGG - Intronic
1023436252 7:40143466-40143488 CTGCATGGTAGCTCTTTTCCAGG - Intronic
1024406349 7:48985958-48985980 CTGGATATTAGATCTTTTTCAGG + Intergenic
1024500218 7:50097258-50097280 CTGTATAAAAGCTGTCTGGCAGG + Intronic
1024812985 7:53235311-53235333 CTGCATGATAGCTCTTTTCCAGG + Intergenic
1028334069 7:89629373-89629395 CTGCATGGTAGCTCTTTTCCAGG + Intergenic
1028793796 7:94881765-94881787 CTGCATGGTAGCTCTTTTCCAGG + Intergenic
1028848373 7:95508740-95508762 CATTTTAATAACTCTTTTGCTGG - Intronic
1029046356 7:97633174-97633196 CAGTATACTGGCTCCTTTGCAGG + Intergenic
1030016018 7:105222003-105222025 CTGTAAAATATCACTTTAGCAGG + Intronic
1031227623 7:119060716-119060738 CTGTATAACTCCTCTTTTCCTGG - Intergenic
1032782349 7:135174028-135174050 CTGCATGGTAGCTCTTTTCCAGG + Intergenic
1035750695 8:1994116-1994138 TTGTATAAAAGCTCTTCTTCAGG + Intronic
1035942229 8:3914217-3914239 CTCTATTCTAGCCCTTTTGCAGG - Intronic
1036104325 8:5824058-5824080 CTGTATGGTAACTCTTTTCCAGG - Intergenic
1038089705 8:24239550-24239572 CTGCATGGTAGCTCTTTTCCAGG + Intergenic
1038758925 8:30368273-30368295 TTGTATGATACCTCTTTTTCTGG - Intergenic
1038830865 8:31058739-31058761 CTGTATATTTTCTCTTTTTCGGG + Intronic
1038846240 8:31232154-31232176 CTGGATATTAGCTCTTTGTCAGG + Intergenic
1039235340 8:35496806-35496828 CTGTAGAATAGCTGCTTTGTAGG - Intronic
1040655589 8:49503869-49503891 TTATATAATAGATCTTTTACTGG + Intergenic
1041262495 8:56033975-56033997 CTGCCTGATAGCTCTGTTGCAGG - Intergenic
1041841668 8:62279262-62279284 CTGGATATTAGCCCTTTTTCAGG + Intronic
1041983049 8:63885918-63885940 CAGTCTAATAGTTTTTTTGCAGG + Intergenic
1042087799 8:65127856-65127878 CTGCATGATAGCTCTTTTCCAGG - Intergenic
1042767180 8:72335784-72335806 TTGAATAATAGCCCTTTTTCTGG + Intergenic
1043856703 8:85273416-85273438 CTGGATAACAGCTCTTTCTCAGG + Intronic
1044175378 8:89114294-89114316 CTGGATATTAGATCTTTTTCAGG - Intergenic
1044184498 8:89235803-89235825 CTGCATGGTAGCTCTTTTCCAGG - Intergenic
1045755646 8:105537993-105538015 GTGTATAATATCTTTTTTACAGG + Intronic
1046651732 8:116843090-116843112 CTATATATTAGCTGTTTTTCAGG - Intronic
1046834721 8:118787718-118787740 ATATATAATAGTTCTGTTGCTGG - Intergenic
1047787632 8:128169123-128169145 CTGTGTTATAGCTATTTTGGTGG - Intergenic
1049633923 8:143675670-143675692 CTGCATAGTAGCTCTTTTCCAGG + Intergenic
1050870302 9:10559659-10559681 CTGGATATTAGCCCTTTTTCAGG - Intronic
1051698285 9:19791753-19791775 CTGTTTAATAACTCATTTGATGG - Intergenic
1052508128 9:29381127-29381149 CTGCATGGTAGCTCTTTTCCAGG + Intergenic
1053705445 9:40748520-40748542 CTGTATGGTAGCTCTTTTCCAGG - Intergenic
1054415520 9:64872127-64872149 CTGTATGGTAGCTCTTTTCCAGG - Intergenic
1054858573 9:69926931-69926953 CTGCATGATAGCTCTCTTCCAGG - Intergenic
1055613921 9:78051897-78051919 CTGTATAATACTTGTTTAGCAGG - Intergenic
1056599946 9:88039030-88039052 CTGTATGGTAGCTCTCTTCCAGG - Intergenic
1058169902 9:101667890-101667912 CGGTAAAATATCTCTTTTGTAGG - Intronic
1058634124 9:107019858-107019880 CAGGGTAATAGATCTTTTGCTGG + Intergenic
1059646831 9:116276291-116276313 CTGTGTAATATATCTTTAGCTGG + Intronic
1060437968 9:123611702-123611724 CTGTATATTAACTCATTTGTTGG - Intronic
1061786758 9:133033654-133033676 CTGTACGGTAGCTCTTTTCCAGG - Intronic
1186136299 X:6525512-6525534 AGGTCTAATAGCTATTTTGCAGG + Intergenic
1188057177 X:25554698-25554720 CTTTATAATAACTCTCTTCCAGG - Intergenic
1189034647 X:37483172-37483194 CTGCATGGTAGCTCTTTTCCAGG + Intronic
1189722191 X:43931626-43931648 CTGTATAATGGATTTTTTGTGGG - Intergenic
1189741716 X:44124356-44124378 TTGTATAAAAGCTGTTTTCCAGG - Intergenic
1189833792 X:45000831-45000853 CTGCATGGTAGCTCTTTTCCAGG - Intronic
1190270307 X:48858031-48858053 CTGCATGGTAGCTCTTTTCCAGG + Intergenic
1191639276 X:63412941-63412963 CTGTATGGCAGCTCTTTTCCAGG + Intergenic
1191889874 X:65928896-65928918 CTGTATGGTAGCTCTTTTCCAGG - Intergenic
1192858778 X:75042990-75043012 CTGGATAATAGACCTTTTTCAGG - Intergenic
1192894931 X:75432640-75432662 CTGTATAGTAGGTCTTTTGAGGG - Intronic
1193635404 X:83944038-83944060 TTGTATCATAGCTCTTGCGCAGG - Intergenic
1193790265 X:85808460-85808482 CTGTATCATAGCTTCTGTGCTGG - Intergenic
1194102379 X:89721915-89721937 CTGAATAATAGTTCATTTTCTGG + Intergenic
1195387930 X:104330626-104330648 CTTGATAATAACTCTTTTCCAGG + Intergenic
1196422959 X:115541433-115541455 CTGCATGGTAGCTCTTTTCCAGG - Intergenic
1196869447 X:120099004-120099026 CTGCATGATAGCTCTTTTTCAGG + Intergenic
1197076960 X:122364282-122364304 CTGGTTAATAGCTCTTGTGGAGG + Intergenic
1198389941 X:136163573-136163595 ATGTATGAAAGCTCTTTTGCAGG + Intronic
1198742522 X:139856193-139856215 CTGCATGGTAGCTCTTTTCCAGG + Intronic
1198759013 X:140011840-140011862 CTGCATCATAGCTCCTGTGCTGG - Intergenic
1199278843 X:145976149-145976171 CTGCATAGTAGCTCTTTTCCAGG + Intergenic
1199638392 X:149835478-149835500 CTGCATGGTAGCTCTTTTCCAGG + Intergenic
1200333842 X:155326622-155326644 CTGTATAAATCCTCTTTTACAGG - Intronic
1200454966 Y:3379193-3379215 CTGAATAATAGTTCATTTTCTGG + Intergenic
1200553982 Y:4612193-4612215 CTGCATTATAGCTCTTTCACTGG - Intergenic
1200752268 Y:6957265-6957287 CTGTATGGTAGTTCTTTTCCAGG + Intronic
1200763183 Y:7058480-7058502 CTGTATAGTAGCTCTTTTCCAGG - Intronic
1200769332 Y:7108950-7108972 CTGTATGGTAGCTCTTTTCCTGG + Intergenic
1200938833 Y:8761737-8761759 CTCTTTAATAGGTCTGTTGCTGG - Intergenic
1201260040 Y:12149956-12149978 CTGCATTGTAGCTCTTTTCCAGG - Intergenic
1201296806 Y:12470685-12470707 CTGTATGGTAGTTCTTTTCCAGG - Intergenic
1202593680 Y:26513783-26513805 ATGTGTAACAGCTCTTTTGAGGG - Intergenic