ID: 1087544284

View in Genome Browser
Species Human (GRCh38)
Location 11:99564376-99564398
Sequence ACAGAATTGTTGGCCAGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2318
Summary {0: 1, 1: 5, 2: 32, 3: 295, 4: 1985}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087544284 Original CRISPR ACAGAATTGTTGGCCAGGTG TGG (reversed) Intronic
Too many off-targets to display for this crispr