ID: 1087544285

View in Genome Browser
Species Human (GRCh38)
Location 11:99564381-99564403
Sequence TATAAACAGAATTGTTGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 926
Summary {0: 1, 1: 0, 2: 8, 3: 86, 4: 831}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087544285 Original CRISPR TATAAACAGAATTGTTGGCC AGG (reversed) Intronic
900259960 1:1721853-1721875 AATATAAAGAATTTTTGGCCAGG + Intronic
900295089 1:1944899-1944921 AATAAAAAGAATATTTGGCCGGG - Intronic
900317247 1:2063606-2063628 TTTAAACAGAATTATCGGCCAGG - Intronic
900434514 1:2622587-2622609 TAGAAACCAAATTCTTGGCCGGG + Intronic
901036852 1:6341427-6341449 TTTAAAAAGAATAGTTGGGCCGG - Intronic
901271533 1:7955601-7955623 TGAAAACAGAGTTTTTGGCCAGG + Intronic
901832306 1:11899821-11899843 TATAAAAATTACTGTTGGCCAGG + Intergenic
902040995 1:13492403-13492425 TAAAAAAAGGATTTTTGGCCGGG + Intronic
902054493 1:13588958-13588980 TATTCAATGAATTGTTGGCCGGG - Intronic
902407617 1:16194053-16194075 TAAAAATAAAATAGTTGGCCAGG + Intergenic
902419173 1:16264104-16264126 TATAAAAATTATTGTTGGCCTGG - Intronic
902438430 1:16413075-16413097 TAAAAAAAAAATCGTTGGCCGGG - Intronic
902496618 1:16876555-16876577 TAAAAAAAAACTTGTTGGCCGGG + Intronic
903123278 1:21230679-21230701 TATAGAAAGAATTCTTGGCCAGG - Intronic
903123410 1:21231635-21231657 CATAAATAGAGTTCTTGGCCAGG - Intronic
903398571 1:23021364-23021386 TAAAAACAGATTTATTGGCTGGG + Intronic
903454186 1:23475672-23475694 TACAGATAGAATTCTTGGCCAGG + Intronic
903595581 1:24491456-24491478 AATATAAAGAATTGTTGGCCAGG - Intergenic
903686968 1:25139019-25139041 TTGAAACAGAAATGTTGTCCAGG + Intergenic
903711215 1:25326064-25326086 TATAAACTGAAGTTTTGGCCGGG - Intronic
903715733 1:25365365-25365387 TATAAACTGAAGTTTTGGCCGGG + Intronic
903725231 1:25437629-25437651 TGTAATAAGAATTTTTGGCCGGG + Intronic
903958670 1:27042423-27042445 TAAAAACACAAATATTGGCCCGG + Intergenic
904297489 1:29530549-29530571 TAAAAACACATTTGTAGGCCAGG + Intergenic
905102522 1:35537465-35537487 ATTAAACAGAATTGTAGGCTTGG + Intronic
905602026 1:39260547-39260569 TAGAGACAGGGTTGTTGGCCAGG + Intronic
905680584 1:39868345-39868367 TATATAAAGAACTCTTGGCCAGG + Intronic
905687284 1:39917662-39917684 GAAAATAAGAATTGTTGGCCGGG - Intergenic
905802272 1:40852246-40852268 CATAAAGAGAATTGTTGCCTGGG - Intergenic
906008483 1:42500885-42500907 TATATAAAGAACTCTTGGCCAGG - Intronic
906343332 1:45000123-45000145 TATAAAAATAATGGTCGGCCAGG + Intergenic
906398568 1:45488213-45488235 AACAAAAAAAATTGTTGGCCAGG - Intronic
906633887 1:47395300-47395322 ATTTAATAGAATTGTTGGCCGGG - Intergenic
909002567 1:70236623-70236645 TAAAAAAAAAATTGTAGGCCGGG - Intronic
909783337 1:79577318-79577340 TATAAAAAGATTTCTCGGCCGGG - Intergenic
910108588 1:83657823-83657845 TACAGACAGAATTGAGGGCCAGG + Intergenic
910179176 1:84462721-84462743 TTTAAAAAGAAATGTGGGCCAGG - Intergenic
910255444 1:85242701-85242723 AAAAAAAAGAATTCTTGGCCGGG - Intergenic
910403148 1:86856935-86856957 TAAAAAGAAAATTGTAGGCCGGG + Intergenic
910499225 1:87870585-87870607 GATAAAAATAATTGTCGGCCGGG + Intergenic
910670818 1:89770983-89771005 AATAAAATGAATTTTTGGCCAGG + Intronic
910671514 1:89777931-89777953 TAGAGACACGATTGTTGGCCAGG + Intronic
910940269 1:92525562-92525584 TCAAAATAGCATTGTTGGCCGGG - Intronic
910961208 1:92765612-92765634 TATAAAAAGAATTGATGCCTGGG - Intronic
910966820 1:92816188-92816210 TATAATAAGAATTGGTAGCCAGG - Intergenic
911000278 1:93157827-93157849 AAAAAACAGATTTGTAGGCCGGG + Intronic
911280493 1:95921235-95921257 TATAAAAAGAAAGGTGGGCCAGG - Intergenic
911528317 1:99012798-99012820 TAAAAATATAATTATTGGCCGGG - Intergenic
911562140 1:99418644-99418666 TATTACCAGAATTGTTTTCCTGG - Intergenic
911936183 1:103976958-103976980 TATAAAGAGCACTGGTGGCCAGG + Intergenic
912335749 1:108861106-108861128 TTTAAACATATTTGTAGGCCGGG + Intronic
912343991 1:108946866-108946888 TAAAAATAGAAATTTTGGCCAGG + Intronic
912364950 1:109125677-109125699 TAAAAACAGACTGCTTGGCCGGG - Intronic
912462005 1:109841014-109841036 TAAAAACAGAGTATTTGGCCAGG + Intergenic
912734280 1:112136165-112136187 TATCGACAGATATGTTGGCCAGG - Intergenic
914922190 1:151854685-151854707 TATAAGAAGAGGTGTTGGCCGGG - Intergenic
915504117 1:156341766-156341788 TATAAAATGCATTCTTGGCCGGG + Intronic
915762229 1:158326265-158326287 TATAAATAGATTTGTGGGCCGGG - Intergenic
915887376 1:159737210-159737232 TATAAACAAAATAGTTGCCCAGG + Intergenic
916216874 1:162403193-162403215 TAAAAATAGAATTACTGGCCGGG + Intronic
917467686 1:175296770-175296792 TAAAAACATTATTTTTGGCCTGG - Intergenic
917506672 1:175633682-175633704 TATAAATAGAACTTTCGGCCAGG + Intronic
917857962 1:179117128-179117150 CATAAACAGAAGTATAGGCCTGG - Intronic
918287391 1:183070798-183070820 TATGGAAAGAATTGTTGGACAGG + Intronic
918361878 1:183767655-183767677 TTAAAAAAGAATTGCTGGCCGGG + Intronic
918363171 1:183779543-183779565 AATAAAAAGAAATTTTGGCCAGG - Intronic
918605757 1:186423748-186423770 GATAAATAGAAGTGGTGGCCGGG - Intergenic
919089844 1:192964947-192964969 TAAAAAAAGAATTTTAGGCCTGG + Intergenic
919103904 1:193125555-193125577 TTTAAAATGAATTATTGGCCAGG - Intronic
919186185 1:194153957-194153979 TATAAAAATGATTTTTGGCCAGG + Intergenic
919616729 1:199817113-199817135 TATAAAAAGAATTTTGGGGCCGG - Intergenic
920082429 1:203385029-203385051 TATAAAAACCATTCTTGGCCAGG + Intergenic
920319598 1:205108882-205108904 TACATACAGAATTCTTGGCTTGG + Intronic
920384710 1:205562754-205562776 TAAAAACAGAAAAGTTAGCCAGG + Intergenic
920402079 1:205682134-205682156 TATAATAATAATAGTTGGCCAGG + Intergenic
922283436 1:224146999-224147021 TATAAAAAATATTTTTGGCCAGG - Intronic
922511494 1:226171836-226171858 TAAAAACACATTTATTGGCCAGG - Intronic
923177678 1:231483187-231483209 TATAATAAAATTTGTTGGCCAGG - Intergenic
923734201 1:236586693-236586715 GATTAAAAGTATTGTTGGCCAGG - Intronic
923780177 1:237015474-237015496 TGTAAAAAAAGTTGTTGGCCGGG + Intergenic
924119638 1:240783323-240783345 TAAAAACATCATTCTTGGCCTGG + Intronic
924256854 1:242191423-242191445 TATAAACACAAAAGTTAGCCAGG + Intronic
924263825 1:242260051-242260073 ACTTAAGAGAATTGTTGGCCAGG + Intronic
924847485 1:247787821-247787843 TATAAGCAGAAATCTTGGCTGGG - Intergenic
1062776641 10:155351-155373 TATATAAAGAATTTTTGGCTGGG + Intronic
1062881187 10:979659-979681 TATTAACAGAAGTGTTAGCTGGG - Intergenic
1063133288 10:3196517-3196539 TAGAAAGTGAAATGTTGGCCGGG - Intergenic
1063468180 10:6262157-6262179 TAAAAACAAAGCTGTTGGCCGGG + Intergenic
1063550028 10:7023132-7023154 TAGAAACACAATTGATGGTCAGG - Intergenic
1064213533 10:13380948-13380970 AAAGAACAGAATTTTTGGCCAGG + Intergenic
1064269337 10:13850917-13850939 TCTATAAAGAATTGTAGGCCAGG + Intronic
1064472229 10:15647755-15647777 TAAAAACTGAATAATTGGCCGGG - Intronic
1065551792 10:26875157-26875179 TAGAGACAGGGTTGTTGGCCAGG + Intergenic
1065847920 10:29761455-29761477 TATAAATACTATTATTGGCCAGG + Intergenic
1066084786 10:31965584-31965606 TTTAAAAAGAATTCTTGTCCAGG + Intergenic
1066720973 10:38338421-38338443 ACTTAAGAGAATTGTTGGCCAGG - Intergenic
1067074337 10:43165633-43165655 TAAAAATAAAATTTTTGGCCAGG + Intronic
1068527638 10:58148379-58148401 TAAAAACTCAATTCTTGGCCGGG - Intergenic
1069018091 10:63454016-63454038 TACAAACAGAATTGGAGGCCGGG - Intronic
1069672508 10:70220223-70220245 TATAAGCATAATTGCAGGCCAGG - Intronic
1069922947 10:71828358-71828380 TATAAATAAAAAGGTTGGCCAGG + Intronic
1070009996 10:72463998-72464020 TTTGTAAAGAATTGTTGGCCAGG + Intronic
1070080277 10:73179256-73179278 TAGAAATAAAAATGTTGGCCGGG - Intronic
1070181117 10:74015255-74015277 TATTAAAACAATTTTTGGCCAGG + Intronic
1070193367 10:74132955-74132977 AATAAACAGATTTATGGGCCAGG + Intronic
1070212977 10:74346185-74346207 AAAAAACAGAAATTTTGGCCAGG - Intronic
1070516952 10:77217001-77217023 CAAAAACTGAATTTTTGGCCAGG + Intronic
1072066484 10:91876518-91876540 AAAAAAAAAAATTGTTGGCCAGG + Intergenic
1072066685 10:91878276-91878298 TATAAAAAGAAATATAGGCCAGG + Intergenic
1072087996 10:92099556-92099578 TATAAAATGCATTTTTGGCCAGG + Intronic
1072128895 10:92473223-92473245 AATAAAAAGAATTTTGGGCCGGG - Intronic
1072251829 10:93587788-93587810 TATAAAAGGATTTGTTGGCCAGG + Exonic
1072337005 10:94406103-94406125 TATAAATAACATTGTTGGCTGGG - Intronic
1072414336 10:95234277-95234299 TATAAAATGTATTATTGGCCGGG + Intergenic
1073050851 10:100666337-100666359 TAAAAACATACTTATTGGCCAGG + Intergenic
1073092102 10:100950943-100950965 ATTGAAAAGAATTGTTGGCCAGG + Intronic
1073172275 10:101520660-101520682 TAAAAACCAAGTTGTTGGCCGGG + Intronic
1073218545 10:101850771-101850793 AGTAAACAGACTTGGTGGCCAGG - Intronic
1073274386 10:102296747-102296769 AAAAAAAAGAATTGTAGGCCAGG + Intronic
1073764495 10:106666864-106666886 TAGAAAGAGATTTATTGGCCAGG - Intronic
1073963441 10:108960677-108960699 AAAAATCAGAATTTTTGGCCAGG + Intergenic
1074512594 10:114129823-114129845 AATAAATAGCATTTTTGGCCAGG - Intronic
1074792504 10:116904904-116904926 TAAAAATAGCAGTGTTGGCCGGG + Intronic
1075233510 10:120705225-120705247 TATTAACAGTATTGTAGTCCTGG + Intergenic
1075278887 10:121121733-121121755 TACAAACAAAATTGTTGGCACGG - Intergenic
1075711486 10:124533197-124533219 TCTATCCAGAAGTGTTGGCCTGG - Intronic
1076004840 10:126940312-126940334 AATAAACAGAATGGTTTGCATGG - Intronic
1078140096 11:8685999-8686021 TATAAACAGAAATGTTTAACTGG - Exonic
1078278693 11:9877032-9877054 TATAAACAAAGTTCTAGGCCAGG - Intronic
1078721911 11:13892789-13892811 TAAAAATAGAATTGTAGGCTGGG + Intergenic
1079065020 11:17282554-17282576 AATAAACAAAGATGTTGGCCGGG - Intronic
1079190782 11:18275157-18275179 TAAAAATACAATTGCTGGCCAGG - Intergenic
1079218309 11:18535839-18535861 CATTAAGAAAATTGTTGGCCTGG + Intronic
1080010531 11:27454462-27454484 AATAAATAAAATTATTGGCCGGG + Intronic
1080407493 11:31992595-31992617 TTTAAAAAAAATTTTTGGCCAGG - Intronic
1080612770 11:33918952-33918974 TAAAAAAAGAGTTCTTGGCCGGG - Intergenic
1080812697 11:35721197-35721219 TATAAAAAGAATTATAGGCCAGG - Intronic
1081588092 11:44401335-44401357 GATAAACGGATTTCTTGGCCGGG - Intergenic
1081974688 11:47225295-47225317 TTTAAAAAAAATTGTGGGCCAGG + Intronic
1082053772 11:47795854-47795876 TATAAAAAACATTATTGGCCAGG + Intronic
1082871566 11:57947436-57947458 TTAAAAAAAAATTGTTGGCCAGG - Intergenic
1083067973 11:59945444-59945466 TATAAAGAGAAATGCTGGCTGGG + Intergenic
1083223095 11:61266242-61266264 TAAAAACAAAATTTTTGGCTGGG + Intronic
1083485969 11:62983337-62983359 TAAAAACAGGATTGCGGGCCAGG - Intronic
1084293723 11:68195859-68195881 AATAAAATGAATTTTTGGCCAGG + Intronic
1084523506 11:69681300-69681322 TTAAAATAGAAATGTTGGCCGGG + Intergenic
1084637695 11:70403480-70403502 TATATAAAGAACTCTTGGCCAGG - Intronic
1085485024 11:76855821-76855843 TTTAAACAAAAGTTTTGGCCGGG + Intergenic
1086048638 11:82563061-82563083 TATGCACAGAGTTGTTGCCCTGG + Intergenic
1086102174 11:83112487-83112509 TATAAACAGCATTGGTGGCCAGG + Intergenic
1086726584 11:90193013-90193035 GTTAAACTGTATTGTTGGCCTGG - Intergenic
1086917902 11:92552787-92552809 AAAAAAAAGAATTGTTAGCCAGG + Intronic
1087167094 11:95015592-95015614 TCTAAAAAGAATGTTTGGCCAGG - Intergenic
1087544285 11:99564381-99564403 TATAAACAGAATTGTTGGCCAGG - Intronic
1088872954 11:113908271-113908293 TATAAACAGGATTGTCGCACAGG + Intronic
1088874355 11:113921460-113921482 GATAAAGAAAATTGCTGGCCGGG + Intronic
1089288687 11:117424381-117424403 TAAAAATAGAAATGTTGGTCAGG + Intergenic
1089543062 11:119202415-119202437 TAAAAACACACTTGTTGGCCAGG - Intergenic
1089786568 11:120911530-120911552 TTTAAAGAGAATTTTGGGCCGGG - Intronic
1089851654 11:121502429-121502451 TAAACATAGAATTGTCGGCCGGG - Intronic
1089956358 11:122574864-122574886 TATAAACAGGGTTTTAGGCCCGG + Intergenic
1091241809 11:134057967-134057989 TAGAAAAAAAAATGTTGGCCAGG - Intergenic
1092087860 12:5779029-5779051 AATAATCAGAAATGTTGGCTGGG - Intronic
1092110794 12:5962842-5962864 TAAAAAATGAATTGCTGGCCGGG - Intronic
1092149959 12:6241089-6241111 TATAAAATGAATGGTTGGCCAGG - Intergenic
1092348311 12:7734841-7734863 TATAAAAATAATTGGAGGCCAGG - Intronic
1092396162 12:8128690-8128712 TAGAAACTGAACTTTTGGCCGGG - Intronic
1092440831 12:8500784-8500806 CATAAACAGAATTATTGATCTGG - Intergenic
1092916906 12:13197478-13197500 TTTAAAGAAAACTGTTGGCCGGG + Intronic
1092964866 12:13631772-13631794 CAAGAACAGAATTATTGGCCAGG + Intronic
1093058450 12:14578489-14578511 TAGAGACAGAGTTGTTGGCCAGG - Intergenic
1093362091 12:18241386-18241408 TATAAAAAGTATTTTTGGCCGGG - Intronic
1093760228 12:22901712-22901734 TATATAAAGAATTATTGGCTAGG + Intergenic
1094030134 12:26002478-26002500 TATATAAAAAATTATTGGCCAGG + Intronic
1094224591 12:28030843-28030865 AAAAAAGAGAAGTGTTGGCCAGG + Intergenic
1096304782 12:50464686-50464708 CAAAAAAAGAATTGTTGGTCAGG - Intronic
1096319221 12:50596568-50596590 AATAGACAGAATTCATGGCCAGG + Intronic
1096349392 12:50883031-50883053 TATAGATAGAATTGATGGTCAGG + Intronic
1097537270 12:60888607-60888629 TATTAACAGAATTGTTTTTCTGG + Intergenic
1097854019 12:64442773-64442795 TATAAATAGAATTGTAGGAAGGG + Intronic
1097989502 12:65820234-65820256 TTTAATCATAATTGTGGGCCGGG - Intergenic
1098294199 12:68987388-68987410 TGTAAAAAAAATTATTGGCCGGG + Intergenic
1098444360 12:70551054-70551076 TAAAAACACAAAAGTTGGCCAGG - Intronic
1098791172 12:74825114-74825136 TATGAACAGAGTGGCTGGCCTGG + Intergenic
1098875419 12:75861510-75861532 TTTAAAAAGACTTCTTGGCCGGG - Intergenic
1098940391 12:76528025-76528047 TATAAGCATTATTGTTGGCCAGG + Intronic
1099403422 12:82228604-82228626 AGGAAAAAGAATTGTTGGCCGGG + Intronic
1100622931 12:96297912-96297934 TTTAAATAGCATTGTTGCCCAGG - Intronic
1100712822 12:97275945-97275967 TAAAAACACAATTCTTGTCCTGG + Intergenic
1100734233 12:97509384-97509406 TATATACTGAATTGCAGGCCAGG + Intergenic
1100813952 12:98367445-98367467 TTTAAAAAAAAATGTTGGCCAGG - Intergenic
1101357336 12:103992785-103992807 TATAAAGAGAACTTTCGGCCGGG - Intronic
1102118749 12:110424200-110424222 TAAAAACAGGCTTGTTGGCCGGG - Intergenic
1102321822 12:111942565-111942587 TGTAAAATGAAGTGTTGGCCGGG - Intronic
1102367999 12:112355989-112356011 TATAAACAGAATTTCTAGCGGGG + Intronic
1102959490 12:117083372-117083394 TATAAATGGAATTGTTGGCTGGG - Intronic
1103124468 12:118409438-118409460 AAGAAACAGAATTTTAGGCCGGG - Intronic
1103417674 12:120754520-120754542 TATATAAAGAATTCTTGGGCCGG - Intergenic
1103616974 12:122160307-122160329 TATAAAGAAAATTCTTGGCCAGG + Intergenic
1103671473 12:122619705-122619727 TATAAAAACAAGTGTTGGCCGGG - Intronic
1104007951 12:124908062-124908084 TATAAAAATAAGTGCTGGCCGGG + Intergenic
1104299868 12:127554856-127554878 TATAAAGAAAACTGGTGGCCAGG - Intergenic
1104314738 12:127687006-127687028 TATATACAGAAATATTGGCAAGG - Intergenic
1104703635 12:130926188-130926210 ATAAAACAGAATTTTTGGCCGGG + Intergenic
1104892369 12:132146607-132146629 TATAGACAGACGTGTTGGCGAGG - Intronic
1105062482 12:133165835-133165857 TATAAACAGAAGTGATGTCTTGG + Intronic
1105350583 13:19611535-19611557 TAAAAATAAAATTCTTGGCCAGG - Intergenic
1105476600 13:20733387-20733409 TATAAAAATAATTAGTGGCCAGG - Intronic
1105721759 13:23123661-23123683 TAGAAACAGAAGTGTAGGCCAGG - Intergenic
1105783857 13:23728377-23728399 TAAAAAAATAATTTTTGGCCAGG + Intergenic
1106189281 13:27437044-27437066 TAAAAATACAATTGTAGGCCAGG - Intronic
1107036460 13:35907456-35907478 TATAAAGAGAAATGTGGGCCAGG - Intronic
1107089261 13:36459079-36459101 TAAAAATAAAATTGTAGGCCAGG - Intergenic
1107112348 13:36711666-36711688 TAAAAGAAGAATTGTAGGCCAGG - Intergenic
1107477615 13:40754731-40754753 TATAAACTGGATGGCTGGCCAGG + Intronic
1107574302 13:41700837-41700859 TAAAAACAGAAGTGGTGGCTGGG - Intronic
1107637428 13:42406803-42406825 TAAAAATTGAATTGCTGGCCAGG + Intergenic
1107846080 13:44514562-44514584 TATAAAAAGAAGTTTAGGCCAGG + Intronic
1108807764 13:54180885-54180907 TATAAACAGATTGCTGGGCCCGG - Intergenic
1108966353 13:56307773-56307795 TATAAATAGATTTATAGGCCAGG - Intergenic
1109068870 13:57737380-57737402 TATAAAAAGCATTGCTGGCCGGG + Intergenic
1109386971 13:61643251-61643273 TTTAAAAAAAATTCTTGGCCAGG + Intergenic
1109894550 13:68667524-68667546 TAGAGACAGAGTTGTTGGACAGG + Intergenic
1109966051 13:69698059-69698081 TAAAAACTGATTTTTTGGCCGGG + Intergenic
1110104755 13:71658252-71658274 TATACTCAAAATTGATGGCCAGG + Intronic
1111008747 13:82284216-82284238 TATAAACAGAAATGTCGGCTGGG - Intergenic
1111059197 13:82990367-82990389 TTTAAACAAAATTACTGGCCGGG + Intergenic
1111221639 13:85212231-85212253 TCTAAACAAAATTTTTGGCTAGG + Intergenic
1111298058 13:86309085-86309107 TATAAATATAAATGTAGGCCGGG + Intergenic
1111437027 13:88224487-88224509 AAAAAACAGAACTGTGGGCCTGG - Intergenic
1113494702 13:110717529-110717551 TACAAGTAGTATTGTTGGCCAGG + Intronic
1113669705 13:112167452-112167474 TATAAATAGAATGCTTGGGCTGG - Intergenic
1113984562 13:114303488-114303510 AAGAAGCAGAATTGTCGGCCCGG + Intronic
1114228133 14:20757214-20757236 TCTAAACAGTATTGTAGGCCTGG - Intergenic
1114419922 14:22573305-22573327 TATAAACAATATTGTTGGCTGGG - Intronic
1115014112 14:28588896-28588918 TTTAAAAAGTTTTGTTGGCCAGG - Intergenic
1115556682 14:34549805-34549827 TATAAACGGAACTGTCGGCCGGG + Intergenic
1115561270 14:34585221-34585243 TATTAGAAGTATTGTTGGCCGGG + Intronic
1115566109 14:34627149-34627171 TTAAAAAAAAATTGTTGGCCAGG + Intronic
1115579494 14:34743960-34743982 CAAAAACAAAACTGTTGGCCGGG - Intergenic
1115607880 14:35023486-35023508 TCAAAACATAATTCTTGGCCAGG + Intronic
1115677688 14:35697640-35697662 AAAAAACAAAACTGTTGGCCAGG - Intronic
1115679471 14:35720045-35720067 TGTATTAAGAATTGTTGGCCGGG - Intronic
1115999261 14:39225752-39225774 TAAAAATATAATTATTGGCCTGG + Intergenic
1116935237 14:50732886-50732908 TAAAAACAGTGTTATTGGCCGGG - Intronic
1117180921 14:53190743-53190765 TATAAAGAAAATTTTAGGCCAGG - Intergenic
1117447346 14:55817057-55817079 TATAAAAAGAAAAGTGGGCCAGG + Intergenic
1118155726 14:63239405-63239427 TTTAAAATGAGTTGTTGGCCGGG - Intronic
1118194884 14:63615945-63615967 TACAAAAACAATTCTTGGCCAGG + Intronic
1118313797 14:64711705-64711727 TATATAAAGAACTCTTGGCCGGG - Intronic
1118391580 14:65300185-65300207 TAAAAATACAATTGGTGGCCAGG + Intergenic
1118514875 14:66516311-66516333 TAGAAATATAATTGCTGGCCAGG - Intronic
1118585282 14:67346608-67346630 TAGAAACAATATTCTTGGCCAGG - Intronic
1119314360 14:73679287-73679309 TAAAAACAAAAGTCTTGGCCGGG - Intronic
1119360489 14:74045027-74045049 CAGAAACAGAAAGGTTGGCCGGG - Intronic
1119385469 14:74255573-74255595 TATAAACAGAACTATTTTCCTGG - Intronic
1119620528 14:76128487-76128509 TAAAAACAGAAAAGTTGGCCGGG + Intergenic
1119876113 14:78060799-78060821 TATAACCAGAGTTGCTGGCCAGG + Intergenic
1120450824 14:84665322-84665344 TATTACCAGAATTGTTTTCCTGG + Intergenic
1120961648 14:90130515-90130537 AATAAATAGGAGTGTTGGCCGGG + Intronic
1121134237 14:91480587-91480609 TCTAATGAGAATTGTGGGCCAGG - Intronic
1121349508 14:93162157-93162179 TAGAAAAAGATATGTTGGCCGGG + Intergenic
1121567106 14:94918241-94918263 AATACACAGCATTGTTGGCTGGG - Intergenic
1121568479 14:94928832-94928854 TAAAAACATAACTGATGGCCAGG + Intergenic
1121628288 14:95403575-95403597 AATAAATAAAATTTTTGGCCAGG + Intergenic
1122108051 14:99474567-99474589 TAAAAATACAGTTGTTGGCCAGG + Intronic
1122669550 14:103359762-103359784 TATAAAGAAAAGTGTTGGCCGGG - Intergenic
1122700476 14:103585181-103585203 GATAAAAAGAGTTCTTGGCCAGG + Intronic
1122710754 14:103655792-103655814 TAGAAACTAAAATGTTGGCCAGG + Intronic
1123900712 15:24873740-24873762 CATAAAAAGAAGAGTTGGCCAGG - Intronic
1124003948 15:25781359-25781381 TTTAAAAAGAATATTTGGCCGGG + Intronic
1124268984 15:28263733-28263755 AAAAAACAGAATTGTTAGGCTGG + Intronic
1125019747 15:34972745-34972767 TAGAGACAGGATTGTTAGCCAGG - Intergenic
1125280506 15:38037717-38037739 AATAAAAGTAATTGTTGGCCAGG + Intergenic
1125493994 15:40172876-40172898 GCTAAACAGATTTGTTAGCCTGG + Intronic
1125773893 15:42193073-42193095 TGTAAAGAGAATTATAGGCCGGG - Intronic
1125911080 15:43439865-43439887 CTTTAACAGAATTTTTGGCCAGG - Intronic
1126601124 15:50428410-50428432 TAAAAACTAAATTGTAGGCCCGG - Intronic
1127780053 15:62304852-62304874 TTTACAAAGAACTGTTGGCCAGG + Intergenic
1128098530 15:64978124-64978146 TAAAAAAGGAATTCTTGGCCAGG - Intronic
1128184732 15:65635187-65635209 TCTAAAGAGAACTCTTGGCCAGG + Intronic
1128195329 15:65748692-65748714 TAAAAACCCAATTGTTGGCCAGG + Intronic
1129128390 15:73466144-73466166 TATAAAAACAATTGGTGGCCGGG - Intronic
1129315640 15:74741959-74741981 TATATACAGAGTTGTTGGCCGGG + Intergenic
1130320919 15:82840411-82840433 TATTTTCAGATTTGTTGGCCTGG - Intronic
1130930277 15:88421498-88421520 TCTAAAGAGAACTGTTGGCCGGG - Intergenic
1131185134 15:90267396-90267418 TAAAAAAAGAATTGAGGGCCAGG - Intronic
1131523615 15:93135482-93135504 TAGAAACTGAGTTATTGGCCAGG - Intergenic
1132361913 15:101223284-101223306 TTTAAACAAAGTAGTTGGCCGGG - Intronic
1132952737 16:2573524-2573546 TCTAAATAGAGTTATTGGCCGGG + Intronic
1132961614 16:2626646-2626668 TCTAAATAGAGTTATTGGCCGGG - Intergenic
1133039207 16:3051084-3051106 TTTAAACCTAATTATTGGCCAGG - Intronic
1133136453 16:3715650-3715672 AATTAACAGAACAGTTGGCCAGG + Intronic
1133244741 16:4440673-4440695 TATTAACAGTTTTGTGGGCCAGG + Intronic
1133252943 16:4496282-4496304 TAAAAATAGAATTATTAGCCAGG - Intronic
1133470711 16:6072603-6072625 AAAAAAAACAATTGTTGGCCTGG - Intronic
1133505987 16:6413022-6413044 TTTAAAAAAAATTTTTGGCCAGG + Intronic
1133544529 16:6792733-6792755 TATAAATAGAAGTGATGGGCCGG + Intronic
1133664225 16:7950074-7950096 TAGGAATAGAATTGTTGGCCGGG + Intergenic
1133793182 16:9025333-9025355 CAAAAAAAGAATTATTGGCCGGG - Intergenic
1134003429 16:10800678-10800700 TTTAAAAAGCATTTTTGGCCAGG + Intronic
1134177129 16:12016162-12016184 TTTAAAAAGAATTATTAGCCGGG - Intronic
1134217219 16:12325729-12325751 TTTAAATATAATTTTTGGCCAGG + Intronic
1134260668 16:12648469-12648491 TTTAAAGAGTACTGTTGGCCAGG - Intergenic
1134280955 16:12816657-12816679 TCTAAAAAAAATTTTTGGCCAGG + Intergenic
1134685619 16:16156209-16156231 AATAAACAGCATTGTTGGCTGGG - Intronic
1135095920 16:19564692-19564714 TAAAAACAAACTTTTTGGCCAGG - Intronic
1135493833 16:22934099-22934121 TAAAAATAAAATTGCTGGCCAGG + Intergenic
1135542479 16:23342540-23342562 TAGAAACAGAATTGCAGGCTGGG - Intronic
1135586420 16:23675203-23675225 TAAAAAAAAAAATGTTGGCCAGG + Exonic
1135827945 16:25746844-25746866 TATAAAAACAATTGTGGGCTGGG - Intronic
1136649017 16:31649670-31649692 TATAAATACAAAGGTTGGCCAGG + Intergenic
1137438757 16:48480915-48480937 TAAAAAGATAAATGTTGGCCGGG - Intergenic
1138020414 16:53474609-53474631 TATAAAAAGAATTATAGGCTGGG - Intronic
1138311940 16:56032792-56032814 TATATAAAGAACTCTTGGCCGGG - Intergenic
1138362576 16:56443995-56444017 TATAAATCTAATTGTTGGCTGGG + Intronic
1138500915 16:57443640-57443662 TAGCAACAGAGTTGTTGGCCAGG + Intronic
1138677309 16:58660946-58660968 TAAAAACAAAATTGGGGGCCGGG - Intergenic
1139306523 16:65991025-65991047 AATAAACAGACTTTTTGTCCAGG - Intergenic
1139454153 16:67058434-67058456 TAAAAAAAGAACTGTTGGTCGGG - Intronic
1139770533 16:69272243-69272265 AATATAAAGAATTCTTGGCCAGG + Intronic
1140171229 16:72607231-72607253 CAAAAACTGAATTTTTGGCCAGG + Intergenic
1140382492 16:74502863-74502885 TATAAAAAAAATTACTGGCCGGG - Intronic
1141085791 16:81094799-81094821 CGTAAAGAAAATTGTTGGCCTGG + Intronic
1141504989 16:84471022-84471044 CATAAAAAGCACTGTTGGCCGGG + Intergenic
1141736611 16:85858273-85858295 TATAAAGACACCTGTTGGCCAGG - Intergenic
1143323247 17:6081358-6081380 AAAAAAAAAAATTGTTGGCCAGG - Intronic
1143359260 17:6354602-6354624 TATAAAAACCATTCTTGGCCGGG - Intergenic
1143379224 17:6485451-6485473 TAAAAAGAGACTTATTGGCCAGG - Intronic
1143577213 17:7801166-7801188 TAAAAACAAAATGGTAGGCCGGG - Intronic
1143612915 17:8030192-8030214 TATAAAAAGAAATTGTGGCCAGG - Intergenic
1143672960 17:8409313-8409335 TATTATAAAAATTGTTGGCCGGG + Intergenic
1144176052 17:12708684-12708706 TAAAAATAGTATTGCTGGCCAGG - Intronic
1144211098 17:13016487-13016509 TATAAAAAGAATTCCAGGCCAGG + Intronic
1144445231 17:15321302-15321324 TATAAAAATTATTGTTGGCCGGG - Intronic
1144610627 17:16710429-16710451 AATAAACAGATTCATTGGCCAGG - Intronic
1144856222 17:18269610-18269632 TAAAAACGCAAATGTTGGCCGGG - Intergenic
1144902117 17:18604965-18604987 AATAAACAGATTCATTGGCCAGG + Intergenic
1144928947 17:18840987-18841009 AATAAACAGATTCATTGGCCAGG - Intronic
1145098909 17:20057144-20057166 AAAAAACAGAAAGGTTGGCCGGG + Intronic
1145130382 17:20341108-20341130 AATAAACAGATTCATTGGCCAGG - Intergenic
1145292233 17:21557221-21557243 AAAAAAAAGAATTGTAGGCCAGG + Intronic
1145891272 17:28417756-28417778 TATAAATAAACCTGTTGGCCAGG + Intergenic
1146390886 17:32421989-32422011 TAAAAAGAGAATTCATGGCCAGG + Intergenic
1147111134 17:38262531-38262553 TTTAAACACAATTATAGGCCGGG - Intergenic
1147602075 17:41752967-41752989 TATAAAGGGCATTGTTGGCTGGG + Intergenic
1148145119 17:45359849-45359871 TAAAAACATTATTTTTGGCCGGG + Intergenic
1148418378 17:47525913-47525935 TTTAAACACAATTATAGGCCAGG + Intronic
1148487281 17:47998667-47998689 TTTAAAAAGAAGTGTGGGCCAGG - Intergenic
1148942394 17:51226214-51226236 TATAAAAATAATTGTGGGCCAGG + Intronic
1149600009 17:57887114-57887136 TAAGAACAGAATTTATGGCCGGG - Intronic
1149742392 17:59059074-59059096 TATATAAAGAATTCTTGACCGGG + Intronic
1149888272 17:60362993-60363015 TTTAAAAAGAATTTTTGGCCAGG + Intronic
1150039139 17:61840061-61840083 TATCAAAAGAATTTTTGGCCAGG + Intronic
1150412015 17:64953201-64953223 TCAAAACAAAATTTTTGGCCAGG + Intergenic
1151082731 17:71346938-71346960 TAAAAATAGAAATGTCGGCCAGG + Intergenic
1151232990 17:72698001-72698023 TATAAACTGAACTGGTGGCTAGG + Intronic
1151920750 17:77153360-77153382 TTTAAACAGAACTGCTAGCCAGG - Intronic
1152071581 17:78136764-78136786 TAAAAACAGAACCCTTGGCCAGG + Intronic
1152083306 17:78202229-78202251 TAGAGACAGGGTTGTTGGCCAGG - Intronic
1152511069 17:80789126-80789148 TATAAAAATAATTATTGGCTGGG - Intronic
1152554877 17:81048087-81048109 GATAAACAGAATTCCTGGCCGGG + Intronic
1153023243 18:651113-651135 TATAAAAAGAAATGTAGGCCAGG + Intronic
1153071817 18:1115281-1115303 TATTAACAGAATTGTTTTTCTGG + Intergenic
1153128652 18:1828540-1828562 TAAAAACAAAATTTTTAGCCTGG + Intergenic
1154036911 18:10812126-10812148 TAAAAACACTAGTGTTGGCCGGG - Intronic
1155070313 18:22309314-22309336 TAGAAACAGATTTGTAGGCAGGG + Intergenic
1155125982 18:22876122-22876144 TAGAAACTTAATTCTTGGCCAGG + Intronic
1156245569 18:35294559-35294581 TATCACCATAATTGTTGGCATGG - Intergenic
1156379057 18:36540952-36540974 TATTAAAAGAAATGTTGGGCTGG + Intronic
1156434032 18:37106946-37106968 TAAAAACTGAATTCTTGGCCAGG + Intronic
1156764324 18:40632911-40632933 CATTAGCAGAATTGTTGGCTTGG + Intergenic
1156906130 18:42354095-42354117 TATAAAAAGAACAGCTGGCCAGG - Intergenic
1157107400 18:44787557-44787579 TTAAAAGAAAATTGTTGGCCGGG + Intronic
1157236630 18:45970811-45970833 TATAAACTGAATTTGTGGCTGGG + Intergenic
1158038472 18:53064167-53064189 TATTCACTGAGTTGTTGGCCTGG + Intronic
1158364613 18:56719266-56719288 AAAAAACAGAATTGCTGGCCGGG + Intronic
1158384815 18:56977221-56977243 TTGAAAGAGAATTGTTGGCTTGG + Intronic
1158465431 18:57685950-57685972 CAAAAACACAATTGTAGGCCGGG + Intronic
1158518431 18:58150206-58150228 TAAAAACAGGATTGATGGCTCGG - Intronic
1158712422 18:59849154-59849176 TTTAAAAAGACTTTTTGGCCGGG - Intergenic
1159065410 18:63563599-63563621 ATTAAAAAGAATTATTGGCCAGG + Intronic
1159453952 18:68637995-68638017 TATTACCAGAATTGTTTTCCTGG + Intergenic
1159761609 18:72433597-72433619 TTTAAAAAAAATTTTTGGCCAGG - Intergenic
1159979422 18:74758873-74758895 TATAAATATATTTTTTGGCCAGG - Intronic
1160185949 18:76676222-76676244 TTTAAAAAGAGTTGTTGGCTGGG + Intergenic
1161017163 19:1988898-1988920 AATATATACAATTGTTGGCCAGG - Intronic
1161044120 19:2125705-2125727 TTTAAACAGAAATGTAGGCCGGG + Intronic
1161339855 19:3735492-3735514 TTTAAAAAGAATTTTAGGCCGGG - Intronic
1161348750 19:3780725-3780747 TAAAAATAAAAATGTTGGCCGGG - Intronic
1161527016 19:4762489-4762511 TATTAACAAAATTCTGGGCCAGG - Intergenic
1162047043 19:8006811-8006833 GAAAAACAAAATTGTAGGCCAGG - Intronic
1162088909 19:8265182-8265204 TAATAAAAGAAGTGTTGGCCAGG + Intronic
1162244360 19:9387166-9387188 TATATATAGAATTGCAGGCCAGG + Intergenic
1163087100 19:14989553-14989575 TTTAAAAAAAATTTTTGGCCGGG - Intronic
1163353382 19:16793870-16793892 TAAAAACATAAAAGTTGGCCAGG - Intronic
1163450068 19:17371776-17371798 TAAAAACAGCTTTGCTGGCCAGG - Intronic
1163472103 19:17503634-17503656 AAAAAAAAAAATTGTTGGCCGGG + Intronic
1163746195 19:19049347-19049369 TAAAAATAAAATTCTTGGCCGGG - Intronic
1163865068 19:19766627-19766649 TAAAAACAGAATTATAGGTCGGG + Intergenic
1164223487 19:23219534-23219556 TATAAATAGAAAAGTTAGCCAGG - Intergenic
1164484956 19:28647396-28647418 TCTAAAAAGAATTTTAGGCCAGG - Intergenic
1165341231 19:35213714-35213736 TAAAGACAAAATTCTTGGCCGGG - Intergenic
1165722222 19:38087721-38087743 AAAAAACAGCAGTGTTGGCCGGG + Intronic
1165769796 19:38372866-38372888 TTTAAACAAAAATGATGGCCGGG - Intergenic
1166378310 19:42341134-42341156 TAAAAACAGAATTTTTGGCCAGG + Intronic
1166398721 19:42462042-42462064 AAGAAGCAGAATTGTGGGCCAGG + Intergenic
1166772634 19:45293564-45293586 TATAAAGAAAATTTTTGGCTTGG + Intronic
1166956043 19:46465468-46465490 TATTAATAGAATTCTTGGCTGGG + Intergenic
1167480073 19:49724737-49724759 AAGAAACATCATTGTTGGCCGGG - Intergenic
1167858866 19:52266986-52267008 CATCAATAAAATTGTTGGCCAGG + Intergenic
1167956837 19:53072554-53072576 TAAAAAAAAAATTATTGGCCAGG + Intronic
1168143726 19:54407179-54407201 TAAAAGTAGAATTGTTGGCCGGG + Intergenic
1168162478 19:54520769-54520791 TATTAACACATTTGTAGGCCAGG - Intergenic
1168285441 19:55329838-55329860 TATATAAAGAATCCTTGGCCAGG - Intronic
1168518590 19:57030396-57030418 CATAAAAAGAATTATAGGCCAGG + Intergenic
1168576072 19:57511344-57511366 TATTTATAAAATTGTTGGCCGGG - Intronic
1168605102 19:57752297-57752319 TACAAAGATAATTTTTGGCCAGG - Intronic
1202706446 1_KI270713v1_random:27709-27731 GAAAAAAAAAATTGTTGGCCGGG - Intergenic
926057376 2:9781991-9782013 TTAAAACTGAGTTGTTGGCCGGG - Intergenic
926183240 2:10664828-10664850 TAAAAACACAAATGTTGGCTGGG - Intronic
927900297 2:26814028-26814050 TAGAAACAGAATTCCAGGCCGGG + Intergenic
928038280 2:27847538-27847560 TATAAACAGAAATGTTGACCAGG + Intronic
928156144 2:28879027-28879049 TGTAAAAGAAATTGTTGGCCGGG + Intergenic
928221160 2:29404006-29404028 TATAAAAGGAGTTGTAGGCCGGG + Intronic
928651631 2:33410315-33410337 TGTATAGAAAATTGTTGGCCAGG + Intergenic
928782973 2:34847928-34847950 TATTATCAGAATTGTTTTCCTGG + Intergenic
929154822 2:38779976-38779998 TATAAACAAAATTATAGGCTGGG - Intronic
929216139 2:39415654-39415676 TATAAAAATAATTATAGGCCAGG + Intronic
929508000 2:42543469-42543491 CATAAAAAGAACTGTTGGCTGGG - Intronic
929655664 2:43728855-43728877 TAAAAAGAGTATTGTAGGCCGGG - Intronic
929872132 2:45768045-45768067 GAGAAGCAAAATTGTTGGCCAGG + Intronic
930186121 2:48413737-48413759 TATAAAGAGAGTTGTTGGGTGGG + Intergenic
930206403 2:48590892-48590914 TGAAAAAAGAATTCTTGGCCTGG + Intronic
930702906 2:54477455-54477477 TGAAAAAAGAATTCTTGGCCTGG - Intronic
930728415 2:54705474-54705496 TTTAACCAAAAATGTTGGCCAGG + Intergenic
930777157 2:55184398-55184420 GAAAAACAGGAATGTTGGCCAGG - Intronic
930799660 2:55429804-55429826 TTAAAATAAAATTGTTGGCCAGG - Intergenic
930816752 2:55606524-55606546 TAAAAAAAAAATTATTGGCCAGG + Intronic
931260392 2:60613257-60613279 TAAAAATAGAATTATTGGCCAGG + Intergenic
931654952 2:64502470-64502492 AAAAAACAAAATTGTGGGCCGGG + Intergenic
931680149 2:64739896-64739918 TAAAAATATAATTCTTGGCCGGG + Intronic
932619085 2:73255408-73255430 TATATACAGAAATGCAGGCCGGG + Exonic
933575844 2:84066510-84066532 TTAAAACAGCATTGTGGGCCAGG + Intergenic
933836225 2:86247864-86247886 TATAAATAGAAGTCCTGGCCAGG - Intronic
934532216 2:95099211-95099233 TTTAAAAATAATTTTTGGCCGGG - Intronic
934533277 2:95110505-95110527 TATAAAATCAACTGTTGGCCAGG + Intronic
934718376 2:96556168-96556190 AAAAACCAGAATTTTTGGCCAGG + Intergenic
935399187 2:102642531-102642553 TATAAAAAGAATTGTGCACCAGG - Intronic
936409060 2:112237860-112237882 TATAAATGAAATTTTTGGCCAGG - Intronic
937702415 2:124878976-124878998 TATCAAAAGTATTATTGGCCAGG - Intronic
938000379 2:127729788-127729810 TAAAAAATGAATAGTTGGCCGGG - Intronic
938191306 2:129283599-129283621 TAAAAACAGCACTTTTGGCCAGG + Intergenic
938847295 2:135222813-135222835 CTTAAAAATAATTGTTGGCCAGG + Intronic
938882519 2:135605977-135605999 TAAAAAAAAAATTGTGGGCCAGG - Intronic
938894872 2:135739965-135739987 TTTAAACAGAAGAGTTGGCCAGG - Intergenic
939660084 2:144878604-144878626 TATAGAAACAATTGTTGGCATGG + Intergenic
939792487 2:146596127-146596149 TTTAAACAGAGTTAGTGGCCAGG + Intergenic
939824276 2:146996035-146996057 AAAAAAAAGAGTTGTTGGCCAGG + Intergenic
940047090 2:149421202-149421224 TAGAGACAGGGTTGTTGGCCAGG - Intronic
940461100 2:153964150-153964172 TAAGAACAGCATTTTTGGCCGGG + Intronic
940746734 2:157575562-157575584 TTAAAACAGCACTGTTGGCCAGG - Intronic
941131558 2:161656105-161656127 TATTAAAAGAATTTTTGGCTGGG - Intronic
941499549 2:166253760-166253782 TGAAAAAAGAATTATTGGCCTGG + Intronic
942159463 2:173167208-173167230 TAAAAAAAAAACTGTTGGCCGGG - Intronic
942236657 2:173915286-173915308 TTTAAATAGAATTTTGGGCCTGG - Intronic
942993724 2:182235435-182235457 TAAAAACAGTTTTGTTGGCTGGG - Intronic
943063947 2:183067801-183067823 AAAAAACACAATTTTTGGCCAGG - Intergenic
943760468 2:191602288-191602310 TAAAATCAAAATAGTTGGCCGGG - Intergenic
944342956 2:198624994-198625016 TATAATAATAATTTTTGGCCGGG - Intergenic
944403365 2:199354060-199354082 TAAAAACACAACTGCTGGCCCGG + Intronic
944460762 2:199947794-199947816 TATTTAAAAAATTGTTGGCCAGG + Intronic
944554441 2:200873908-200873930 AATTAACAGATTTGTAGGCCTGG + Intronic
944642084 2:201738003-201738025 AAAATACAGAATTTTTGGCCTGG + Intronic
944778562 2:202994462-202994484 TAAAAAAAAAATTATTGGCCAGG - Intronic
944817059 2:203388385-203388407 TATTCATAGAAATGTTGGCCAGG + Intronic
945315856 2:208370146-208370168 TTTAAAAAGAAAGGTTGGCCGGG + Intronic
945377270 2:209094003-209094025 TATTACCAGAATTGTTTTCCTGG + Intergenic
945760715 2:213910781-213910803 TAGTAAAAGAATTCTTGGCCGGG - Intronic
946594872 2:221295353-221295375 TAAAAACAGCATTGGAGGCCTGG - Intergenic
946920865 2:224581099-224581121 AAAAAACAGAACTATTGGCCGGG + Intronic
947235940 2:227941046-227941068 TATTACCAGAATTGTTTTCCTGG + Intergenic
948446097 2:238034127-238034149 TAAAAAAAAAATTGTTGGCTAGG + Intronic
948579887 2:238979295-238979317 TATAAAAAGAATTCCTGGCCAGG - Intergenic
1168769277 20:404427-404449 TATAAAACAAAATGTTGGCCGGG + Intergenic
1168950530 20:1797765-1797787 TATAAAAGGCACTGTTGGCCAGG + Intergenic
1169089501 20:2850024-2850046 AATATAAAGAATTATTGGCCTGG + Intronic
1169259025 20:4121763-4121785 TATGAATAGAACTGATGGCCAGG + Intronic
1169916884 20:10692010-10692032 TTTTAAAAGAAATGTTGGCCGGG - Intergenic
1170074369 20:12403573-12403595 TAAAAACAGCATTGCTGGCCGGG + Intergenic
1170596993 20:17813444-17813466 AATAAACATCATTGTTGGCCAGG + Intergenic
1170806492 20:19637000-19637022 TAAAAAAGAAATTGTTGGCCTGG + Intronic
1171492244 20:25529111-25529133 TATAAAAATTAATGTTGGCCAGG + Intronic
1172078433 20:32317934-32317956 TAAAAACAGTATTGTGGGCTGGG - Intronic
1172418047 20:34788133-34788155 TATAAATATAACTGCTGGCCAGG - Intronic
1172454111 20:35052785-35052807 TTTAAAAAGTACTGTTGGCCGGG - Intronic
1172726353 20:37045399-37045421 CATAAACATAAATGTGGGCCAGG - Intronic
1173685558 20:44921107-44921129 AAGAAACAAAATTGATGGCCAGG - Intronic
1174228169 20:49021853-49021875 AAAAAAAAGAATTGTTGGCGAGG + Intronic
1174320895 20:49740691-49740713 TAAAGATGGAATTGTTGGCCAGG - Intergenic
1174384806 20:50180933-50180955 AAAAAACAGAATTACTGGCCGGG + Intergenic
1174468326 20:50734852-50734874 TATAAACAGTAATGTTGGCCAGG + Intronic
1174628511 20:51935856-51935878 TAAAAAAAAAATTGTGGGCCAGG - Intergenic
1174700939 20:52608601-52608623 TATAAACAAATATGCTGGCCAGG - Intergenic
1174823404 20:53746893-53746915 TATAAATAAAGTTTTTGGCCGGG - Intergenic
1174839940 20:53892372-53892394 TAAAAACAATATTATTGGCCTGG + Intergenic
1175735281 20:61381778-61381800 TAAAAAGATAACTGTTGGCCAGG + Intronic
1177044808 21:16156158-16156180 TGAAAACAAAAATGTTGGCCCGG - Intergenic
1177686066 21:24438987-24439009 TTTAAAAAAAATTGTTGGCTGGG + Intergenic
1179216967 21:39375832-39375854 AATAATCAAAGTTGTTGGCCAGG - Intergenic
1179665585 21:42910028-42910050 TAGAAACAGGAGTTTTGGCCAGG + Intronic
1180666201 22:17514736-17514758 TTAAAACAGACTTGTGGGCCAGG + Intronic
1180752549 22:18134632-18134654 TTTAAAAAAAATTGTGGGCCGGG - Intronic
1180798194 22:18617979-18618001 TAAAAACTTAATTTTTGGCCGGG + Intergenic
1181223524 22:21377287-21377309 TAAAAACTTAATTTTTGGCCGGG - Intergenic
1181255218 22:21558335-21558357 TAAAAACTTAATTTTTGGCCGGG + Intronic
1181693434 22:24580041-24580063 TATATAAAGAATTTGTGGCCAGG + Intronic
1182160667 22:28118101-28118123 TAAAAAAAGAATTATGGGCCAGG + Intronic
1182279690 22:29210529-29210551 CTTAAAAAAAATTGTTGGCCGGG - Intronic
1182434366 22:30320957-30320979 TATAAACAGATTGGGTGGCTGGG + Intronic
1182606245 22:31506341-31506363 TAAAGACAGAATTTCTGGCCAGG - Intronic
1183221076 22:36513596-36513618 AATAAAAGGAATTCTTGGCCGGG - Intronic
1183487836 22:38098919-38098941 TGTATACAGAATTTATGGCCAGG + Intronic
1183858958 22:40655172-40655194 TAAAAACAGATTTGCTGGCTGGG + Intergenic
1184019591 22:41811724-41811746 TATAAACAATACTTTTGGCCGGG - Intronic
1184213279 22:43049796-43049818 AAAAAAAAGAATTGTTGGCTGGG + Intronic
1184540051 22:45116186-45116208 TATATAAAGAATTCCTGGCCGGG + Intergenic
1185160378 22:49224067-49224089 TAGAAAGAAAAGTGTTGGCCAGG + Intergenic
1185184401 22:49389030-49389052 TATAAAAGAATTTGTTGGCCAGG + Intergenic
1185252705 22:49813531-49813553 TATTAAAAAAATTTTTGGCCAGG + Intronic
949183272 3:1160112-1160134 TAAAAACTGAATGATTGGCCGGG - Intronic
950057889 3:10042189-10042211 TAAAAACAGACCTGTGGGCCAGG - Intronic
950065173 3:10106616-10106638 TAAAAAAAGAACTGTTGGCCGGG + Intronic
950780208 3:15385300-15385322 TAAAAACCCACTTGTTGGCCAGG + Intronic
950840228 3:15961251-15961273 TAAAAATTGAATTGTCGGCCAGG - Intergenic
951229860 3:20165754-20165776 CCTAAACAAAATTGTTGGCCAGG + Intronic
951554662 3:23909224-23909246 GAAAAACAGAAATGTGGGCCAGG + Intronic
951577199 3:24126095-24126117 TAAAAAAAGAATTCTAGGCCAGG + Intronic
952469933 3:33636894-33636916 TTTAAACAAAATTTTTGGCCAGG - Intronic
952701196 3:36329379-36329401 TATTAAGAGAGTTTTTGGCCTGG + Intergenic
952768807 3:36978392-36978414 TAAAAAATGAATTATTGGCCGGG + Intergenic
953107617 3:39900114-39900136 TTTAAAAATAATTGTTGGCTGGG - Intronic
953859293 3:46528814-46528836 TATAAAAAAGATTGTAGGCCAGG + Intronic
954165359 3:48752856-48752878 TAAAAAGAAATTTGTTGGCCAGG - Intronic
954190055 3:48953223-48953245 TCTACTCAGAATTGCTGGCCAGG - Intronic
954232034 3:49225168-49225190 TATAAAGAGAAGTTTTGGCTGGG + Intronic
954532836 3:51335694-51335716 TAAGAAAAGAGTTGTTGGCCAGG + Intronic
954569530 3:51629009-51629031 TAAAAATAGTGTTGTTGGCCAGG - Intronic
954938733 3:54351407-54351429 TATAAACAAGATTGTTGGAATGG + Intronic
954961478 3:54569277-54569299 TAAAATCAGAAATTTTGGCCTGG - Intronic
955271843 3:57507890-57507912 TTAAAACACAATTGTTGGGCCGG + Intronic
955283760 3:57618901-57618923 GACAAACACATTTGTTGGCCAGG - Intergenic
956308284 3:67850511-67850533 TAAAAATAAAATAGTTGGCCGGG - Intergenic
956538449 3:70306404-70306426 TATAAAAACGATTATTGGCCGGG - Intergenic
956784595 3:72631900-72631922 TATAAGCAGAGTTGTTGGGTGGG + Intergenic
956913035 3:73840914-73840936 TATAACCAAAATAATTGGCCAGG + Intergenic
957019801 3:75112971-75112993 TTTAAAATGATTTGTTGGCCGGG + Intergenic
958999750 3:100949559-100949581 AATAAATTCAATTGTTGGCCAGG - Intronic
959026014 3:101240412-101240434 TTTAAACAGAATTACAGGCCTGG - Intronic
960116997 3:113905127-113905149 AAAAAACTGAAGTGTTGGCCGGG - Intronic
960940989 3:122934201-122934223 TAAAAACAAAATTTTTGGGCCGG - Intronic
961468202 3:127094278-127094300 GATAAAAAGAATTATGGGCCAGG - Intergenic
961570882 3:127797916-127797938 TATATAAAGAATTTTGGGCCAGG - Intronic
962103126 3:132363641-132363663 TAAACACAGAGTGGTTGGCCAGG + Intronic
962147318 3:132854633-132854655 TATTAACAGAATTGTTTTTCTGG + Intergenic
962153484 3:132918122-132918144 TATCATCAGAATTGTGGTCCAGG + Intergenic
962254649 3:133862045-133862067 TATACACAGAATTGGAGCCCTGG + Intronic
962376169 3:134860517-134860539 TAAAAAAAGATTTCTTGGCCGGG + Intronic
962571276 3:136715800-136715822 TATAAACTGAAATGATGGCCAGG + Intronic
962576458 3:136759505-136759527 TTTAAAAAGAAATTTTGGCCAGG + Intergenic
962932687 3:140052449-140052471 TAATAACAGAAATATTGGCCAGG - Intronic
963753782 3:149211996-149212018 TATTAATAAAATAGTTGGCCGGG + Intronic
964110310 3:153080419-153080441 TAAAAACATAATTTTGGGCCGGG - Intergenic
964150158 3:153514960-153514982 TTTAAAGAAAAGTGTTGGCCGGG + Intergenic
964248549 3:154683808-154683830 TATTACCAGAATTGTTTTCCTGG + Intergenic
964358062 3:155868639-155868661 AAAATACAGACTTGTTGGCCAGG - Intergenic
964407315 3:156362777-156362799 TATAAACAGTATTTTTTTCCAGG - Intronic
964466036 3:156994324-156994346 TAGAAACAGATTTGGTGCCCAGG - Intronic
964747313 3:160024479-160024501 TTTAAACAGCATTACTGGCCGGG + Intronic
965126680 3:164639540-164639562 AATAAAAAGAAATGTTGGCCGGG - Intergenic
965181089 3:165404514-165404536 AATAAACAGAAGTGGTAGCCAGG + Intergenic
965754155 3:172008250-172008272 TATAAACCAAATTATGGGCCAGG + Intergenic
965769208 3:172163079-172163101 TATAGACAGAGTCGTTGCCCAGG - Intronic
965829802 3:172772489-172772511 TATATAAAGAATTCTCGGCCGGG - Intronic
965970948 3:174555593-174555615 AAAAAACTGAATTTTTGGCCAGG - Intronic
966187476 3:177241038-177241060 TAAAAACAAAACTCTTGGCCAGG + Intergenic
966206874 3:177413774-177413796 TAGAAAAAGAAAAGTTGGCCGGG - Intergenic
966303617 3:178506640-178506662 TTTAAACAGAAACATTGGCCAGG + Intronic
966898510 3:184463711-184463733 TGTAAGCAGAGTTTTTGGCCAGG - Intronic
967011737 3:185441744-185441766 AATAAAAAAAATTGGTGGCCAGG + Intronic
967909752 3:194532276-194532298 TATAAAAAGAATTATTTGGCGGG - Intergenic
968586527 4:1419373-1419395 TAAAAACATAAATGTTGGCCGGG + Intergenic
968807362 4:2784062-2784084 TATTACCAGAATTGTTTTCCTGG + Intergenic
968839035 4:2987643-2987665 CAGAAGCAGAATTGTTGGCCAGG + Intronic
969367051 4:6702014-6702036 TTAATTCAGAATTGTTGGCCAGG - Intergenic
970391004 4:15614024-15614046 TATAACCAGAATTGTTTTTCTGG + Intronic
970536659 4:17036801-17036823 AATAAAAAGTATTGGTGGCCAGG - Intergenic
971275793 4:25195311-25195333 TAAAAAGGGAATTGATGGCCAGG - Intronic
973965143 4:56154168-56154190 TTTAAATATGATTGTTGGCCGGG + Intergenic
974166915 4:58215367-58215389 TATCAACAGAGTTGTTTGACAGG - Intergenic
974603126 4:64114405-64114427 TATAAACAGAATTTTCTTCCTGG + Intergenic
974923131 4:68266725-68266747 TAAAAACTGAATTCCTGGCCTGG - Intergenic
974938180 4:68432853-68432875 TAAAAAGAAAATTATTGGCCAGG + Intergenic
975137937 4:70892651-70892673 TAGAAACAGCGTTGTGGGCCGGG + Intergenic
975326092 4:73060583-73060605 TATAAAAAATATTGTGGGCCAGG + Intronic
975623988 4:76324211-76324233 TTGAGACAGAATTGTTGCCCAGG + Intronic
975643733 4:76526070-76526092 TATAAAAATAAATGTCGGCCAGG + Intronic
975755579 4:77568357-77568379 TATAAAGAACATGGTTGGCCAGG - Intronic
978431088 4:108634071-108634093 TAAAAATAGAATTGTAGGGCCGG - Intergenic
978629963 4:110732750-110732772 TAAATAGTGAATTGTTGGCCAGG - Intergenic
978761941 4:112362142-112362164 TATTACCAGAATTGTTTGTCTGG - Intronic
978916192 4:114128129-114128151 TATAACCAGAATTGTTTTTCTGG - Intergenic
978931555 4:114320022-114320044 TAAAAAAAAAATTGTAGGCCAGG + Intergenic
979850753 4:125567789-125567811 TAAAAACAGACATATTGGCCAGG - Intergenic
980315982 4:131200649-131200671 TAAAAATAGAATTATTGGCCTGG - Intergenic
980910265 4:138987880-138987902 TATAAATGGTATTGTTGTCCAGG + Intergenic
980915534 4:139030074-139030096 TAGAGACAGGGTTGTTGGCCAGG + Intronic
980937325 4:139238427-139238449 TAAAAAAAGAATTGGCGGCCGGG + Intergenic
981036677 4:140176753-140176775 TATAAACTGAATTATGGGCTGGG - Intergenic
981176900 4:141692239-141692261 TAAAAACAGTTTTGTGGGCCAGG - Intronic
981414651 4:144477928-144477950 TATAAACGGAATTGTTTTCTTGG + Intergenic
981508625 4:145530470-145530492 TACAAAAAGAATCATTGGCCTGG + Intronic
982195316 4:152905846-152905868 TACATAAAGAATTCTTGGCCAGG - Intronic
982299418 4:153864389-153864411 TATTAACAGAATTGTTTTTCTGG + Intergenic
982610438 4:157567644-157567666 TTCAAACAGAATTGCTGGCCAGG + Intergenic
982645265 4:158016092-158016114 TAAAAACCGAATTTGTGGCCGGG - Intergenic
982740294 4:159050811-159050833 TATAAAAAAAAATCTTGGCCAGG + Intergenic
982922919 4:161299072-161299094 TATAACAAAAATTCTTGGCCAGG + Intergenic
983232549 4:165143729-165143751 AAAAAACAGTATTGGTGGCCGGG - Intronic
983730183 4:170983574-170983596 TAAAAATTGGATTGTTGGCCAGG + Intergenic
984022597 4:174504017-174504039 TTTAAACAGAAGCATTGGCCAGG - Intronic
984392712 4:179157323-179157345 TAAAAATATTATTGTTGGCCGGG - Intergenic
984647916 4:182239372-182239394 TATAAGCAAGATTTTTGGCCGGG - Intronic
984678032 4:182572195-182572217 TAAAAACAGTAATATTGGCCGGG - Intronic
984982907 4:185300461-185300483 TAAAAAAAGAATTCGTGGCCAGG - Intronic
986054466 5:4122007-4122029 TTTTTAAAGAATTGTTGGCCGGG - Intergenic
989703945 5:44305271-44305293 TACAAACAGAATCCTTGGACTGG - Intronic
989738157 5:44733523-44733545 TAAAAATAGTATTGTCGGCCAGG + Intergenic
989794379 5:45448816-45448838 TATAATAAAAATTGTTGGTCAGG + Intronic
990805031 5:59650958-59650980 TATAAAAATAATTGTTGGCCGGG + Intronic
991372825 5:65937611-65937633 TCTAAAAATAATTCTTGGCCGGG + Intronic
991444522 5:66684964-66684986 TATAAAAAGAATAGCTGGCCAGG + Intronic
991590687 5:68248275-68248297 TAAAAAGAACATTGTTGGCCAGG - Intronic
991696394 5:69277472-69277494 TAAAAATAAAAATGTTGGCCGGG + Intergenic
992252996 5:74894258-74894280 AATAAAAAGAATTATTGGCTGGG - Intergenic
992547284 5:77825750-77825772 TTTAAACACAACTGTGGGCCAGG + Intronic
992641184 5:78769605-78769627 GATGAACAAAAGTGTTGGCCTGG - Intronic
993715646 5:91273225-91273247 TCTACACAGAAATGTTGGCCAGG + Intergenic
993988649 5:94628124-94628146 TAAAGAAAGTATTGTTGGCCAGG - Intronic
993988694 5:94628431-94628453 TTTAAAAAGTATTGTTGGGCTGG - Intronic
994060423 5:95470271-95470293 TAAGAATTGAATTGTTGGCCGGG - Intronic
994080243 5:95700591-95700613 TCTAAAAAAAATTTTTGGCCAGG - Intergenic
994110035 5:95991799-95991821 TATAAAATATATTGTTGGCCAGG - Intergenic
994199361 5:96955075-96955097 TAAAAACATAATTGCAGGCCGGG - Intronic
994221305 5:97198392-97198414 TTTAAATAGAATTATTAGCCTGG + Intergenic
994336657 5:98575062-98575084 TAGAAACAGAATTTGTGTCCAGG + Intergenic
994410115 5:99396935-99396957 TAAAAATAGAACTATTGGCCAGG + Intergenic
994413624 5:99440530-99440552 TCTAAAAAGAATTATTGGCCAGG + Intergenic
994483704 5:100368345-100368367 TAAAAATAGAACTATTGGCCAGG - Intergenic
994887418 5:105582516-105582538 TATAATCAGCACTGTTGGCAGGG + Intergenic
995762554 5:115578491-115578513 GATAAAGAAAAATGTTGGCCGGG - Intergenic
995813343 5:116134914-116134936 TATAAAAAAAATTGTAGGCCGGG - Intronic
995893823 5:116987547-116987569 TATAAAGAGAAATGAGGGCCGGG + Intergenic
996433588 5:123408909-123408931 TATAAAAAGAATAATAGGCCGGG + Intronic
996465414 5:123796378-123796400 TAAAAATAAAATTATTGGCCAGG + Intergenic
996736281 5:126761620-126761642 ATTATAAAGAATTGTTGGCCGGG + Intergenic
996943617 5:129040497-129040519 TACAAATAGAATTGCTGGCTGGG - Intergenic
997118347 5:131149653-131149675 TAAAAATAGTATTGCTGGCCGGG - Intergenic
997221036 5:132164668-132164690 TTTAAATTGAGTTGTTGGCCAGG + Intergenic
997310936 5:132881960-132881982 TAAAAACATAATTTGTGGCCGGG - Intronic
997535540 5:134618020-134618042 AAAAAAAAGATTTGTTGGCCGGG + Intronic
997550307 5:134746790-134746812 TTTAAACACAAAAGTTGGCCAGG + Intronic
997894816 5:137706879-137706901 TATAAAGAGTATGATTGGCCAGG + Intronic
997928508 5:138052938-138052960 AAAAAACAGAATTTCTGGCCAGG + Intergenic
997966102 5:138357653-138357675 AATAAACAAAAATGTTGGCTGGG - Intronic
998123600 5:139599987-139600009 TAGAGACAGGCTTGTTGGCCAGG + Intronic
998233240 5:140375156-140375178 TATAAAAATAATTTTTGGCTGGG + Intergenic
998577596 5:143333472-143333494 TAAAAACTGTATTGCTGGCCGGG + Intronic
998642397 5:144026151-144026173 TTTAAACAAAATTATTGGCTTGG + Intergenic
998824791 5:146090236-146090258 TATATAAAGAACTCTTGGCCGGG + Intronic
999040741 5:148408224-148408246 TAAAAACAGTAATGTTGGCTAGG + Intronic
999083344 5:148864919-148864941 TATAGAAAGAAATGCTGGCCTGG + Intergenic
999839027 5:155403935-155403957 TATTACCAGAATTGTTTTCCTGG - Intergenic
999894225 5:156011731-156011753 TAAAAATAGAATTCTGGGCCAGG - Intronic
1000083671 5:157870257-157870279 AATAAATAGAATAGTTGGCTGGG + Intergenic
1000760303 5:165215400-165215422 TACAAATAGAAATGCTGGCCAGG - Intergenic
1001394695 5:171408999-171409021 TATAAAAAGTATTTTTGGCCAGG + Intronic
1001486234 5:172121509-172121531 TATAAAAAAAATTTTTGGCAGGG + Intronic
1001584548 5:172824610-172824632 TATAAAAATAATTTTAGGCCTGG - Intergenic
1001921459 5:175603401-175603423 TAGAATAAGAATTCTTGGCCAGG + Intergenic
1001993840 5:176138132-176138154 TAAAAACTTAGTTGTTGGCCGGG - Intergenic
1002040788 5:176512632-176512654 TTTAAACCCAAATGTTGGCCGGG - Intergenic
1002396644 5:178961518-178961540 AATTAACAGCATTTTTGGCCAGG + Intronic
1002511841 5:179725384-179725406 TTAAAAAAAAATTGTTGGCCAGG + Intronic
1002511891 5:179725692-179725714 AAAAAAAAAAATTGTTGGCCAGG + Intronic
1002524955 5:179810077-179810099 TTAAAAAAAAATTGTTGGCCCGG - Intronic
1003091838 6:3110501-3110523 TATAAAGAGTATAGTGGGCCAGG - Intronic
1003919501 6:10819815-10819837 AATAAACAGGATTCATGGCCGGG + Intronic
1003990447 6:11481572-11481594 TACAAACAGAACAGTTAGCCAGG + Intergenic
1004221414 6:13750446-13750468 TTTAAAAAAAATTCTTGGCCGGG + Intergenic
1004383941 6:15155926-15155948 AATAAACAGAAATATGGGCCAGG - Intergenic
1004386520 6:15177803-15177825 TAAAAATAAACTTGTTGGCCGGG + Intergenic
1004531669 6:16460238-16460260 TATAAAGAGAAGTTTTGTCCTGG - Intronic
1004598985 6:17129547-17129569 AAAAAAAAAAATTGTTGGCCAGG + Intronic
1004614349 6:17275910-17275932 TAAAAAAAGATTTATTGGCCGGG + Intergenic
1004839871 6:19570598-19570620 TATGAACAGTGTTGTTGGCGGGG - Intergenic
1005566511 6:27099798-27099820 TATATAAATAATTGTTGACCAGG - Intergenic
1005641173 6:27797859-27797881 TGTTTACAAAATTGTTGGCCTGG + Intergenic
1005691425 6:28310809-28310831 TATTATCAGAATTGTTTTCCTGG + Intergenic
1006024156 6:31136853-31136875 CAAAAACATAAGTGTTGGCCGGG + Intronic
1006268257 6:32943612-32943634 TCTTAAAAGACTTGTTGGCCGGG + Intronic
1006571119 6:35005755-35005777 TATAAAGAATATTGTTGGCCGGG + Intronic
1006755887 6:36415145-36415167 TTTAAAAAGAATTGCCGGCCAGG + Intronic
1007020870 6:38520156-38520178 AATACACAAAATTGTCGGCCAGG + Intronic
1007570492 6:42886698-42886720 TAAAAACTGTATTGCTGGCCGGG + Exonic
1007649429 6:43409135-43409157 TATATAAAGAACTCTTGGCCAGG + Intergenic
1008068133 6:47072353-47072375 CATCAAGAGAGTTGTTGGCCGGG - Intergenic
1008079012 6:47175566-47175588 TATATGCAAAATTGTTTGCCTGG - Intergenic
1008172301 6:48223411-48223433 TATAAAAACAAATGTTGGCAAGG - Intergenic
1008583754 6:52930259-52930281 TTTGACCAGAATTGTTGACCTGG + Intergenic
1008788109 6:55195674-55195696 TAAAAACAGTATTCATGGCCGGG + Intronic
1009995890 6:70894724-70894746 CATACACAGAATTCTTGGCTGGG + Intronic
1010003457 6:70971112-70971134 TAAAAACTGAAGTGTAGGCCAGG - Intergenic
1010024220 6:71196947-71196969 AATATAAAGAATTGTTGGCTGGG - Intergenic
1010226814 6:73497447-73497469 TAAAAAAAGAATTTGTGGCCAGG - Intronic
1010234718 6:73565832-73565854 TATAAGAAGCATTGTTGGCCAGG + Intergenic
1010437016 6:75843462-75843484 TAGAAAAAGAATAGATGGCCGGG + Intronic
1010864648 6:80959895-80959917 GATAAACAGAATGGTAGGACTGG - Intergenic
1010934956 6:81849988-81850010 TAAAAATAGAGTTGATGGCCAGG - Intergenic
1010981201 6:82371916-82371938 TAGAAACAGAACTGATGGCTGGG - Intergenic
1011259656 6:85457646-85457668 TAGTAACAGAAATGATGGCCTGG + Intronic
1011312079 6:85990298-85990320 TTAAAAATGAATTGTTGGCCGGG - Intergenic
1011474709 6:87740058-87740080 GTTAAAAAGAAATGTTGGCCGGG - Intergenic
1011585421 6:88919612-88919634 TAGAAATAAAATTGTGGGCCAGG - Intronic
1012755174 6:103221430-103221452 TATAAACAGAATTGTTTCCTTGG - Intergenic
1013074458 6:106758880-106758902 TATAAAAAAAATTTTTAGCCAGG - Intergenic
1013118176 6:107118742-107118764 AATAAAGATAGTTGTTGGCCGGG - Intergenic
1013148303 6:107417461-107417483 AATAAACAAAAATATTGGCCAGG + Intronic
1013345975 6:109261138-109261160 TAAAAAAAAAATTGTTGGCCGGG + Intergenic
1013360926 6:109393377-109393399 AATAAACAAAAATATTGGCCAGG - Intronic
1013517655 6:110903054-110903076 TAAAAACAGAAGTCTAGGCCAGG - Intergenic
1014018082 6:116557230-116557252 TATAAATAGCATAGTTGGCTGGG - Intronic
1014127203 6:117790059-117790081 TAAAAACCTAATTGTTGGCCGGG - Intergenic
1014484112 6:121978039-121978061 TAAAAACAGAAATTATGGCCAGG + Intergenic
1014566661 6:122956989-122957011 TATTACCAGAATTGTTTTCCTGG - Intergenic
1014595266 6:123328858-123328880 CTTAAACAGAATTGCTGACCAGG - Intronic
1014967015 6:127767385-127767407 TATAAAGAAAATATTTGGCCTGG - Intronic
1015089682 6:129340480-129340502 AATATACTGAATTGTTTGCCAGG + Intronic
1015308660 6:131739773-131739795 TATAAAGACATTTATTGGCCTGG + Intronic
1015561110 6:134517125-134517147 TAGAATCCGAGTTGTTGGCCAGG + Intergenic
1016064376 6:139663893-139663915 TTAAAACTGAATTGTTGGTCGGG - Intergenic
1016393520 6:143598569-143598591 TAAAAGCAGAAGTGTGGGCCAGG + Intronic
1016536182 6:145109277-145109299 TAAAAACAGAATTAATGGCCAGG - Intergenic
1016667090 6:146654645-146654667 AATATACACAATTTTTGGCCAGG - Intronic
1016738058 6:147501608-147501630 TAGAAACAGAATTGTTAATCAGG - Intergenic
1016744368 6:147562525-147562547 TAAAAACCAAAGTGTTGGCCGGG + Intronic
1016894664 6:149040360-149040382 TAAAAATAAAATTGTAGGCCGGG + Intronic
1017118657 6:151003234-151003256 TAAAAACAGAAAAGTTGGCCGGG + Intronic
1017353359 6:153471458-153471480 TATAAAGAACAATGTTGGCCAGG - Intergenic
1017432733 6:154386712-154386734 TTGAAAAAGAATTATTGGCCGGG + Intronic
1017494849 6:154974630-154974652 TTTAAAGAGAAGTGTTGGCTGGG + Intronic
1017533982 6:155327006-155327028 TTTAAAGAGAATACTTGGCCAGG - Intergenic
1017897827 6:158696496-158696518 TATAAAAATAAGTGTTGGCCAGG - Intronic
1019678937 7:2333833-2333855 TCTAAACATAAAAGTTGGCCAGG + Intronic
1020889921 7:13866456-13866478 TATAAAAAGAAGAGTAGGCCAGG - Intergenic
1021585128 7:22199582-22199604 TGGACACAGATTTGTTGGCCAGG + Intronic
1022657018 7:32328935-32328957 AATAAATAGTATTGCTGGCCAGG + Intergenic
1022664856 7:32401241-32401263 TAAAAATAGAAATGTAGGCCGGG + Intergenic
1022681746 7:32555041-32555063 TCTAATAAGAATTCTTGGCCGGG + Intronic
1023452569 7:40303327-40303349 TAGAAACAGCTTTCTTGGCCGGG - Intronic
1023836446 7:44071187-44071209 TAAAAATGGAATTGTTGGCCAGG - Intergenic
1024147256 7:46530291-46530313 TATAAATAGCATTGATTGCCAGG - Intergenic
1024285654 7:47755350-47755372 TAAAAACAGAATCATGGGCCAGG - Intronic
1024362867 7:48487013-48487035 CATGAACAGAAGTTTTGGCCCGG + Intronic
1024810392 7:53204298-53204320 TATATAGAGAATTTTGGGCCAGG + Intergenic
1025258580 7:57401494-57401516 GAAAAAAAAAATTGTTGGCCGGG + Intergenic
1026116980 7:67503857-67503879 AATATTCAGAATTCTTGGCCAGG + Intergenic
1026298099 7:69073513-69073535 TTTAAAAAGTATTGTTGGCTGGG - Intergenic
1026328585 7:69332710-69332732 CAAAAAAAGAAGTGTTGGCCTGG + Intergenic
1026344680 7:69464007-69464029 TAAAAAGAGTATTGGTGGCCGGG + Intergenic
1026516724 7:71079083-71079105 AAAAAACAGAAGTGTTGGCAAGG + Intergenic
1026571029 7:71530861-71530883 TAAAAATAAAATTCTTGGCCGGG - Intronic
1026727711 7:72882625-72882647 TAAAAACAGAATTGTTTACTTGG - Intronic
1026789361 7:73321682-73321704 AATATACAGAATTTTTGGCTTGG + Intronic
1027060757 7:75084003-75084025 TAAAAACAGTAGTGGTGGCCAGG + Intergenic
1027116128 7:75483100-75483122 TAAAAACAGAATTGTTTACTTGG + Intronic
1027155053 7:75761147-75761169 TATAAAAAAATTTTTTGGCCAGG + Intergenic
1027156908 7:75774922-75774944 TAAAAAAAGAATTATTGGTCGGG + Intronic
1027275700 7:76552597-76552619 TAAAAACAGAATTGTTTACTTGG - Intergenic
1027466918 7:78526712-78526734 TACAAATAGAAAAGTTGGCCGGG + Intronic
1027585809 7:80057318-80057340 TATAAACAGAAATATTAGCCGGG + Intergenic
1028059137 7:86287901-86287923 TAAAAAAAGAAATGTTGGCATGG + Intergenic
1028197856 7:87927517-87927539 TATTACCAGAATTGTTTTCCTGG - Intergenic
1029560932 7:101302650-101302672 TATAAATAGACTATTTGGCCGGG - Intergenic
1029608138 7:101611934-101611956 TAAAAATACAAATGTTGGCCGGG + Intergenic
1029721404 7:102367150-102367172 TAAAAACAGAATTGTTTACTTGG - Intronic
1030042041 7:105460231-105460253 TTTAAAAAGAATTGTCGGCTGGG - Intronic
1030514382 7:110521684-110521706 TTTTAACAGAATTGTTGCCATGG + Intergenic
1032071997 7:128813683-128813705 CATAAAAAGAATTCTAGGCCAGG + Intronic
1032767619 7:135013897-135013919 TAAAAACCAAAATGTTGGCCGGG + Intronic
1032835254 7:135666531-135666553 TAGAAACAGCCATGTTGGCCAGG + Intronic
1033370861 7:140706369-140706391 TTAAAACAAATTTGTTGGCCAGG - Intronic
1033474524 7:141678256-141678278 TTTAAAAAGGATTATTGGCCGGG - Intronic
1033892584 7:146033395-146033417 AAAAAATAGAATTTTTGGCCGGG + Intergenic
1034095141 7:148400684-148400706 TATGTAAAGAGTTGTTGGCCAGG + Intronic
1034109252 7:148520605-148520627 TATAAACCATATTTTTGGCCAGG + Intergenic
1034213638 7:149386278-149386300 AATAAACAGGTGTGTTGGCCAGG - Intergenic
1034213969 7:149389180-149389202 AATAAACAGGTGTGTTGGCCAGG + Intergenic
1034232499 7:149542386-149542408 TATAATAAGAAATATTGGCCGGG + Intergenic
1034328731 7:150263394-150263416 TATTAAGAGAATTGTTGGCCTGG + Intronic
1034454555 7:151160122-151160144 TAAAAACAGAATTGTAGAGCTGG + Intronic
1034624109 7:152479274-152479296 AATAAAAAGAAGTCTTGGCCGGG - Intergenic
1034764485 7:153705995-153706017 TATTAAGAGAATTGTTGGCCTGG - Intergenic
1035365495 7:158347156-158347178 AATAAAAAAAATTGTTGCCCAGG + Intronic
1036167288 8:6447842-6447864 AGAAAACAAAATTGTTGGCCGGG - Intronic
1037231213 8:16661112-16661134 TAAAAAAATAATTCTTGGCCGGG + Intergenic
1037871210 8:22498827-22498849 TAAAAGTAGAATTATTGGCCGGG + Intronic
1039992816 8:42504546-42504568 TATAATAAAAATTGGTGGCCAGG + Intronic
1040020242 8:42734712-42734734 TCTAAAAAAAATTCTTGGCCAGG - Intronic
1040513300 8:48114439-48114461 TATAAATGGATTTGTTGGGCTGG - Intergenic
1041277412 8:56177215-56177237 TGAAAACAGAATTCATGGCCTGG + Intronic
1041296988 8:56367341-56367363 AATAATTATAATTGTTGGCCGGG - Intergenic
1041494240 8:58468491-58468513 TGAAAATAGAAATGTTGGCCAGG - Intergenic
1042197346 8:66242436-66242458 CATAAAGAAAATTATTGGCCGGG - Intergenic
1042435283 8:68757332-68757354 TAAAAACAAAAATGTTAGCCGGG + Intronic
1042548402 8:69971538-69971560 TAAAAACAAAATTTTTGGCCAGG - Intergenic
1042587163 8:70353408-70353430 TATAAACATAATGTTTGGCCAGG - Intronic
1042618593 8:70677441-70677463 TCTAAACAAAAATCTTGGCCAGG - Intronic
1043319945 8:78972224-78972246 TATCAACAAAATCTTTGGCCTGG + Intergenic
1043885926 8:85600628-85600650 GATAAACAGCATTGGTGGGCTGG + Intergenic
1044129845 8:88508409-88508431 AATAAATAAAATTATTGGCCAGG + Intergenic
1045119228 8:99016882-99016904 TATATAAAGAATTCCTGGCCGGG - Intronic
1045209679 8:100083659-100083681 TATAAAAGTAATTGTTGGCTGGG - Intronic
1045262222 8:100586214-100586236 TGAAATCTGAATTGTTGGCCAGG - Intronic
1045841876 8:106590579-106590601 TAAAAACCGTATTGCTGGCCGGG - Intronic
1046529635 8:115426974-115426996 TCTAAAAAGCATTTTTGGCCAGG + Intronic
1046898153 8:119495365-119495387 TAAAAACAAAATTATTGGCAGGG - Intergenic
1047177724 8:122557391-122557413 TATAAACTGAATTGTGGAGCTGG + Intergenic
1047265542 8:123304386-123304408 TATTAAAAGGATTGTAGGCCAGG - Intergenic
1047593246 8:126349641-126349663 TAAAAAAAGAATAGTCGGCCAGG + Intergenic
1047953169 8:129952354-129952376 TATAAATGTAATTTTTGGCCGGG - Intronic
1049715891 8:144091489-144091511 CATAAAAATAATTCTTGGCCGGG - Intergenic
1050228835 9:3494280-3494302 GATAAGCAGAGTTGTTGACCTGG + Intronic
1050440309 9:5654846-5654868 TATAAACACATTTGCAGGCCAGG - Intronic
1050471581 9:5996989-5997011 GATAAATAGAAGAGTTGGCCAGG - Intronic
1050909240 9:11046363-11046385 TTTAAAAAGAATTACTGGCCTGG + Intergenic
1051228764 9:14931452-14931474 TATAAGAATAATTGTTGGGCTGG + Intergenic
1052225563 9:26081087-26081109 TATAAACAGAAGTGTTGTTGTGG - Intergenic
1052307662 9:27029450-27029472 TATAAACAATATAGTCGGCCGGG + Intronic
1052522038 9:29561099-29561121 TATAAAACAAATAGTTGGCCTGG - Intergenic
1053211332 9:36230954-36230976 TAGAAACAGAATTTTTAGCCAGG + Intronic
1055340877 9:75281324-75281346 AATATAAAGAATTGTTGGCCGGG - Intergenic
1055441381 9:76339836-76339858 TATAAAAACATTTATTGGCCGGG - Intronic
1055487123 9:76767154-76767176 TCAAAACAGAATCTTTGGCCAGG + Intronic
1055725467 9:79223147-79223169 AATAAAAAGAAATATTGGCCTGG + Intergenic
1056000620 9:82212583-82212605 CATAATAAGAAATGTTGGCCAGG + Intergenic
1057369956 9:94462516-94462538 TAGATAAAGAATTGTTGGCTGGG - Intergenic
1058339599 9:103878224-103878246 AAGAATCAGAATTATTGGCCGGG - Intergenic
1058712133 9:107688937-107688959 TTTCTACAGAATTCTTGGCCAGG - Intergenic
1058760454 9:108126104-108126126 TATAAAAAGAATTGTTGATCTGG - Intergenic
1058934442 9:109755264-109755286 TATAAAGAGCCTTGTTGGTCAGG - Intronic
1058967659 9:110052195-110052217 TATAAAGAAAATGGTGGGCCGGG - Intronic
1059061878 9:111041576-111041598 TAGAGACAGACATGTTGGCCAGG - Intergenic
1059116589 9:111605163-111605185 TATAAACACAAAAGTTAGCCTGG + Intergenic
1059264832 9:113017274-113017296 TTTTAAAAAAATTGTTGGCCAGG - Intergenic
1060002413 9:119970378-119970400 CAAAAACAGAATCATTGGCCAGG - Intergenic
1060113661 9:120924708-120924730 TAAAAACACAGTTGCTGGCCAGG - Intronic
1060330151 9:122660768-122660790 CATTAAAAGAAATGTTGGCCGGG + Intergenic
1061228108 9:129292783-129292805 TTTAAAGAAAATTCTTGGCCGGG + Intergenic
1061744601 9:132730396-132730418 TTTAAAAAGAATTCTAGGCCTGG - Intronic
1061891262 9:133621708-133621730 AAAAAACAGAAATCTTGGCCGGG - Intergenic
1062713710 9:137990993-137991015 TATTACCAGAATTGTTTTCCTGG - Intronic
1185548589 X:965927-965949 TAGAGACAGGGTTGTTGGCCAGG + Intergenic
1185777069 X:2811889-2811911 TGAAAACCCAATTGTTGGCCAGG - Intronic
1186113774 X:6283494-6283516 TATAGACAGAACAGATGGCCAGG + Intergenic
1186115742 X:6303629-6303651 TATAAGCAGCATTGAAGGCCAGG + Intergenic
1186296612 X:8155629-8155651 TATAAGCATAATTTGTGGCCAGG + Intergenic
1186493575 X:9993995-9994017 AAAAAACAGTGTTGTTGGCCAGG - Intergenic
1186703958 X:12122470-12122492 TATAGACAGAAGTGCTGGCTTGG - Intergenic
1186753265 X:12643416-12643438 TATAAATTGAATTATTTGCCAGG - Intronic
1187430947 X:19223988-19224010 TATAAATGCAATTGCTGGCCAGG - Intergenic
1187462423 X:19499949-19499971 TTTAAAAAGAATAATTGGCCGGG + Intronic
1187483180 X:19677011-19677033 TCTAAACTGAATGGTTTGCCAGG - Intronic
1187537939 X:20160722-20160744 TTTAAAATGAAATGTTGGCCGGG - Intronic
1187710563 X:22049407-22049429 TATAATAAGAAAAGTTGGCCAGG - Intronic
1187869360 X:23751619-23751641 TAAAAACAATATTGCTGGCCAGG + Intronic
1187892170 X:23946567-23946589 TAAGAACAGCATGGTTGGCCAGG + Intergenic
1187896849 X:23990014-23990036 TATATAAAGCATTTTTGGCCAGG + Intronic
1188396094 X:29685689-29685711 TAAGAACAGAAGTATTGGCCAGG + Intronic
1188865893 X:35312715-35312737 AAGAAAAAGAATTGTAGGCCAGG + Intergenic
1189274531 X:39775841-39775863 TTTTAATAGAGTTGTTGGCCAGG + Intergenic
1189842923 X:45100979-45101001 TAAAAACTGAAATATTGGCCAGG - Intronic
1189947861 X:46198142-46198164 AATAAAAATAATTTTTGGCCGGG + Intergenic
1190112676 X:47604544-47604566 TATAAATTAAATTGTTGGCAAGG - Intronic
1190165507 X:48070313-48070335 TATAAAAACAATTCCTGGCCGGG + Intronic
1190249480 X:48711287-48711309 TGTAAACAGATTTGTTTCCCAGG - Intergenic
1191076757 X:56461771-56461793 TAGAAACAGAATTGATGTACTGG + Intergenic
1191887970 X:65908613-65908635 TAAACATAGAATTATTGGCCGGG - Intergenic
1192401203 X:70838121-70838143 TAGAAACACATTTGTTGGCCAGG + Intronic
1192445919 X:71211137-71211159 CATAAACAGAATTGGCAGCCTGG - Intergenic
1192464552 X:71344952-71344974 TAAATAAATAATTGTTGGCCGGG - Intergenic
1192605001 X:72507142-72507164 TGAAAAAAGAAATGTTGGCCAGG - Intronic
1192783216 X:74314773-74314795 TGAAAACACAATTGTCGGCCGGG - Intergenic
1193102596 X:77632157-77632179 TTTAAAAAAAATTTTTGGCCGGG - Intronic
1193373781 X:80732842-80732864 TATAAAGAACAATGTTGGCCGGG + Intronic
1193809342 X:86033511-86033533 GAAAAACAGAATTGCTGGCAAGG + Intronic
1194344509 X:92746703-92746725 TAGAAAAAAAATTGTTGGCCAGG - Intergenic
1194547545 X:95256803-95256825 TATTACCAGAATTGTTTTCCTGG + Intergenic
1194610810 X:96041412-96041434 TATATACAAAATTGTTGGAAAGG - Intergenic
1195554004 X:106200751-106200773 AAGAAACAGAATTGCCGGCCGGG + Intronic
1195741822 X:108072546-108072568 TTTAAAAAAAATTCTTGGCCAGG - Intronic
1196180416 X:112683901-112683923 TACAAACAGATTTAGTGGCCAGG + Intergenic
1196404999 X:115352002-115352024 TTTAAAAAAAGTTGTTGGCCGGG + Intergenic
1197181128 X:123538693-123538715 TTCAAACAGAATTTCTGGCCAGG - Intergenic
1197205427 X:123785520-123785542 TAAAAACATAATTGATAGCCGGG + Intergenic
1197205941 X:123790604-123790626 TTTAAACAAAAATCTTGGCCAGG - Intergenic
1197955732 X:131945601-131945623 TATATACAGAATAGTTGGTGGGG - Intergenic
1198185264 X:134248456-134248478 TGAAAACAGAATTATAGGCCGGG - Intergenic
1198968804 X:142256513-142256535 TATAAAGAATATTGTTTGCCAGG - Intergenic
1199262390 X:145790416-145790438 TATAAGAAGAATTCTTGGCCGGG - Intergenic
1200652853 Y:5863343-5863365 TAGAAAAAAAATTGTTGGCCAGG - Intergenic
1200747347 Y:6914100-6914122 AATAAAGAAAACTGTTGGCCAGG + Intronic
1200875420 Y:8149203-8149225 TAAAAAGACATTTGTTGGCCAGG - Intergenic
1200947458 Y:8859987-8860009 TAAAAACAGACTTTTTGGCCAGG + Intergenic
1201665880 Y:16453562-16453584 TATAAATAGAAAAGTTAGCCTGG - Intergenic
1201925119 Y:19276181-19276203 TTTAAACAAGATTTTTGGCCAGG + Intergenic