ID: 1087551470

View in Genome Browser
Species Human (GRCh38)
Location 11:99655799-99655821
Sequence TAGTAGTAGAATAAAGAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 257}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087551470 Original CRISPR TAGTAGTAGAATAAAGAGGT AGG Intronic
902654906 1:17860368-17860390 TAGTAGTAGACTGAAAATGTGGG - Intergenic
905161289 1:36036994-36037016 CAGTAGTAAAATAAAGAATTTGG - Intronic
906672587 1:47667330-47667352 ATGCAGTAGAATTAAGAGGTGGG + Intergenic
907084829 1:51661893-51661915 TAAGTGTAGAATAGAGAGGTAGG + Intronic
907669926 1:56465326-56465348 TAAGTGTGGAATAAAGAGGTTGG + Intergenic
907796473 1:57723039-57723061 CAGTGGTAGAGTAAAGAGCTTGG - Intronic
908525181 1:64981008-64981030 GTGTAATAGAATAAATAGGTTGG - Intergenic
909098088 1:71314874-71314896 TTGTGGCAGCATAAAGAGGTAGG - Intergenic
910352498 1:86314571-86314593 TTGTGGTATAATTAAGAGGTTGG + Intergenic
911246741 1:95526204-95526226 TTGTGGTAGAATTAAGAGATGGG + Intergenic
911587478 1:99707274-99707296 TATTAATAAAATAAAGATGTAGG + Intergenic
912977121 1:114341033-114341055 TAGTGGCAGTATTAAGAGGTGGG - Intergenic
913163947 1:116168387-116168409 GAGGAGTAGAACAAAGAGGCGGG + Intergenic
914729243 1:150356052-150356074 CATTTGTACAATAAAGAGGTAGG + Intergenic
914806285 1:150994553-150994575 TAGTAGGGGAAGAAAGAGATGGG - Intronic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
916368945 1:164067178-164067200 TAGTAGTAGCAGATAGAGGCTGG - Intergenic
917983402 1:180289567-180289589 TAGAAGTAGAATTACTAGGTTGG - Intronic
918392890 1:184084808-184084830 TTGTAGTAGTATTAACAGGTGGG - Intergenic
921588603 1:216977769-216977791 TTGTAATAGCATTAAGAGGTGGG + Intronic
922071225 1:222195495-222195517 TAGTAGAAAAATAGAGAGATGGG - Intergenic
923775799 1:236977500-236977522 TGATAGTAGTATTAAGAGGTGGG - Intergenic
923841365 1:237674956-237674978 TAGTAGTAGGATGAATAGATGGG - Intronic
924165959 1:241283715-241283737 AAGGAGGAAAATAAAGAGGTTGG - Intronic
1063467701 10:6258249-6258271 TAGTAACACAATAAAGAGTTGGG - Intergenic
1065066096 10:21966667-21966689 AAGAAGAAGAAGAAAGAGGTGGG - Intronic
1065075053 10:22070018-22070040 TTGTAATAGTATTAAGAGGTGGG + Intergenic
1065722764 10:28642498-28642520 TAGTAGAAGAAGAAAGAGGTAGG - Intergenic
1070080682 10:73183622-73183644 TAGTATCAGAATAAATAGCTCGG + Intronic
1070906335 10:80076762-80076784 GAGGAGAAGAATAAAGAGGGTGG + Intergenic
1071206963 10:83291223-83291245 TAGTCATAGAATAATGAGGTCGG - Intergenic
1073109390 10:101052017-101052039 TAGTGCTAGGATAGAGAGGTGGG - Intergenic
1074515759 10:114167611-114167633 AAGTAGTAGACTAAAGGGGAAGG + Intronic
1075322750 10:121505310-121505332 CAGTATTAAAATAAAGAAGTGGG + Intronic
1075815463 10:125261413-125261435 TAGTAGTAGATACAAAAGGTTGG - Intergenic
1078459998 11:11507449-11507471 TAGGAGGAAAAGAAAGAGGTGGG - Intronic
1079237259 11:18699475-18699497 CAGTAGTAGAATAAGGAGGATGG - Intronic
1079959083 11:26900506-26900528 AAGAAGTAGAAGAAAGAGGTAGG - Intergenic
1080224797 11:29948712-29948734 TAAAAGTATAATAAATAGGTTGG + Intergenic
1081447404 11:43144217-43144239 TAGTACTAGAAGAAGGAAGTGGG + Intergenic
1083183120 11:61000946-61000968 GAATAGGAGAAGAAAGAGGTTGG - Intronic
1083863223 11:65437546-65437568 GAAAAGTAGAATAATGAGGTAGG - Intergenic
1085561628 11:77477173-77477195 TAGAAGTGGAATAAATAAGTAGG + Intergenic
1086052299 11:82607592-82607614 TAGTGGGAGAATCAAGAGGTGGG - Intergenic
1086147367 11:83567355-83567377 TAGCAATAGAATAAAAAAGTTGG + Intronic
1086299028 11:85404404-85404426 TAATAATAGAATAGAGTGGTTGG - Intronic
1087044676 11:93834841-93834863 GTGTAATAGTATAAAGAGGTGGG + Intronic
1087236437 11:95723883-95723905 TTGTAGCAGTATTAAGAGGTGGG - Intergenic
1087333940 11:96818855-96818877 TTGAAGGATAATAAAGAGGTAGG - Intergenic
1087406842 11:97741550-97741572 TAATAATAAAAAAAAGAGGTTGG - Intergenic
1087551470 11:99655799-99655821 TAGTAGTAGAATAAAGAGGTAGG + Intronic
1087648383 11:100834665-100834687 TAGTAGTAGCTTAAAGAAGTGGG + Intronic
1089908355 11:122069369-122069391 TAAGAGTTGAATAATGAGGTGGG + Intergenic
1090631703 11:128654815-128654837 TAATAGCAGAATTAAGATGTTGG + Intergenic
1091885977 12:4017337-4017359 TAGCAGAAGAAAAGAGAGGTGGG - Intergenic
1092949042 12:13483450-13483472 TAATAGTACTATAAAAAGGTGGG + Intergenic
1093310688 12:17579213-17579235 TAGTGGTAAAATAAATAGTTTGG - Intergenic
1094559052 12:31532579-31532601 TAGTAGTGAAATAGGGAGGTGGG + Intronic
1095372074 12:41480358-41480380 TAGATATAGAACAAAGAGGTGGG - Intronic
1095746846 12:45669083-45669105 TAGTAGTCCAAGAAAGAGCTGGG - Intergenic
1097436357 12:59554756-59554778 TAGAAGTGAAAGAAAGAGGTAGG - Intergenic
1098085460 12:66837822-66837844 TAGTAACAGAATAAAGAGGAAGG + Intergenic
1099040820 12:77652373-77652395 AAGTAGTACAATAAAGAGAAAGG - Intergenic
1099280331 12:80636554-80636576 CAGTTGTAGAATAAAGGGATGGG - Intronic
1099578670 12:84412600-84412622 TAGAGTTAGAAAAAAGAGGTTGG + Intergenic
1099964372 12:89429850-89429872 TAGCAATAGAAGTAAGAGGTGGG - Intronic
1101538843 12:105645915-105645937 TTGTAATAGTATTAAGAGGTGGG - Intergenic
1102631294 12:114282886-114282908 TATTAGAAGAATAAAGCAGTGGG - Intergenic
1105782053 13:23714352-23714374 CAGGAGAAGAAAAAAGAGGTTGG - Intergenic
1106042498 13:26106562-26106584 CAGTAGTAGTAGAAAGATGTGGG - Intergenic
1108084464 13:46770915-46770937 TAGCTACAGAATAAAGAGGTAGG - Intergenic
1109684448 13:65797433-65797455 AAGTAGTCTAATAAAGAGGCAGG + Intergenic
1110394767 13:75016635-75016657 AAGTAGTAGAATAGAGAGAAAGG + Intergenic
1110873912 13:80486268-80486290 TAATAGTAAAATAAATATGTTGG + Intergenic
1113063789 13:106354200-106354222 TAGAAGAAGACTGAAGAGGTGGG + Intergenic
1113409711 13:110073879-110073901 GAGGAGTATAATAAAGAGATAGG - Intergenic
1114684398 14:24514272-24514294 TAGAAGTAGAAGAAAGGGGATGG + Intergenic
1115046103 14:28996110-28996132 TATTAGTAGATAAAAGAGATAGG - Intergenic
1117707939 14:58492462-58492484 TAGCAGTAGAACAAGGTGGTTGG - Intronic
1118050904 14:62026562-62026584 AAGTGGTAGTATTAAGAGGTGGG - Intronic
1118830266 14:69424897-69424919 TAAGAATAGTATAAAGAGGTAGG + Intronic
1119263796 14:73252855-73252877 TAGGTGTAGAACAAAGAGGTGGG + Intronic
1120155569 14:81089290-81089312 TAGTTGTATATTGAAGAGGTGGG + Intronic
1122008484 14:98726126-98726148 TACCAGTAGAAGAAAGAAGTTGG - Intergenic
1124173240 15:27396904-27396926 TTATAGGAGAAAAAAGAGGTTGG + Intronic
1124826978 15:33107038-33107060 TAGAAGGAAAATAAAGAGTTTGG - Intronic
1124856793 15:33396928-33396950 TACCAGAAAAATAAAGAGGTTGG - Intronic
1126185351 15:45825977-45825999 TTGTAATAGTATTAAGAGGTGGG + Intergenic
1127217369 15:56837936-56837958 TATTTGTAGAATAAAGAATTTGG - Intronic
1128324058 15:66712113-66712135 TAGTAGTATGACAAATAGGTTGG + Intronic
1128461645 15:67873026-67873048 TTGTAGCAGTATTAAGAGGTGGG - Intergenic
1128899351 15:71405956-71405978 TAGAAATACAATTAAGAGGTAGG + Intronic
1129106346 15:73310132-73310154 TGGTAGATGAAAAAAGAGGTTGG + Intergenic
1131236173 15:90698932-90698954 TGGAGGTAGAATAAAGATGTTGG + Intergenic
1131694630 15:94863286-94863308 CTGTAGTAGTATTAAGAGGTGGG + Intergenic
1131787438 15:95928022-95928044 TAACAGTAGTATTAAGAGGTAGG - Intergenic
1131919502 15:97308836-97308858 TTGTAATAGAATTAAGGGGTGGG + Intergenic
1131952656 15:97697522-97697544 TTGTAGCAGTATTAAGAGGTGGG + Intergenic
1132102542 15:99034804-99034826 GAGTAGGAGAAGAGAGAGGTGGG + Intergenic
1133676647 16:8079650-8079672 TAGTAGAAGAATGAAGAGATGGG + Intergenic
1135898481 16:26432451-26432473 TAGAAGTTGAATATGGAGGTCGG - Intergenic
1136252440 16:29014704-29014726 CAGAAGCAGAATAAAGAGGTGGG - Intergenic
1137869071 16:51932067-51932089 TAATAATAGAAAAAAAAGGTGGG + Intergenic
1138721481 16:59087305-59087327 CAGTAGTAGGTTAAAGGGGTAGG + Intergenic
1138786396 16:59851687-59851709 TAATAGTATAATAAAGAGGATGG - Intergenic
1139842101 16:69889921-69889943 TAATAATAGAATAAAGAGATGGG - Intronic
1141354894 16:83335987-83336009 TAGTAATAGAATATAGCTGTAGG - Intronic
1143800396 17:9374765-9374787 CATTAAAAGAATAAAGAGGTTGG + Intronic
1144031325 17:11325786-11325808 CAGTGGTACAATGAAGAGGTTGG + Intronic
1144180951 17:12752285-12752307 AAGAAGTATAAAAAAGAGGTGGG + Intronic
1145262360 17:21361970-21361992 TGGTAGAAGAAGAAAGAGGAGGG - Intergenic
1149449246 17:56737190-56737212 AAGTAGCAGAATACAGAGTTGGG - Intergenic
1156070942 18:33207922-33207944 TAGCACTAGAATATAGAGGAAGG - Intronic
1156081819 18:33344637-33344659 TAGTAGTAGAAAAAATATGGAGG - Intronic
1160305172 18:77726667-77726689 TAGTAGTAGGAAAAAGAAATGGG + Intergenic
1163227591 19:15975485-15975507 TAGAAGCAGGATAAAGAGGTGGG + Intergenic
1164263220 19:23587439-23587461 TTGTAATAGAATTAAAAGGTGGG - Intronic
1167164688 19:47790578-47790600 GAGTAGCAGAAGGAAGAGGTGGG + Intergenic
926831731 2:16970757-16970779 TTGTAATAGTATTAAGAGGTGGG + Intergenic
927119017 2:19936597-19936619 TTGTGGTAGTATTAAGAGGTGGG + Intronic
928612685 2:33005905-33005927 GAGTAGCAGCATAAAGTGGTAGG + Intronic
928893293 2:36232444-36232466 GAATAATGGAATAAAGAGGTAGG - Intergenic
929853269 2:45612370-45612392 TTGTAATAGTATGAAGAGGTGGG - Intergenic
930376541 2:50574243-50574265 TAGAAGTAGAATAAATTGGTGGG + Intronic
931485563 2:62687407-62687429 TAGTAGTACAAAAGAGATGTAGG + Intronic
931615844 2:64156820-64156842 TAGTAGTAGAGGTTAGAGGTTGG - Intergenic
931937794 2:67217385-67217407 TTGTAATAGTATGAAGAGGTGGG + Intergenic
931969394 2:67568911-67568933 AAGGAGTTGAGTAAAGAGGTTGG - Intergenic
932518356 2:72378697-72378719 AAGTAGTAAAATAAAAATGTGGG + Intronic
933355465 2:81205004-81205026 TAGTAGTAGATAAAGTAGGTAGG + Intergenic
936817192 2:116473699-116473721 TAGCAGAAGAATCTAGAGGTTGG - Intergenic
937383065 2:121399148-121399170 ATGTAGTAAAATAAAGAAGTAGG + Intronic
938998161 2:136702611-136702633 CAATTGTGGAATAAAGAGGTAGG - Intergenic
939988429 2:148855013-148855035 TTGTAGTGGTATTAAGAGGTGGG + Intergenic
940149154 2:150579767-150579789 TGGAAGCAGAAGAAAGAGGTGGG + Intergenic
940702730 2:157066075-157066097 TAGTGGTAGAATGGAGAGGTTGG + Intergenic
941178014 2:162223402-162223424 TATTAGTCAAATAAAGAGGTGGG + Intronic
942513064 2:176723169-176723191 AAGTAATAGTATTAAGAGGTGGG + Intergenic
942638203 2:178032315-178032337 TAGTATTAAAATTAAGAGCTTGG + Intronic
943361689 2:186926987-186927009 TAGTGGAATAATGAAGAGGTTGG + Intergenic
943631350 2:190256022-190256044 TAGTAGGAGAAAAAAGAGTGAGG + Intronic
944223562 2:197326519-197326541 TTGTAGTGGTATTAAGAGGTGGG + Intergenic
944840719 2:203621287-203621309 AAGTAATAGTATTAAGAGGTAGG + Intergenic
944925469 2:204459429-204459451 TACCAGTAGAATAAAGAAATTGG + Intergenic
945407877 2:209471656-209471678 TAATAAAAGAATAAAGAGGAAGG + Intronic
947328604 2:229004558-229004580 TAGTATGAAAATAAAGAGCTGGG + Intronic
948823508 2:240562380-240562402 TAGTAATAGAAAAAGGAGGCTGG - Exonic
1169826044 20:9769909-9769931 TAGTAGAAGAATATAGAACTAGG + Intronic
1171027652 20:21646370-21646392 TATTATTAGAATAAAAAAGTTGG + Intergenic
1172210237 20:33192608-33192630 AAGTAGTGGTATTAAGAGGTGGG - Intergenic
1175013947 20:55768306-55768328 TTGTAAAAGAATAAACAGGTCGG + Intergenic
1175509412 20:59513410-59513432 TAGCAGTAGAATCACGGGGTGGG + Intergenic
1177916279 21:27091730-27091752 TAGTAGAGGAAAAGAGAGGTAGG - Intergenic
1178175396 21:30091772-30091794 TATTAGTATAATAAATAGGTTGG - Intergenic
1179810527 21:43866280-43866302 TCTTAGTAGAAGAAAGATGTGGG + Intronic
1182935051 22:34213264-34213286 TAGTAATAGAATAAATAGATAGG - Intergenic
951743808 3:25954347-25954369 GAATGGGAGAATAAAGAGGTTGG + Intergenic
954725298 3:52603516-52603538 GAGAAGAAGAAAAAAGAGGTTGG - Exonic
956307826 3:67845822-67845844 TAGAAGAATAATAAAGAGTTTGG - Intergenic
957221488 3:77388492-77388514 AAGTAGAGAAATAAAGAGGTGGG - Intronic
957631818 3:82725459-82725481 TAGCAGTAGTATAAATATGTTGG + Intergenic
957934518 3:86925452-86925474 AAGTTGTAGAATAATGAGCTTGG - Intergenic
958999094 3:100940654-100940676 TAATAGCAGAATTAAGAGGCAGG - Intronic
959287541 3:104435574-104435596 TTGTAGTGGCATTAAGAGGTGGG - Intergenic
959341114 3:105133029-105133051 TAGTAGAAAATTAAAGAGGAGGG + Intergenic
959912741 3:111782169-111782191 TAATAGTAGAATCTAGAGATGGG + Intronic
960376260 3:116905468-116905490 GAGTAGTAGTATAATGAGGGTGG + Intronic
960431879 3:117579553-117579575 AAGGAGAAGAAGAAAGAGGTCGG + Intergenic
961339298 3:126206655-126206677 TAGTAAGAGAATAAAGTGGCTGG - Intergenic
962956839 3:140274490-140274512 CAGTAATAGAACAAAAAGGTAGG + Intronic
963393878 3:144706575-144706597 TAGGAGTATAGAAAAGAGGTTGG - Intergenic
964333712 3:155632734-155632756 TATTAGTAAACTAAAGAGGATGG + Intronic
966679514 3:182626552-182626574 AAGTAGTAGAAAAAGCAGGTGGG - Intergenic
967498726 3:190172368-190172390 TATTGGTAGAATCAAGAAGTGGG - Intergenic
967622976 3:191656708-191656730 TCGTTGTTGAATATAGAGGTTGG - Intergenic
970680482 4:18501639-18501661 TAGTTGTTGAATAAATAGCTGGG - Intergenic
970982698 4:22120345-22120367 TAGTAGAAGAATAAATAGAATGG + Intergenic
971087132 4:23292000-23292022 TCCTAGTAGAAAAAAGACGTAGG + Intergenic
972827384 4:42775634-42775656 TGGCAGTAGGAGAAAGAGGTGGG + Intergenic
974616834 4:64297172-64297194 TAGTAGTAGAAAAAACAAGAGGG + Intronic
974837309 4:67266393-67266415 TTGTAGTTGTATTAAGAGGTGGG - Intergenic
975369752 4:73571039-73571061 TTTTAGTAGAAGAAATAGGTAGG - Intergenic
976325025 4:83761810-83761832 TAGTAGGACAATAATAAGGTAGG + Intergenic
976391890 4:84514230-84514252 TAGTAGTATAATAATGACTTAGG + Intergenic
977827413 4:101550206-101550228 TTGTAGCAGAATTAAAAGGTGGG + Intronic
978353187 4:107841989-107842011 GAGAAGCAGAATAAAGATGTTGG + Intronic
982213552 4:153060493-153060515 TAGTAGAAAAATAATGAGGCCGG + Intergenic
984189552 4:176589019-176589041 TAGTAGAAGGAGAAAGAGGAAGG + Intergenic
984538936 4:181013085-181013107 CAGAAGGAGAATAAAGAGGATGG + Intergenic
984545909 4:181102447-181102469 GACTAGTAGAATAAAGAGGAAGG + Intergenic
984756182 4:183327751-183327773 TAATAGTAAAATAATGAGGAAGG + Intergenic
985981491 5:3470170-3470192 TTGTACTAGTCTAAAGAGGTGGG - Intergenic
986093213 5:4531598-4531620 TAATAATAAAAAAAAGAGGTGGG + Intergenic
987799261 5:22672370-22672392 TTGTAATAGTATTAAGAGGTAGG + Intronic
988721434 5:33883044-33883066 CACTAGGAGAATAAAGAGGAAGG - Intronic
988896171 5:35677040-35677062 TAGCAGTGAAATAAAGAGGGTGG + Intronic
988980986 5:36569113-36569135 TAGAAGTAAATTAAGGAGGTGGG - Intergenic
991268738 5:64754046-64754068 TAGTAGTAGATTAAGGAGTTTGG - Intronic
991407332 5:66313152-66313174 TAATAGTAGAATTATGAGGAAGG - Intergenic
992159781 5:73990006-73990028 GAGTAGTAAAATAAAGAGTCAGG + Intergenic
992531240 5:77653585-77653607 TAGTGGTGGAATAAAGAAGTAGG + Intergenic
992952584 5:81874999-81875021 TAGTACTTAAATAAAGAGGGTGG + Intergenic
993016352 5:82539038-82539060 TAGTTGTGGAATAATAAGGTAGG + Intergenic
993031299 5:82708880-82708902 CAGAAGTACAATCAAGAGGTCGG - Intergenic
993464471 5:88228147-88228169 TAGTTGTAGGATAAAGATATGGG + Intronic
993591137 5:89796474-89796496 TTGTAGCAGCATTAAGAGGTGGG + Intergenic
996490314 5:124087005-124087027 TAGTGGTAGAGGAAAGTGGTTGG - Intergenic
996572351 5:124945766-124945788 TAGTAACAGTATTAAGAGGTAGG + Intergenic
997753151 5:136369462-136369484 TTGTAATAGTATTAAGAGGTGGG + Intronic
998713907 5:144858993-144859015 TATCAGAAGAATAAAGAGGTTGG - Intergenic
1000444352 5:161301587-161301609 TAGTAGTTGAAACAAGAGGGAGG + Intronic
1003034147 6:2628463-2628485 GAGTAGTAGGAGGAAGAGGTGGG + Intronic
1004118347 6:12793633-12793655 TAGTGGTAGAATTTAGTGGTGGG + Intronic
1004296668 6:14418235-14418257 TTGTAGCAGTATTAAGAGGTGGG + Intergenic
1006105853 6:31715823-31715845 TTTTAGGAGAATAAGGAGGTGGG - Intronic
1006122029 6:31813117-31813139 TAGAGATAGAAAAAAGAGGTCGG - Intronic
1007386271 6:41522315-41522337 TAGAGGTAGAACAGAGAGGTGGG + Intergenic
1008142066 6:47843507-47843529 AGGTGGTAGAATTAAGAGGTGGG - Intergenic
1009651001 6:66478479-66478501 TAGTAGTGGAATAGAGAAGCAGG - Intergenic
1009798218 6:68499574-68499596 CAGAAATAGAATAAAGAGGAAGG - Intergenic
1010255214 6:73749473-73749495 TAGTAGTTGAAGAGAAAGGTGGG + Intronic
1010880879 6:81169564-81169586 GAATAATAGAATAAAGGGGTGGG + Intergenic
1010987084 6:82437181-82437203 AATTAGTAGAATAAGTAGGTGGG - Intergenic
1012060395 6:94471340-94471362 TAGTACTAGAATAAGGAGGAGGG - Intergenic
1015282341 6:131447052-131447074 TTGTGGTCGAATTAAGAGGTGGG - Intergenic
1016348147 6:143138591-143138613 TAGTAATACAATAAAAAAGTAGG + Intronic
1016716560 6:147238721-147238743 TAGTAGTAGAATTATGATCTGGG + Intronic
1019795755 7:3047074-3047096 TAGTTGTAGAATCAAGTGGTGGG - Intergenic
1019832129 7:3341979-3342001 TAGTAAAAGAATAAAGCAGTTGG + Intronic
1020053195 7:5097001-5097023 TGGAAGTAGAATAATGAGGCGGG - Intergenic
1020390500 7:7652595-7652617 GAGAAGTAGGATAAAGAGGCAGG + Intronic
1026131911 7:67627973-67627995 TACTAGTAGTGTAAAGATGTAGG - Intergenic
1026151807 7:67794236-67794258 TAATAGCAAAATAAAGGGGTTGG - Intergenic
1028021226 7:85776418-85776440 TAGAAGTAGAGCAAAGAGGGTGG - Intergenic
1028210194 7:88064443-88064465 CAGGAGTAGACTAAAGTGGTAGG - Intronic
1032627705 7:133610469-133610491 CAGTATTAAAATAAACAGGTTGG - Intronic
1032788584 7:135222660-135222682 CACTAGTAGCAAAAAGAGGTGGG + Intergenic
1034579388 7:152029309-152029331 TGGTAGTAGGATAATGAAGTAGG + Intronic
1037165260 8:15820118-15820140 TATTAACAGAATAAAGAAGTGGG - Intergenic
1038559786 8:28563646-28563668 TAGCAGTGGAATAAAGAGATGGG + Exonic
1038934590 8:32234724-32234746 TAGTTGTGAAATAAACAGGTTGG + Intronic
1040839175 8:51766123-51766145 TAGTAAAAGAATAAACAGCTCGG - Intronic
1040894931 8:52356004-52356026 AAGTAGTGGAAGAAAAAGGTTGG + Intronic
1042380401 8:68106777-68106799 TACTAGTAGAGTAAATAGATAGG + Intronic
1043480295 8:80645906-80645928 TTGTAATAGTATTAAGAGGTGGG + Intronic
1043779898 8:84319190-84319212 TAGTCATAGAATAAATAGCTTGG + Intronic
1044180491 8:89187758-89187780 TTGTGGTAGTATTAAGAGGTGGG + Intergenic
1044385927 8:91588227-91588249 TGGTAGTAGGAAAGAGAGGTAGG - Intergenic
1046361794 8:113169033-113169055 TAGTTGGAGAAGAAAGAAGTAGG - Intronic
1047419807 8:124697993-124698015 TAGTTGTAGAACAAAGTGCTAGG - Intronic
1048257870 8:132919100-132919122 TAGGGGTAAAATAAAGAGGGGGG - Intronic
1049993630 9:1013420-1013442 TTGAAGTAAAAGAAAGAGGTGGG + Intergenic
1050516098 9:6445857-6445879 TATTATTAGAAGAAAGAGCTAGG - Intronic
1050708917 9:8437548-8437570 TAGTAGCAGATTGTAGAGGTTGG + Intronic
1051394108 9:16600758-16600780 TAGAAGTAATATAAAGAGCTAGG + Intronic
1051662715 9:19440796-19440818 TAATAGTAGAGTTAAGAGGAAGG - Intronic
1052490338 9:29158983-29159005 TAGGAGGAAAATAAAGAGTTAGG - Intergenic
1052748450 9:32464362-32464384 TAGTAAAAGTATAACGAGGTAGG - Intronic
1056679403 9:88704161-88704183 TAGTATTAGTTTAGAGAGGTGGG + Intergenic
1056818185 9:89816895-89816917 TCGTAGTAGAAGAAAGAAGCTGG - Intergenic
1057362303 9:94384771-94384793 TTGTAATAGTATTAAGAGGTGGG + Intronic
1057661038 9:97003332-97003354 TTGTAATAGTATTAAGAGGTGGG - Intronic
1057975442 9:99601418-99601440 TAGTCCTAGAATCAAGAGTTAGG - Intergenic
1058092548 9:100821822-100821844 TATTAGTAGATAAAATAGGTGGG - Intergenic
1060143850 9:121234260-121234282 AAGTAGTAGAATTTAGAGCTGGG - Intronic
1060324467 9:122599493-122599515 AATCAGTAGAATAAAGAAGTTGG - Intergenic
1060690087 9:125650086-125650108 TAGTAGTAGGCAAAAGTGGTAGG - Intronic
1061438937 9:130586153-130586175 TGGTATTAGAATAAAAATGTAGG - Intronic
1185658874 X:1710037-1710059 TATTAGTATAATAAAGATATAGG + Intergenic
1185982633 X:4796450-4796472 AAGTAGTTGAATAATGGGGTGGG + Intergenic
1187124522 X:16441883-16441905 TATTAGAAGGCTAAAGAGGTAGG - Intergenic
1189556365 X:42149546-42149568 TAGTAGGAGAAAAAAGGGTTGGG - Intergenic
1193058357 X:77178218-77178240 TACTTGTACAATGAAGAGGTTGG - Intergenic
1193653074 X:84163217-84163239 TAGTAGCAGAATCAAGACTTAGG - Intronic
1193851804 X:86546312-86546334 AAGAAGAAGAAGAAAGAGGTAGG - Intronic
1193906397 X:87250418-87250440 AAGTAGTAGAAAAAAAAGATTGG - Intergenic
1193977212 X:88136268-88136290 TGGTAGGAGGAAAAAGAGGTAGG + Intergenic
1194004267 X:88470987-88471009 TAATAGTAGAATATTGAGGCTGG + Intergenic
1194037171 X:88889543-88889565 TAGTAGTTGAACAATGAAGTTGG - Intergenic
1195114521 X:101683399-101683421 TAGTTGTAGAGTAATGTGGTTGG + Intergenic
1196761084 X:119201530-119201552 TAGCAGAAGAACAAAGAGGAAGG - Intergenic
1198049595 X:132937864-132937886 TATCAATAGAATAAAGAGGTAGG + Intronic
1198999846 X:142622403-142622425 TAATATTGGAATGAAGAGGTTGG - Intergenic
1199887671 X:152037457-152037479 TAGTACTAGAATAAAATGGCTGG - Intergenic