ID: 1087553452

View in Genome Browser
Species Human (GRCh38)
Location 11:99682619-99682641
Sequence GTTCAACCTATTACACAGAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 112}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087553452_1087553454 10 Left 1087553452 11:99682619-99682641 CCGTTCTGTGTAATAGGTTGAAC 0: 1
1: 0
2: 1
3: 9
4: 112
Right 1087553454 11:99682652-99682674 CAATAAAAAGATTTTAAAATTGG 0: 1
1: 1
2: 22
3: 263
4: 2045

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087553452 Original CRISPR GTTCAACCTATTACACAGAA CGG (reversed) Intronic
901846038 1:11982886-11982908 TTAAAAGCTATTACACAGAAGGG + Intronic
903095229 1:20965850-20965872 GTAAAACCTATCACACAGAGAGG - Intronic
904459320 1:30666262-30666284 GTTCAAGCTCTGACACTGAATGG - Intergenic
907666155 1:56435417-56435439 GTTAAACATATTACATACAAGGG + Intergenic
908161083 1:61409268-61409290 GTTCTACCGATGACACAGAAAGG + Intronic
909909187 1:81240543-81240565 GTTCAGTGTATAACACAGAAGGG + Intergenic
915806541 1:158859361-158859383 GTACAAGCTATTACACAGGTGGG + Intergenic
915830390 1:159123904-159123926 ATTCACTCTATTACACAGCAGGG + Intronic
923295571 1:232591531-232591553 GTTTAACCTTTAACCCAGAATGG + Intergenic
923543089 1:234903538-234903560 TCTCAACCTTTTACACAAAATGG + Intergenic
924036135 1:239940405-239940427 GTTCAAACTGCTACAGAGAAAGG - Intergenic
924701374 1:246456905-246456927 ATTCCACCTAGTACACCGAATGG + Intronic
1064832439 10:19485444-19485466 TTTCACCCTATTAGCCAGAATGG - Intronic
1079749537 11:24179821-24179843 TTTCAACTTATTACAAAAAAAGG + Intergenic
1080383193 11:31795493-31795515 GTGCAACACATTACAAAGAATGG - Intronic
1080853729 11:36093661-36093683 GTACAACCTATAACACAGGTGGG - Intronic
1081035668 11:38142287-38142309 GTTCAGTCTACTGCACAGAATGG + Intergenic
1083346154 11:61994083-61994105 ATTCAACCCATTACACAGTTAGG + Intergenic
1083476262 11:62917536-62917558 GTTCACCCCATTCCACAGAAGGG - Intronic
1087553452 11:99682619-99682641 GTTCAACCTATTACACAGAACGG - Intronic
1090529169 11:127572347-127572369 ATTCTACCTATTACTGAGAATGG - Intergenic
1090883227 11:130853018-130853040 GTTCAAACTATTTCACAAGATGG + Intergenic
1090950445 11:131468259-131468281 AATCAACCCATTACACAGCATGG - Intronic
1091634753 12:2188532-2188554 GTTGAACCTATTGCACCTAATGG + Intronic
1092160540 12:6313105-6313127 CTTCAGCCTTTCACACAGAAGGG + Intronic
1093707738 12:22293793-22293815 GTACAACTTATTATTCAGAAAGG - Intronic
1094151742 12:27292247-27292269 GATCAAATTATTACAAAGAATGG - Intronic
1094640009 12:32264936-32264958 GTGCGACCTTGTACACAGAAAGG + Intronic
1107065247 13:36207674-36207696 GTGCAACCTATTATCCAGATGGG - Intronic
1107306750 13:39029801-39029823 GTTAAACATATTACAAAAAAAGG + Intronic
1108221896 13:48243387-48243409 GTTCAACAAATTACAAAGGATGG - Intronic
1109607406 13:64714462-64714484 TTTCACCCTATTAGACAGGATGG + Intergenic
1109831751 13:67799885-67799907 GTTCAATCTAAGACACAGATAGG - Intergenic
1111009973 13:82300383-82300405 GTTTAAAATATTACACAGAAAGG + Intergenic
1112652921 13:101418025-101418047 GTTCAACCAAGGACAGAGAAAGG - Intergenic
1116397478 14:44463855-44463877 TTTCAACATACTACTCAGAATGG + Intergenic
1118426689 14:65672411-65672433 CTTCAAACTATTAAACATAAAGG - Intronic
1120306496 14:82777721-82777743 GTACAGCCTATTACACACATAGG - Intergenic
1121414806 14:93772025-93772047 ATACCACCTATTACAAAGAAGGG + Intronic
1121865111 14:97355684-97355706 ATTCAACCCATTACACATAGTGG - Intergenic
1122080078 14:99261040-99261062 GTTCACCCGATTCCAAAGAACGG + Intronic
1123958870 15:25372637-25372659 TTTCATCCTATTAGCCAGAAGGG - Intronic
1125776974 15:42224747-42224769 GTTAAACCTGTTACACTGGAAGG + Intronic
1126320156 15:47413343-47413365 ATTTAACCTATTAAACAAAACGG - Intronic
1130628742 15:85543455-85543477 GTTCAACCAATTTCACAGGCAGG - Intronic
1133776435 16:8899182-8899204 TTGCAACCTAAGACACAGAAAGG + Exonic
1146462330 17:33056068-33056090 GTCCAACCTATTTGACAGAAGGG + Intronic
1147505282 17:41010162-41010184 GTTCAACCTGTGGCCCAGAAAGG + Intronic
1149020404 17:51956936-51956958 GTTCATGCTATTATACAGAATGG + Intronic
1149562156 17:57615954-57615976 ATTCTACCTGTTAAACAGAAAGG - Exonic
1154280545 18:12998194-12998216 AATCAACCTATTATACAGGAAGG - Intronic
1155425949 18:25707676-25707698 CTTCAACACATTTCACAGAAAGG - Intergenic
1157886395 18:51370877-51370899 GTTGACAATATTACACAGAAAGG - Intergenic
1158587449 18:58754031-58754053 TTTAAACCTAGCACACAGAAAGG - Intergenic
1163587659 19:18172904-18172926 CTTCTCCCCATTACACAGAAGGG + Intronic
1166509907 19:43398948-43398970 ATTCAATCTATAAAACAGAATGG - Intergenic
929156590 2:38793890-38793912 GTTCAAACCATTGCCCAGAAAGG - Intergenic
929978323 2:46656052-46656074 GTTCAAACTATTGCCCAGAGAGG - Intergenic
930520646 2:52462404-52462426 GTTAAAACTAATACAAAGAAAGG - Intergenic
930780623 2:55222085-55222107 GTTCATCCAATTTCTCAGAAAGG - Intronic
932065877 2:68559437-68559459 GATCTACCTATTACACAAAGTGG - Intronic
932192287 2:69751209-69751231 TTTTAACCTATTACACAGAGTGG - Intronic
940336754 2:152537002-152537024 TTTCAAACCTTTACACAGAAAGG + Intronic
940364893 2:152837343-152837365 TTTCAAATCATTACACAGAAAGG - Intergenic
941131638 2:161658337-161658359 GTGGAACCTATTAAACAGCAAGG - Intronic
942978559 2:182049551-182049573 ATTCAACTTATTACACAGAGGGG + Intronic
946558168 2:220882794-220882816 GTTCTTCCTCTGACACAGAAAGG - Intergenic
947568906 2:231215542-231215564 ATTCAACCTATCACTCAAAAGGG - Intronic
1172533687 20:35653797-35653819 GTTCATCCAATTACTAAGAAAGG - Exonic
1173826963 20:46054128-46054150 GTACAGCCTACTACACACAAAGG + Intronic
1174298705 20:49567539-49567561 CCTCAACCCATTACACAGATGGG - Intronic
1177856900 21:26409864-26409886 TTTGAAGCGATTACACAGAAAGG - Intergenic
1178829326 21:36042003-36042025 GTTCCACCTAATTCACACAAAGG + Intronic
1184378722 22:44131757-44131779 GTTCTACCTCTTACAGAGCAGGG - Intronic
951283956 3:20786734-20786756 GTTTAGCCTATTACACAGCTAGG - Intergenic
951375119 3:21905045-21905067 GTTCAACTTCTTACAGTGAAAGG - Intronic
955689554 3:61577940-61577962 GTTAAACCCATTTCACAGATGGG - Intronic
959157727 3:102686906-102686928 ACTCCACCTATTACACAGCAAGG - Intergenic
959876308 3:111386345-111386367 GTTTAACCTGTTACACAGCTTGG + Intronic
960254451 3:115497291-115497313 GTTCTAGCTACTACAAAGAAAGG - Intergenic
970030978 4:11674361-11674383 ATTTAACCTATAATACAGAATGG - Intergenic
970914650 4:21318933-21318955 GTTCAACCTTTTTAACAGGAGGG - Intronic
975721040 4:77248779-77248801 GTTCATACTTTTACATAGAAAGG + Intronic
982201702 4:152967876-152967898 GTTCAACCTTGGAAACAGAAGGG - Intronic
983353323 4:166622664-166622686 GTTCATCTTACTACTCAGAATGG + Intergenic
984396105 4:179201738-179201760 TTTCACCATACTACACAGAATGG + Intergenic
984568317 4:181358508-181358530 GTTCAACCCATGACACAATATGG - Intergenic
984725764 4:183019063-183019085 GTTCAACCTACTACACACCTAGG + Intergenic
984893224 4:184512119-184512141 ATTCAACCTCTTGCACAGAGTGG - Intergenic
986490980 5:8290068-8290090 CTTGAAGATATTACACAGAAAGG - Intergenic
987979664 5:25066143-25066165 CTTCAGCCCATTACACATAATGG + Intergenic
988181823 5:27805403-27805425 ATTCAACTTAGTTCACAGAAAGG + Intergenic
988916178 5:35895514-35895536 GTTCAACCTATTAGGAGGAAAGG - Intergenic
990560425 5:56978360-56978382 TTTCAACCTATTCCACAAACTGG + Intergenic
991540422 5:67721432-67721454 GTTCAAACTATTACACAAAAGGG + Intergenic
993359903 5:86961628-86961650 TATCAACCAATTACACATAATGG - Intergenic
994356009 5:98794421-98794443 GTTCAACCTAATACACTGTATGG - Exonic
995402933 5:111761831-111761853 GTTCAACCAATCAGACCGAAGGG + Intronic
996061527 5:119038548-119038570 GTTCAACAAATTATACTGAATGG + Intronic
996664633 5:126044564-126044586 GTGCATCCTATTAAACAGAAAGG + Intergenic
1000489736 5:161896475-161896497 TTAGAACCTATTACACAGTATGG + Intronic
1005777176 6:29146848-29146870 GATCAACCTGAAACACAGAAAGG - Intergenic
1006712956 6:36091462-36091484 GCTAAACCTATTACAAAGGATGG + Intronic
1010134138 6:72530439-72530461 ATTCAACCAATTATACTGAAAGG - Intergenic
1014899910 6:126950268-126950290 GTTCAATCTAATAAAAAGAAGGG - Intergenic
1019869158 7:3742672-3742694 GTTAAAAGTTTTACACAGAAAGG - Intronic
1019948581 7:4350670-4350692 TTTCACCCTATTACCCAGGATGG - Intergenic
1028334935 7:89640180-89640202 ATTCAACCTATTCAACTGAAGGG - Intergenic
1028785854 7:94792921-94792943 GTTCTACCAATTACTGAGAAGGG - Intergenic
1030853430 7:114519730-114519752 ATTAAACCTATTCCATAGAAGGG - Intronic
1032974610 7:137208236-137208258 CTTCAGACTATGACACAGAATGG + Intergenic
1036742582 8:11377760-11377782 GTTCTTCCTATTTGACAGAATGG - Intergenic
1040815428 8:51503205-51503227 CTTCAATCTAATACACAGTAGGG + Intronic
1041443673 8:57926923-57926945 GTGCAATCTATTTCAAAGAAAGG + Intergenic
1042444834 8:68871797-68871819 CTTCTACGTTTTACACAGAAGGG - Intergenic
1043692144 8:83168130-83168152 TTTCAAGCTTTAACACAGAAGGG - Intergenic
1045985572 8:108246156-108246178 TTTCATCCTACTACCCAGAAGGG + Intronic
1052285418 9:26779206-26779228 TTTCATCATATTACTCAGAACGG - Intergenic
1052556322 9:30022757-30022779 TTTCAACATACTACTCAGAATGG - Intergenic
1058607990 9:106743912-106743934 GTACCACCTATTTCAAAGAATGG + Intergenic
1060679518 9:125549088-125549110 GTTGAACCTTTTCCACAGATTGG - Intronic
1195763051 X:108267664-108267686 TTTCAACCTAAAACACACAAAGG + Intronic
1200834451 Y:7719247-7719269 GTTCAACCAATTCCAGATAAAGG + Intergenic