ID: 1087554546

View in Genome Browser
Species Human (GRCh38)
Location 11:99699037-99699059
Sequence TGGTTAATAAAGGTAGATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 141}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087554541_1087554546 16 Left 1087554541 11:99698998-99699020 CCTGAATAAATGCAAAGAGAAGT 0: 1
1: 0
2: 0
3: 40
4: 421
Right 1087554546 11:99699037-99699059 TGGTTAATAAAGGTAGATCATGG 0: 1
1: 0
2: 1
3: 16
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087554546 Original CRISPR TGGTTAATAAAGGTAGATCA TGG Intronic
902862259 1:19254877-19254899 TGGTTTATAAAGGTAGGTATAGG + Intronic
903457468 1:23497657-23497679 TGGTTAAAATATGTAGAACAGGG - Intergenic
904019179 1:27449295-27449317 TGGTCAATAAATGTTTATCAAGG + Intronic
904114418 1:28151082-28151104 TGGTTAATAAAGGGACAAGAAGG + Intronic
906682383 1:47737737-47737759 TGGTTACTACAGGTAGAGAAGGG - Intergenic
909191290 1:72555869-72555891 TGGACAATAAATGAAGATCAAGG - Intergenic
914867204 1:151441294-151441316 TGGTTAATTAAGTTACATCACGG + Intronic
917353607 1:174103661-174103683 TAGCTGATAAAGGTGGATCAGGG + Intergenic
919309228 1:195886087-195886109 TGGTTAATAAAAGTTGAATATGG - Intergenic
923954962 1:239006014-239006036 TGGTTAAAGGAGGTAGAGCAAGG - Intergenic
924160692 1:241228646-241228668 CAGTTAATAAAGGCAGATCCAGG + Intronic
1063864475 10:10349430-10349452 TGCTTACTGATGGTAGATCATGG - Intergenic
1064534504 10:16344845-16344867 TGGATAATGAAGGTAAGTCAAGG + Intergenic
1065761804 10:28989646-28989668 TGCTCAATAAAGGCATATCAGGG + Intergenic
1065790034 10:29252292-29252314 TGGTGAATCAAGTGAGATCACGG - Intergenic
1069085220 10:64130843-64130865 AGGGTAATAAAGGTAGAATATGG + Intergenic
1071260314 10:83913452-83913474 TGGTTAATACAGGTAAAGCATGG + Intergenic
1071595246 10:86917493-86917515 TGGTTAGTAAAGAAAGATCTTGG - Intronic
1074436091 10:113435673-113435695 TAGATTATAAAGCTAGATCATGG + Intergenic
1077911391 11:6574257-6574279 TAGTTAATAAAGGAACAGCAGGG - Intronic
1079445690 11:20554497-20554519 TGGGTCTTAAAGGTAGATGAAGG - Intergenic
1079746304 11:24135812-24135834 TAGTAAATAAAAGTAGATGAAGG - Intergenic
1081062389 11:38496268-38496290 TGTTCAAAAAAGGTAGAACAGGG + Intergenic
1082960148 11:58912181-58912203 TGGTAAATGAAGGTACAGCAGGG + Intronic
1085370409 11:75998647-75998669 TGATTACTAATGGTAGAGCATGG + Intronic
1086727692 11:90209071-90209093 AGGGTAATAGAGGAAGATCAAGG - Intronic
1087203952 11:95374562-95374584 TGCTCAATAAAGGCAGATCTGGG - Intergenic
1087554546 11:99699037-99699059 TGGTTAATAAAGGTAGATCATGG + Intronic
1089324528 11:117648109-117648131 TGGTGGAGAAAGGGAGATCAAGG - Intronic
1091925907 12:4348752-4348774 TTTTTAAAAAAGGCAGATCATGG + Intronic
1094072607 12:26434541-26434563 TGGTCAAGAAAGGGATATCATGG + Intronic
1094583235 12:31753906-31753928 TGGTTAAAGAAAGAAGATCAGGG + Intergenic
1095588726 12:43879083-43879105 TTTTTAATATAGGTAGATAATGG + Intronic
1097590056 12:61563461-61563483 TGCTTAAGAATGGTAGACCAAGG + Intergenic
1097767394 12:63541973-63541995 TGGTTAATAGAGGCAGATGAAGG - Intergenic
1097783766 12:63737016-63737038 TGGTTAATAGAGGCAGATGAAGG - Intergenic
1098555213 12:71811082-71811104 AGGTTTATCAAGCTAGATCATGG + Intergenic
1099857987 12:88192888-88192910 TGGGTAATAAAGTTAAATTAAGG - Intronic
1100093037 12:90995112-90995134 TAGATAATTAATGTAGATCACGG - Intronic
1101144048 12:101824125-101824147 TGGTTAACAAGGGTATAACAAGG + Intronic
1103359524 12:120345665-120345687 TGGGAAATAGAGGAAGATCAGGG + Intronic
1103381067 12:120495145-120495167 TGGTTAAAAAAGCAAGATCTTGG - Intronic
1108360049 13:49660926-49660948 TGGTTCATGAAGTTAGATAATGG + Exonic
1108992890 13:56685534-56685556 TGCTTGATAAACATAGATCAAGG + Intergenic
1109368108 13:61384247-61384269 TAGTTAATAAAGAGTGATCAAGG + Intergenic
1109368130 13:61384580-61384602 TAGTTAATAAAGAGTGATCAAGG + Intergenic
1109757835 13:66784875-66784897 TAGTTTATAAAGTAAGATCAGGG - Intronic
1111353698 13:87068545-87068567 TGGTAAAAAAAGATACATCAAGG + Intergenic
1111543052 13:89693618-89693640 TGGTTTATAAGAGTAGGTCAGGG + Intergenic
1111807856 13:93060110-93060132 TGGATATTAAAGGTAAATAATGG + Intergenic
1114943222 14:27642871-27642893 TAGTTAATAAAGGTGTAGCAGGG - Intergenic
1114990949 14:28288878-28288900 TGTTTTATAGAGGTAAATCATGG + Intergenic
1119015402 14:71047244-71047266 TGTTTAAAAAAGGTAAGTCAAGG - Intronic
1120279829 14:82425031-82425053 TGGTGAATAAAGGTACAAAACGG + Intergenic
1123668686 15:22630584-22630606 TGGTTAATACAAGTAAAGCAGGG - Intergenic
1124417175 15:29481711-29481733 TGATTTATAGAGGAAGATCAAGG - Intronic
1124524663 15:30437061-30437083 TGGTTAATACAAGTAAAGCAGGG - Intergenic
1124773990 15:32570651-32570673 TGGTTAATACAAGTAAAGCAGGG + Intergenic
1126834199 15:52642966-52642988 AGGTTAAAAAAGGTAGATAGGGG - Intronic
1137343400 16:47632440-47632462 TAGTTAATAATTGTATATCATGG - Intronic
1138724895 16:59125190-59125212 AGGTTAAAAAAGTGAGATCAGGG + Intergenic
1141398153 16:83723023-83723045 TGCTTAATAAAGGGAGTACATGG + Intronic
1142768980 17:2083049-2083071 TGGCTAGTAAAGGCAGAACAGGG + Intronic
1145065198 17:19757319-19757341 TGGATAATAAAGGTTGGACAAGG - Intergenic
1153706575 18:7751434-7751456 TGGTCAATAAAGGCAGATTATGG - Intronic
1157188140 18:45558080-45558102 TGGAGAAGAAAGGTAGATGAAGG - Intronic
1157389535 18:47289548-47289570 TGTTTTATAATGGTAGATCAGGG + Intergenic
1168543166 19:57229844-57229866 TGGTTACAATAGGTGGATCAGGG - Intergenic
1168604183 19:57745036-57745058 TGGTTAATCAAGGTAGCACTTGG + Intronic
926880811 2:17541658-17541680 GGGTTAAAAAATGTAAATCAAGG + Exonic
927019893 2:19005644-19005666 TGGTTAACTAATGTAGGTCATGG - Intergenic
928279298 2:29930055-29930077 TGGAAAATAAAGTTACATCAAGG + Intergenic
928775368 2:34754815-34754837 TGTTTAACAGAGGTACATCATGG - Intergenic
935044383 2:99467077-99467099 TGTTAAATAAAGGTAAATAAAGG + Intronic
936744437 2:115557723-115557745 TGGTAAAGAAAGATGGATCAAGG + Intronic
939034043 2:137109918-137109940 TGGTTAAGACAGGTGGGTCAAGG - Intronic
943260852 2:185661626-185661648 TGGTTCCTAAAAGGAGATCAGGG + Intergenic
943381091 2:187149408-187149430 AGGATGATAAAGGTAGTTCAAGG + Intergenic
943854891 2:192777017-192777039 TGGCTATTAAGGGTAGATTAGGG - Intergenic
944677501 2:202046678-202046700 AGGTCATTAAATGTAGATCATGG - Intergenic
945902664 2:215556446-215556468 TGGCTAAGAAAGGGAGATGAGGG + Intergenic
1171076129 20:22126024-22126046 TGGTTAATAAAGGTTAATAAAGG + Intergenic
1171321854 20:24252625-24252647 TGGTTAATATGGGTAAATAATGG + Intergenic
1176969591 21:15250102-15250124 AGGTTAACAAGGGTAGATCTGGG - Intergenic
1177158480 21:17522446-17522468 TGGTTAATAAAGAAAAATAAAGG - Intronic
1177449647 21:21249043-21249065 TGGTAAGGAAAGCTAGATCAGGG - Intronic
1177664999 21:24144375-24144397 TGGGTAAAACAGGTAGATAATGG + Intergenic
950444621 3:13029360-13029382 GGGTTAATACAGATAGAACATGG + Intronic
952144937 3:30522102-30522124 TTATTAATAAAGGGAGATGAAGG + Intergenic
953207482 3:40844278-40844300 TGGTGAATAAAGGCAGAGAACGG + Intergenic
953420097 3:42747596-42747618 TGGTTAATAAAGGTGGAACCTGG + Intronic
956341008 3:68224179-68224201 TGGTAAATAAAGGTAAATGTAGG + Intronic
957210841 3:77256459-77256481 TGGGTAATAAAAGTAAATCATGG + Intronic
958993582 3:100875668-100875690 TAATTAATAAAGTTAGATCAAGG - Intronic
960134098 3:114088540-114088562 AGATTAATAAAGATAGATAAGGG - Intergenic
961972048 3:130978447-130978469 TGGTTAATAAAAGTAGTTTCCGG + Intronic
963953826 3:151231199-151231221 TGGCTAGTAAAGGTAGAAGAAGG + Intronic
966781733 3:183590102-183590124 TGGCAAAGAAAAGTAGATCATGG - Intergenic
970637856 4:18029448-18029470 TTGAGAATAAGGGTAGATCATGG - Intergenic
974712647 4:65620690-65620712 TGTGAAATAAAGGCAGATCATGG + Intronic
974754865 4:66190312-66190334 TGGTTAAAAATGGGAGTTCAGGG + Intergenic
976999208 4:91474986-91475008 TGGGTAATAAAGGTGGGTTAGGG + Intronic
977849819 4:101813229-101813251 TGGTGAATTAAGGTAGATTTTGG + Intronic
983861231 4:172709448-172709470 TGTTTATTAAAGGAAGATCATGG - Intronic
986945230 5:13010102-13010124 TGTTTTATGAAGGTAGTTCATGG + Intergenic
988601018 5:32639534-32639556 TGGAAAATGAAGGTAAATCATGG - Intergenic
992975058 5:82107811-82107833 AGGATAATAAAGGTAGAATATGG + Intronic
994519872 5:100820058-100820080 TCATTAACAAAGGTAAATCAAGG - Intronic
996105382 5:119495969-119495991 AGGTTAATAAAGGAGGCTCATGG - Intronic
996234925 5:121115337-121115359 TGGTTAATAAGGGTAAATCAAGG - Intergenic
996838604 5:127821933-127821955 TGGCTAAAAAAGTTAAATCAAGG + Intergenic
997492316 5:134287825-134287847 TGGTTAATTTAGGCAGATCCAGG - Intronic
1002884889 6:1284831-1284853 AGGTTAATTAATGTAGCTCATGG + Intergenic
1004751877 6:18570065-18570087 TGGTAAATATAGGAAGATCAAGG - Intergenic
1006454916 6:34126152-34126174 TGGTGAAAAAAGGTAGATTCAGG + Intronic
1006957310 6:37885341-37885363 TGGTTTATAAATGAAGATCTGGG + Intronic
1011072498 6:83401073-83401095 GGGGAAATAAAGGTAGAGCAGGG - Intronic
1012023534 6:93958381-93958403 TGATTAAGAAAGATAGAGCAAGG - Intergenic
1012630139 6:101455677-101455699 TGGGTAATATAGGTAGATAACGG + Intronic
1021264965 7:18508854-18508876 TATTTAATTCAGGTAGATCATGG + Intronic
1021370071 7:19833771-19833793 TGGTTGATAAAGGAGTATCAGGG - Intergenic
1025809443 7:64866061-64866083 TGGTTAATGACTGTAGATCCTGG + Intergenic
1026611041 7:71860159-71860181 TGCTCAATAAAGGCAGAGCAGGG - Intronic
1028090522 7:86694936-86694958 TGGGTAATGAAGGAAGATCAAGG + Intronic
1028494236 7:91446460-91446482 ACTTTAATAAAGATAGATCAAGG + Intergenic
1028512297 7:91638673-91638695 TGAATAATAAATGAAGATCAAGG - Intergenic
1028833204 7:95347540-95347562 TGGTTAGTATGGGTAGCTCAAGG - Intergenic
1029660877 7:101960664-101960686 TGATTAAAAAAGGTATATTAAGG - Intronic
1031493535 7:122418772-122418794 TGGTTGATAAAGTTAGGTAATGG + Intronic
1031699789 7:124909621-124909643 TTGTTAATAATGGTAAGTCAAGG - Intronic
1033214941 7:139486586-139486608 TTGTTAAAAAAGGTTGGTCATGG - Intergenic
1036029923 8:4958418-4958440 TCTATAATAAAGGTAGATGAAGG + Intronic
1036463687 8:8976019-8976041 GGGTTAATGAAGTTAAATCAGGG + Intergenic
1036538587 8:9678326-9678348 TGTTTAACAAAGGTAGGTCTTGG + Intronic
1037042077 8:14248314-14248336 TAGTTAATAAATTAAGATCATGG - Intronic
1038908120 8:31930481-31930503 TGGTTAATCAAGGTAAACAAAGG - Intronic
1041695722 8:60734267-60734289 TTGTTAATAAAGGCAGATTCTGG + Intronic
1041954838 8:63546416-63546438 TCCTTATTAAAGGAAGATCATGG - Intergenic
1044747764 8:95387436-95387458 TGGTTAATAAGGGCACATCTTGG + Intergenic
1047197878 8:122737954-122737976 AGGCTCATAAAGGTAGCTCATGG - Intergenic
1050320057 9:4443084-4443106 TGTTTCATAAAGGAAGATTAAGG - Intergenic
1051309432 9:15753860-15753882 TGGTCCATACAGGTAGATAAAGG + Intronic
1051322183 9:15917541-15917563 TAGTTATTAAAAGTAGATCAAGG + Intronic
1051358551 9:16262081-16262103 TGGTTAATAAAGACTGAGCACGG - Intronic
1051561553 9:18447212-18447234 TGGTAAATAAAGGTTGCTCAAGG + Intergenic
1052221242 9:26025727-26025749 TGCTTAATAAAGGCAGCTGAAGG + Intergenic
1056337775 9:85592171-85592193 TGGTTAAAAATTGTAAATCATGG + Intronic
1056943606 9:90975657-90975679 TGGTTAATGAATGCAGAGCATGG + Intergenic
1058289357 9:103218732-103218754 TGGTTATCAAAGGAAGATAAAGG - Intergenic
1059546555 9:115181094-115181116 TGGTTAAAAATGCAAGATCAAGG + Intronic
1060167220 9:121428266-121428288 TGGTTATTAAAGGTTGAGAAAGG + Intergenic
1060445546 9:123684032-123684054 TGATTATTCAAAGTAGATCAAGG + Intronic
1186203874 X:7181395-7181417 GGGTTAATAAAGGAAGTGCAGGG + Intergenic
1188867715 X:35334074-35334096 TGGTTACTAGGGGTAGGTCAGGG + Intergenic
1192542311 X:71984687-71984709 TTTTTACTAAAGGTAAATCATGG + Intergenic
1194642832 X:96423717-96423739 GAGTTAATAATGGTAGAGCAAGG + Intergenic
1198321837 X:135525898-135525920 TGGATAAGAAAGCAAGATCATGG - Intronic
1199932580 X:152539023-152539045 TGATTAATAAAAATAGAGCAGGG - Intergenic
1201284358 Y:12366446-12366468 TGGATGATAATGGTAGATGATGG + Intergenic