ID: 1087558136

View in Genome Browser
Species Human (GRCh38)
Location 11:99748651-99748673
Sequence TTTGGAGTCCCAGAGTCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 219}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087558129_1087558136 21 Left 1087558129 11:99748607-99748629 CCAGTTCAAAAGGCCTGAGAACT 0: 1
1: 0
2: 1
3: 27
4: 314
Right 1087558136 11:99748651-99748673 TTTGGAGTCCCAGAGTCTGAAGG 0: 1
1: 0
2: 3
3: 24
4: 219
1087558127_1087558136 30 Left 1087558127 11:99748598-99748620 CCTTTTAGCCCAGTTCAAAAGGC 0: 1
1: 0
2: 0
3: 9
4: 129
Right 1087558136 11:99748651-99748673 TTTGGAGTCCCAGAGTCTGAAGG 0: 1
1: 0
2: 3
3: 24
4: 219
1087558134_1087558136 8 Left 1087558134 11:99748620-99748642 CCTGAGAACTTGAGTGGGGTGGA 0: 1
1: 0
2: 1
3: 9
4: 125
Right 1087558136 11:99748651-99748673 TTTGGAGTCCCAGAGTCTGAAGG 0: 1
1: 0
2: 3
3: 24
4: 219
1087558128_1087558136 22 Left 1087558128 11:99748606-99748628 CCCAGTTCAAAAGGCCTGAGAAC 0: 1
1: 0
2: 3
3: 23
4: 222
Right 1087558136 11:99748651-99748673 TTTGGAGTCCCAGAGTCTGAAGG 0: 1
1: 0
2: 3
3: 24
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087558136 Original CRISPR TTTGGAGTCCCAGAGTCTGA AGG Intronic
900901380 1:5518688-5518710 TTTGGACTTCCAGAGTGTCATGG - Intergenic
904380135 1:30105038-30105060 TTTCCAGCCCCAGACTCTGAGGG + Intergenic
904638766 1:31905467-31905489 TTTGGAGTACCTCAGTCTGGAGG - Intergenic
906076665 1:43056866-43056888 TTTAGAGCACCAGAGTCAGAAGG + Intergenic
906508122 1:46394879-46394901 TTTGGAATCGCAGAGTGTAATGG + Intronic
910498929 1:87866231-87866253 GTGTAAGTCCCAGAGTCTGATGG + Intergenic
910800039 1:91136170-91136192 GGTGCAGTCCCAGAGTCTAAAGG - Intergenic
911290248 1:96048845-96048867 TGTTAAGTCCCGGAGTCTGAAGG + Intergenic
911290255 1:96048876-96048898 TCTGGAGTCCTAATGTCTGAAGG + Intergenic
912171489 1:107105832-107105854 TTTGGAATCACAGAATTTGAAGG - Intergenic
913321189 1:117589678-117589700 GTTTAAGTCCCAGAGTTTGAAGG - Intergenic
916417780 1:164609000-164609022 TTTGGAGCTCCACTGTCTGAGGG + Intronic
917019027 1:170566279-170566301 CTTGGAGGCCCTGAGTCTGAAGG - Intergenic
917501677 1:175591377-175591399 TTTGAAGTGCCAGGGTCTCAAGG - Intronic
918490315 1:185074535-185074557 TTTGGAATCCCTGAGTCATAAGG - Intronic
918748822 1:188243768-188243790 TTTGTAGTCCCAGGTTCTGAGGG + Intergenic
918908904 1:190539393-190539415 TTTTGAGTCTCAGAGTCTAGAGG - Intergenic
921469257 1:215529104-215529126 TTTGGACTTCCAGATGCTGATGG - Intergenic
921750165 1:218783015-218783037 TTTTGTGTCTCAGAGTCTCAAGG + Intergenic
923993698 1:239467948-239467970 TTTGTCTTCTCAGAGTCTGAGGG + Intronic
1063495187 10:6501153-6501175 CTTGGAGACCCAGAGTCTTAGGG + Intronic
1064737710 10:18399632-18399654 TTTGGCCTCCCAGAGTCCTAGGG + Intronic
1065569201 10:27051654-27051676 TCTGGGGACCCAGAGTATGAAGG + Intronic
1065925861 10:30433693-30433715 TCTGGAGTCCCAGGGTCCGGCGG - Intergenic
1066064511 10:31752386-31752408 CCTGGAGCCCCAGAGGCTGATGG - Intergenic
1067042216 10:42961022-42961044 TCTGGAGTCCCAGAGATAGAAGG - Intergenic
1067288050 10:44921775-44921797 TTGGGAGGCCCAGAGTCTGAGGG - Intronic
1067911014 10:50346949-50346971 TTGGGACTCCCAGAGTAAGATGG - Intronic
1068593196 10:58872002-58872024 TTTAGAGACCCACAGTGTGAAGG + Intergenic
1068612008 10:59070414-59070436 TTGCAAGACCCAGAGTCTGAAGG + Intergenic
1069869281 10:71523392-71523414 TTGGTAGTCCCCGAGTTTGAGGG - Intronic
1071384063 10:85101934-85101956 GATAGAGTCCCAGAGTCTGCAGG + Intergenic
1072445151 10:95492956-95492978 TCTGCTGTCCCAGAGTCTGCAGG + Intronic
1072956097 10:99889384-99889406 TTGGGAGTGCCAGGGTCGGATGG - Intronic
1073506919 10:104003387-104003409 TTTGGATTCTCAGATTCTGGTGG - Exonic
1074558117 10:114510512-114510534 TTTGTATTTCCAGAGTCTAATGG + Intronic
1074584926 10:114758574-114758596 AGAGGAGTCCCAGAGTCTGGGGG - Intergenic
1076630962 10:131852003-131852025 TTGGGAGGCCGAGCGTCTGATGG - Intergenic
1077123062 11:919572-919594 TTTGGAGTGCCAGAGGCTGTGGG + Intergenic
1077260991 11:1620617-1620639 TTCGGACTCCGTGAGTCTGATGG - Intergenic
1079588380 11:22152908-22152930 TTTTGAGTCACACAGTCTGTGGG + Intergenic
1083747290 11:64743343-64743365 TTTGGGAACCCAGAGCCTGAGGG + Intronic
1084300809 11:68250797-68250819 GTATAAGTCCCAGAGTCTGAAGG + Intergenic
1087558136 11:99748651-99748673 TTTGGAGTCCCAGAGTCTGAAGG + Intronic
1089090265 11:115868610-115868632 TTTGGTGTCCCAGAAGGTGAAGG - Intergenic
1092924164 12:13258596-13258618 TGGGGAGTCCCAGAGCCTGCTGG + Intergenic
1095504584 12:42881270-42881292 TTTGCAGTCCCAGAAGATGAAGG - Intergenic
1096571495 12:52526015-52526037 TTCGCAGTCCTGGAGTCTGAGGG - Intergenic
1099151210 12:79116268-79116290 TTGGGAGTGCCAGAGGATGATGG + Intronic
1099299556 12:80874858-80874880 CCTGTAGTCCCAGAGGCTGAGGG + Intronic
1101214074 12:102563362-102563384 TTTGCAGTCCCACGATCTGAAGG + Intergenic
1102666489 12:114578348-114578370 GTGTAAGTCCCAGAGTCTGAAGG - Intergenic
1103927984 12:124434198-124434220 GTGGGGGTCCCAGGGTCTGAGGG + Intronic
1104084436 12:125461231-125461253 TTTGGAGCCTGTGAGTCTGATGG + Intronic
1104286181 12:127426845-127426867 TTTGGAGCCTGTGAGTCTGATGG - Intergenic
1106236444 13:27865092-27865114 CTTGCAGACCCAGAGCCTGAAGG - Intergenic
1107975959 13:45688855-45688877 TGAGGAGTCTCCGAGTCTGAGGG + Intergenic
1109010985 13:56943720-56943742 GTGGAAGTCTCAGAGTCTGAAGG - Intergenic
1110013228 13:70365552-70365574 TTTGGAGCCCCACAGCCTGAGGG + Intergenic
1110411831 13:75212814-75212836 ATTTGAGTCCCAGAGTCTTTGGG + Intergenic
1111914034 13:94342558-94342580 TCTGGATGCCCGGAGTCTGAAGG - Intronic
1115348989 14:32373026-32373048 TTTGATGTTTCAGAGTCTGACGG + Intronic
1115460856 14:33658966-33658988 TTTGGGGTCCCAGAGTAATATGG - Intronic
1116315796 14:43390359-43390381 TTGGGAGGCCCAGAGGCTGAGGG + Intergenic
1117619248 14:57567690-57567712 GTTGGACTCCCTGAGTCTGAGGG - Intronic
1118702135 14:68443746-68443768 GTTGGTGTCCCAAAGGCTGAAGG - Intronic
1122448946 14:101788088-101788110 TCCGGAGGCCCAGAGTCAGAGGG + Intronic
1124605088 15:31163578-31163600 CATGGAGTCCCAGAGCATGAAGG - Intergenic
1127798167 15:62455734-62455756 TATGGAGTCCCAGAGGCAAAAGG - Intronic
1129911093 15:79227049-79227071 TTTGGAGTCTGTGAGTCTGGAGG + Intergenic
1130507342 15:84557647-84557669 TTAGGAATCCGAGAGACTGAGGG - Intergenic
1132396342 15:101477856-101477878 TGTAGAGTCTAAGAGTCTGAAGG - Intronic
1133643458 16:7740451-7740473 TTTGAAGTTTCAGAGACTGAGGG - Intergenic
1136563701 16:31056763-31056785 TTTGGCCTCCCAGAGTCTGAAGG + Intergenic
1137773430 16:51036623-51036645 TTTGCAGTACCAGAGATTGAGGG + Intergenic
1137897155 16:52226409-52226431 GTGTAAGTCCCAGAGTCTGAAGG + Intergenic
1139312887 16:66042144-66042166 TTTGGAGTCACATAGTCATACGG + Intergenic
1140951269 16:79820111-79820133 TTTGAAGTTCCAGAGTTTGTTGG - Intergenic
1142365046 16:89645744-89645766 TCTGCTGCCCCAGAGTCTGAAGG + Exonic
1142438191 16:90076507-90076529 TTTGGGGTCCCTCAGGCTGAGGG + Intronic
1144242941 17:13331835-13331857 GTTGGAGTGTCAGAGTCAGAGGG + Intergenic
1145978507 17:28997966-28997988 TAAGGAGTCCCAGAGCCTGGGGG - Intronic
1146824873 17:36013480-36013502 TAGGGAGTCCCACAGGCTGAGGG - Intronic
1147881999 17:43660287-43660309 GCTGGAGTCCCAGAGGCTGGAGG - Intronic
1148201010 17:45750054-45750076 TGTGCTGTCCCAGAGGCTGAAGG + Intergenic
1148684845 17:49495575-49495597 ATTGGGGTCCCAGATACTGAGGG + Intronic
1149481628 17:57008096-57008118 TTTTTAGTCTCAGGGTCTGAAGG - Intergenic
1149819550 17:59761772-59761794 CTTTGTGTGCCAGAGTCTGAAGG + Intronic
1151786133 17:76275932-76275954 TTTGAGGTCCCTGAGCCTGATGG + Exonic
1152896324 17:82913491-82913513 TTTGGAGTCCCCGTGGCTGGCGG + Intronic
1153153603 18:2124273-2124295 TTTTGAGCTCCAGAGTGTGAAGG - Intergenic
1153185483 18:2481505-2481527 GTGTAAGTCCCAGAGTCTGAAGG + Intergenic
1153656402 18:7286640-7286662 TTGTAAGTCCCAGAGTCTGAAGG + Intergenic
1155040865 18:22064706-22064728 CTTGGAGACTCAGATTCTGAGGG + Intergenic
1156994195 18:43447071-43447093 TCTGGAGTCCCAGAGGGTCAGGG - Intergenic
1158090933 18:53712464-53712486 CCTGTAGTCCCAGAGGCTGAGGG - Intergenic
1158677632 18:59536231-59536253 TCTGGTGTGCAAGAGTCTGACGG + Intronic
1158770306 18:60508218-60508240 TTTGAAGTCCCTGTGTCTGGTGG + Intergenic
1159277938 18:66245253-66245275 GTTTAAGTCCCAGAGTCTGAAGG + Intergenic
1160412467 18:78684237-78684259 TTTGAGGTCCCAGAGTGTGGTGG - Intergenic
1166393341 19:42422555-42422577 TTTGGGGTCCCTGGGGCTGAGGG + Intronic
1166773676 19:45299728-45299750 CTTGGAGTCCCAGAGGCAGTGGG + Intronic
1167273173 19:48517982-48518004 CTTTGAGTGCCAGAGTCTGGAGG - Intergenic
1168252551 19:55148797-55148819 TTTGGGGCCTCAGACTCTGAGGG - Intronic
1168258656 19:55180573-55180595 ATTGGAGACCCAGACTCTGCAGG + Intergenic
1168452136 19:56474896-56474918 GTTCGAGTCTCAGAGTCTCAAGG + Intronic
926785821 2:16517570-16517592 TTTGAAGGCCCAGAAGCTGAAGG - Intergenic
927293211 2:21424531-21424553 TTAGGACACCCAGAGGCTGAGGG + Intergenic
929754915 2:44756414-44756436 TTTTGTGGCCCAGAGGCTGAAGG + Intronic
931215690 2:60242086-60242108 GTGTTAGTCCCAGAGTCTGAAGG - Intergenic
936092822 2:109511980-109512002 TTGGGAGTCCCAGAGTCCTCTGG - Intergenic
937862407 2:126721315-126721337 TTTGGGGTCCTAGAGGCTCAGGG + Intergenic
939050819 2:137305544-137305566 CTTGGAGTCCCAGAAGCTAAAGG + Intronic
945211847 2:207391383-207391405 TTTGGAGTTCAAGAGTCTTCTGG + Intergenic
947126902 2:226878735-226878757 CTTGGAGTCACAGATTCTGTGGG - Intronic
947653566 2:231807842-231807864 GGTGGAGCCCCTGAGTCTGAAGG - Exonic
1169386508 20:5154572-5154594 TTTGAAGTGCCAGTGTCTGAAGG + Intronic
1169433828 20:5566181-5566203 TTTATATTCCCAGAGACTGATGG - Intronic
1170273968 20:14562798-14562820 TCTAGAGTCCCTGACTCTGAGGG - Intronic
1174783445 20:53411350-53411372 CTTGGAGACCCAGAGTCCGCAGG - Intronic
1176259015 20:64169247-64169269 TTTGCGGTCCGAGAGTCTCAGGG - Intronic
1177115251 21:17077763-17077785 ATTGGATTCACAGACTCTGAGGG - Intergenic
1177798760 21:25806803-25806825 ATGTAAGTCCCAGAGTCTGAAGG - Intergenic
1180992007 22:19942355-19942377 TGTGGAGCCCCAGACTCAGAGGG + Intronic
1181785786 22:25225623-25225645 TTTTGTGTCCCAGACTCTGCAGG - Intronic
1182444660 22:30383104-30383126 TCTGGACTCCCAGAGGCTGGAGG + Intronic
1182499943 22:30739407-30739429 ATTGGAGGCCCAGAGCCTGAGGG - Intronic
1184431777 22:44445308-44445330 TTGGGAGTTCCACAGTCTGGTGG - Intergenic
949599126 3:5579409-5579431 GTTTGAGTCCCAGAGTCCAAAGG - Intergenic
949805422 3:7950762-7950784 AATTGAGTCCCAGAATCTGACGG + Intergenic
950416725 3:12873108-12873130 GTTGGAGGCACAGACTCTGAGGG - Intergenic
951464652 3:22989258-22989280 ATTTGTGTCACAGAGTCTGATGG + Intergenic
951564749 3:24002187-24002209 GTATCAGTCCCAGAGTCTGAAGG + Intergenic
953638973 3:44687879-44687901 GTGCAAGTCCCAGAGTCTGAAGG + Intergenic
958931420 3:100212037-100212059 TTTGAAGTCCTTGAGCCTGAAGG + Intergenic
959908475 3:111736517-111736539 TTTGGAGTCCCAAGATCTAAGGG - Intronic
960171431 3:114466042-114466064 TCTGGAGTACCAGAGTCTACAGG + Intronic
962402738 3:135075281-135075303 TCTAGAGTGCCAGAGTCTGCTGG + Intronic
964493575 3:157264216-157264238 ATGTAAGTCCCAGAGTCTGAAGG - Intronic
965426149 3:168525921-168525943 TATGGAGTCCCAGAGTTGGCAGG - Intergenic
965943271 3:174210677-174210699 TTTAGAGTCCCAAGCTCTGAAGG - Intronic
966295877 3:178422213-178422235 TTTGTATTTCCAGAGTCTGAAGG + Intronic
969460070 4:7324328-7324350 TTTGGAGTGCCAGAGCCTCTTGG + Intronic
970158181 4:13162882-13162904 TTGGGTGGGCCAGAGTCTGAGGG - Intergenic
971404547 4:26310233-26310255 TATGGAATTGCAGAGTCTGATGG + Intronic
973076752 4:45938117-45938139 TCTGGAGGCCCAAAGTTTGATGG + Intergenic
973798129 4:54449593-54449615 TTTGGAGTCCCAGATTGTTGCGG + Intergenic
976260050 4:83136779-83136801 TCTGGGGACCCAGAGTGTGAAGG - Intronic
976844399 4:89471333-89471355 GTGTGAGTCCCAGCGTCTGAAGG - Intergenic
979539046 4:121858204-121858226 TTTGGAATTCCATAGTCAGATGG - Intronic
980415062 4:132476801-132476823 GTATAAGTCCCAGAGTCTGAAGG + Intergenic
981108006 4:140903335-140903357 TTTGGAAATTCAGAGTCTGAGGG - Intronic
981269188 4:142824098-142824120 GTTTAAGTCCCAGAGTCTGAAGG - Intronic
982173495 4:152683684-152683706 ATTGAAGTCCCAGGTTCTGAAGG + Intergenic
982200816 4:152958181-152958203 TTTGGAGTGTGAGAGTCTCAAGG + Intronic
982307043 4:153943559-153943581 TGTGGACTCCCAGAGTCCCAGGG - Intergenic
985930558 5:3054206-3054228 TTTGGTGTCCTAGAGTCTCCTGG + Intergenic
986262015 5:6155822-6155844 TTTGCAGTCCAAGAGTCTCCTGG - Intergenic
986373948 5:7111002-7111024 TATGGAGACCAAGAGTCTGTGGG + Intergenic
986828918 5:11552920-11552942 TTTGGACTCTCAGCATCTGAAGG + Intronic
987778210 5:22397003-22397025 TTTGGTGTATCAGAGTCTGCTGG + Intronic
987862911 5:23508416-23508438 TTTGGGGTCCCTCAGGCTGAGGG - Intronic
992027681 5:72686709-72686731 TTTGGACTCAAAGAGTCAGAGGG + Intergenic
992286644 5:75242291-75242313 TTTGCAGTCCCTGAGCTTGATGG - Intergenic
992923685 5:81557045-81557067 TAAGGAGTACCAGAGTATGAAGG - Intronic
992950082 5:81850151-81850173 CTGGGAGATCCAGAGTCTGAGGG + Intergenic
994571263 5:101516887-101516909 TTAGGCCTCCCAGAGGCTGAGGG + Intergenic
995223260 5:109675156-109675178 ACTGGAGTCCCAGAGATTGATGG + Intergenic
996163025 5:120190458-120190480 TTTGGAGACCCAGAAGGTGAGGG - Intergenic
997253374 5:132408711-132408733 TTTGGAGCCCCATAGTCAGAAGG - Intergenic
999176936 5:149638458-149638480 TTTGGGGCCCAAGAGTCTGCTGG + Intergenic
999750860 5:154627424-154627446 TTTGGTGTCCCAGACCCTGAAGG - Intergenic
999887446 5:155938380-155938402 TTTTGAGTCCCAAACTCAGAAGG - Intronic
1001557719 5:172647732-172647754 TTTTGAGTTCCAGAGTCTACAGG - Intronic
1002637870 5:180617096-180617118 GTGGGTGTCCCAGAGTCTGAGGG - Intronic
1002637882 5:180617146-180617168 GTGGGTGTCCCAGAGGCTGAGGG - Intronic
1002637895 5:180617196-180617218 GTGGGTGTCCCAGAGGCTGAGGG - Intronic
1002637919 5:180617296-180617318 GTGGGTGTCCCAGAGTCTGAGGG - Intronic
1002637931 5:180617346-180617368 GTGGGTGTCCCAGAGTCTGAGGG - Intronic
1002637943 5:180617396-180617418 GTGGGTGTCCCAGAGGCTGAGGG - Intronic
1002637956 5:180617446-180617468 GTGGGTGTCCCAGAGGCTGAGGG - Intronic
1002637969 5:180617496-180617518 GTGGGTGTCCCAGAGGCTGAGGG - Intronic
1002637982 5:180617546-180617568 GTGGGTGTCCCAGAGGCTGAGGG - Intronic
1002637995 5:180617596-180617618 GTGGGTGTCCCAGAGGCTGAGGG - Intronic
1002638008 5:180617646-180617668 GTGGGTGTCCCAGAGGCTGAGGG - Intronic
1002638021 5:180617696-180617718 GTGGGTGTCCCAGAGGCTGAGGG - Intronic
1002638046 5:180617796-180617818 GTGGGTGTCCCAGAGGCTGAGGG - Intronic
1002638085 5:180617948-180617970 GTGGGTGTCCCAGAGGCTGAGGG - Intronic
1002638109 5:180618048-180618070 GTGGGTGTCCCAGAGGCTGAGGG - Intronic
1002638123 5:180618099-180618121 GTGGGTGTCCCAGAGGCTGAGGG - Intronic
1002638136 5:180618149-180618171 GTGGGTGTCCCAGAGGCTGAGGG - Intronic
1002638149 5:180618199-180618221 GTGGGTGTCCCAGAGGCTGAGGG - Intronic
1002638163 5:180618250-180618272 GTGGGTGTCCCAGAGGCTGAGGG - Intronic
1002638176 5:180618300-180618322 GTGGGTGTCCCAGAGGCTGAGGG - Intronic
1002638190 5:180618351-180618373 GTGGGTGTCCCAGAGGCTGAGGG - Intronic
1002638215 5:180618451-180618473 GTGGGTGTCCCAGAGGCTGAGGG - Intronic
1004702142 6:18089145-18089167 ACTGGAATCCCAGAGTCAGAAGG - Intergenic
1005298420 6:24448552-24448574 TGTGGACTCTCATAGTCTGATGG - Intronic
1005376134 6:25184652-25184674 TTTGGAGTCCCTGAAAGTGATGG - Intergenic
1005622446 6:27632516-27632538 TCTGGAGTCCCAGATTTTGAAGG + Intergenic
1007962689 6:45974811-45974833 TGTGGTGTCCCAGAGCCTGCAGG - Intronic
1008108019 6:47461119-47461141 TGTGGATTCCCAGAGGCTGAAGG - Intergenic
1010099425 6:72086586-72086608 TTTGTACTCCCAGAGCCTTAAGG + Intronic
1014913878 6:127121190-127121212 TTTGGGGCCCCTGATTCTGAAGG + Intronic
1015806089 6:137110079-137110101 GTCTGGGTCCCAGAGTCTGAAGG - Intergenic
1021439726 7:20664134-20664156 TTTGGCCTCTCAGAGTCAGAAGG + Intronic
1022520250 7:31001618-31001640 TTATGAGTCCCTGAATCTGATGG - Intergenic
1022782171 7:33597140-33597162 TATAGAGTCTCTGAGTCTGAGGG + Intronic
1023072645 7:36452067-36452089 TTTGGAGAACCTGACTCTGAAGG + Intronic
1024264818 7:47598438-47598460 CTTGGACTCTCAGAGTCTGGAGG + Intergenic
1025067889 7:55873424-55873446 TTTGGGGTACCAGCTTCTGATGG + Intergenic
1027802311 7:82770731-82770753 TCTTGAGTACCAGAGTCAGAAGG - Intronic
1031006325 7:116476689-116476711 TTTGGAATCCCAAAGTGTAATGG - Intronic
1032166286 7:129547629-129547651 GTGTAAGTCCCAGAGTCTGATGG + Intergenic
1033455349 7:141498107-141498129 TTTGGAGTTCCAGAGTCAGATGG + Intergenic
1034030485 7:147757402-147757424 TTTAGAGTTCCAAAGCCTGATGG + Intronic
1034377331 7:150657597-150657619 TTTGGAGTCACTCAGTCTAAGGG - Intergenic
1035198521 7:157243264-157243286 TATGGAGTGCCAGGGTCTCAAGG + Intronic
1035477863 7:159156350-159156372 CTCGGAGTCACAGAGTCTGGGGG - Intergenic
1036149719 8:6286206-6286228 CTGTGAGTCCCAGAGTCCGAAGG + Intergenic
1036183768 8:6607035-6607057 TTTGGAAACCAAGAGGCTGATGG + Intronic
1039055428 8:33532631-33532653 GTGTAAGTCCCAGAGTCTGAAGG - Intergenic
1039834353 8:41244984-41245006 ATTGGAGTTCCGGAGGCTGAGGG - Intergenic
1040423259 8:47260326-47260348 TACGGGGTGCCAGAGTCTGAAGG - Intergenic
1040692745 8:49959351-49959373 TTTGGAATCCCATAAACTGAGGG - Intronic
1044323190 8:90829473-90829495 TTTGGAGTTCCAGATTGTTAGGG + Intronic
1044590269 8:93907559-93907581 TTGAGAGTCCCAGAGTTGGAGGG + Intronic
1048427027 8:134332575-134332597 TTTGGAGAAACAGAGACTGAGGG - Intergenic
1049120495 8:140732797-140732819 TTTGGAGACTCAGAGGGTGAAGG + Intronic
1049325514 8:142019526-142019548 CTTGGTGTCCCAGAGGCTGAGGG + Intergenic
1055097508 9:72428718-72428740 TGTGGATTCCCAGAGATTGAGGG + Intergenic
1055299239 9:74865893-74865915 TCTGTAGTCCCAGATTCTCAGGG - Intronic
1055407692 9:75991804-75991826 TTGGTAGTCCCAGATTCTTAAGG - Intronic
1056780449 9:89545374-89545396 TTTGGAGTGCCAGAGCCTGGGGG + Intergenic
1058746131 9:107992382-107992404 TTTGCAGTCCCTGCTTCTGAAGG + Intergenic
1059911078 9:119044901-119044923 TGTGGAGACTCACAGTCTGATGG - Intergenic
1059949415 9:119446437-119446459 TTTTCAGTCTCAGAGTTTGATGG + Intergenic
1185720801 X:2379926-2379948 TTTGGAGTCTCAGATTCTGGCGG - Intronic
1186272555 X:7904800-7904822 TTTGGAGTCACAGAAGCTCATGG - Intronic
1186507440 X:10104227-10104249 GTGTAAGTCCCAGAGTCTGAAGG + Intronic
1188290039 X:28376447-28376469 TTTGAAGTCCTAGAATCAGAGGG - Intergenic
1188990984 X:36819954-36819976 GTGTGAGTCCCAGAGTCTAAAGG - Intergenic
1190331146 X:49236103-49236125 TTTGGAGTCCCCGAGTGCCAGGG - Intronic
1191114173 X:56834517-56834539 TTTCAAGTACCAGAGTCTGAAGG + Intergenic
1197153681 X:123247371-123247393 TTTATAGTCCCCGAGTCTGTAGG - Intronic
1200898613 Y:8403993-8404015 TTTGGAGTTTCATAGCCTGAAGG - Intergenic
1200920107 Y:8605585-8605607 TATGGAGCCTCAGAGACTGATGG + Intergenic