ID: 1087558209

View in Genome Browser
Species Human (GRCh38)
Location 11:99749565-99749587
Sequence GATTTCAGATAAATTTCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 178}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087558206_1087558209 -3 Left 1087558206 11:99749545-99749567 CCTCAGTGGCCCAGTCTTAGGAT 0: 1
1: 0
2: 1
3: 12
4: 153
Right 1087558209 11:99749565-99749587 GATTTCAGATAAATTTCCCCTGG 0: 1
1: 0
2: 0
3: 20
4: 178
1087558204_1087558209 4 Left 1087558204 11:99749538-99749560 CCTGACACCTCAGTGGCCCAGTC 0: 1
1: 0
2: 0
3: 11
4: 156
Right 1087558209 11:99749565-99749587 GATTTCAGATAAATTTCCCCTGG 0: 1
1: 0
2: 0
3: 20
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087558209 Original CRISPR GATTTCAGATAAATTTCCCC TGG Intronic
905294928 1:36948210-36948232 AGTTTCAGAAAAATGTCCCCTGG - Intronic
905805054 1:40870405-40870427 CATGTCAGCTAACTTTCCCCAGG - Intergenic
905861416 1:41354442-41354464 GAAGTAAAATAAATTTCCCCAGG - Intergenic
909168028 1:72253978-72254000 GATTACAAATGATTTTCCCCAGG + Intronic
909865011 1:80656868-80656890 GCTGTCAGATAAATTTCTCTTGG + Intergenic
910118119 1:83755188-83755210 AAAATCAGAGAAATTTCCCCTGG + Intergenic
913550161 1:119909792-119909814 TATTTCTGAGAAATTTCCACTGG - Intergenic
916856341 1:168754097-168754119 GATTTCAAAGATATTTCCCCAGG + Intergenic
918368047 1:183829857-183829879 GATATAAGATAAATTTCACGAGG - Intronic
920195165 1:204221924-204221946 GATATCAGATTGGTTTCCCCCGG - Exonic
920767453 1:208847041-208847063 GATTTCAGATAGCATTTCCCAGG - Intergenic
921375768 1:214471901-214471923 AATGTCATATCAATTTCCCCTGG - Intronic
923820957 1:237440786-237440808 GATTTCAGAATAGTGTCCCCGGG - Intronic
923972719 1:239223239-239223261 GATTTCAAGTTTATTTCCCCAGG + Intergenic
924482301 1:244447827-244447849 TATTTCAAATAAATTTCCAGGGG + Intronic
1063510290 10:6638123-6638145 GATTGCAGAATAATTTTCCCAGG + Intergenic
1067977880 10:51046504-51046526 GATTTGAGATAAATCTTTCCTGG + Intronic
1068711804 10:60142994-60143016 TATTTCATTTAAATCTCCCCAGG - Intronic
1069235164 10:66062061-66062083 GAGGTCAGATAAATTGCCCAAGG - Intronic
1069532850 10:69231666-69231688 TATTTCGGATCAATTTCCCAGGG + Intronic
1072880012 10:99217503-99217525 GATTTAAAAAAAATCTCCCCAGG - Intronic
1073919151 10:108439210-108439232 GTATTCAGAGAAACTTCCCCAGG + Intergenic
1079617153 11:22509626-22509648 GATTTGATATAAATTTCTCCTGG + Intergenic
1083045194 11:59728245-59728267 GATCTCATTTAATTTTCCCCAGG + Intronic
1083944034 11:65914045-65914067 GATTTCATCTAAGTTTCACCTGG - Intergenic
1084039397 11:66532605-66532627 GATTTCAGAGAAGTTTCCTGGGG - Exonic
1084900856 11:72308822-72308844 GATTTCGGATAAAGTTTTCCAGG + Intronic
1086549348 11:88037214-88037236 GATTTCAAATACATTTCCATAGG + Intergenic
1087558209 11:99749565-99749587 GATTTCAGATAAATTTCCCCTGG + Intronic
1090153861 11:124414988-124415010 GTTTTAAGATATATTTCACCAGG - Intergenic
1093576543 12:20737591-20737613 GCTTTCAGATCCATGTCCCCTGG + Intronic
1097611327 12:61824994-61825016 GGTTTCAGATAAATTCCCATGGG + Intronic
1098816289 12:75168525-75168547 AATTTCACATAAATTTACCAGGG + Intronic
1099706872 12:86165666-86165688 GATTTCAGTTAAAATTCCATTGG - Intronic
1102629788 12:114267869-114267891 CATTTCTGATAAGTTTCCACTGG + Intergenic
1103028063 12:117590081-117590103 GATTTCAGAGAAGTTTCCTGGGG + Intronic
1104580207 12:130006036-130006058 GATTTCACATAATTATCACCAGG + Intergenic
1106779342 13:33041620-33041642 GACTTCAGATAATTTGCCCAAGG + Intronic
1107758074 13:43647434-43647456 GAATTCAGGTGAACTTCCCCAGG + Intronic
1107972552 13:45657690-45657712 GTTTTCACATGAATTACCCCAGG + Intergenic
1109382996 13:61589339-61589361 TATTGCACATAAATTTCCTCAGG + Intergenic
1109939807 13:69346840-69346862 GAGTTCAGAAAAATGTCCACTGG + Intergenic
1110024277 13:70514207-70514229 TATTTCAGATAAATTTCTTAAGG - Intergenic
1110165404 13:72436529-72436551 GATTTAAGCCTAATTTCCCCTGG + Intergenic
1110211335 13:72977035-72977057 GGTATCAGATAATTTTCCCAGGG - Intronic
1110988210 13:82001997-82002019 AATTAGATATAAATTTCCCCAGG + Intergenic
1111531374 13:89541648-89541670 GATTTCAGTTCAATATCCCTGGG + Intergenic
1111735354 13:92132126-92132148 GTATTCATATAAATTTCCTCAGG + Intronic
1113047272 13:106169557-106169579 GATTTTACAAAAAGTTCCCCAGG + Intergenic
1113514410 13:110881636-110881658 AAATTCATATGAATTTCCCCTGG - Intronic
1113557632 13:111251248-111251270 GATATCAGATAAACTGTCCCTGG - Intronic
1114203663 14:20547553-20547575 GATTTGACAAAAATTTCCCTAGG + Intergenic
1114537333 14:23431463-23431485 GAATTCGAATGAATTTCCCCTGG + Exonic
1117432763 14:55685869-55685891 GCCTTCAGATCAATTTCCCAAGG - Intronic
1123136610 14:106033282-106033304 GAATTCAGATAAATTCCTCAAGG + Intergenic
1125439355 15:39685376-39685398 GATATAAAATAATTTTCCCCAGG - Intronic
1126872036 15:53000091-53000113 GATTTTAGAAAAATTTCCCAAGG - Intergenic
1129808727 15:78488193-78488215 GTTTCCAGATAAAATTCCACAGG - Exonic
1130023005 15:80246927-80246949 GATGTCACATACATTTTCCCAGG + Intergenic
1137885834 16:52102523-52102545 GAATTCAAGTAATTTTCCCCAGG + Intergenic
1145250565 17:21294803-21294825 GATTACAGACAAACCTCCCCGGG - Intronic
1145358480 17:22186540-22186562 GATTACATAAAATTTTCCCCAGG + Intergenic
1150748352 17:67835394-67835416 GATGTTAGGTAAATTCCCCCTGG - Intronic
1151077060 17:71286254-71286276 GAATTCACATAATGTTCCCCTGG - Intergenic
1153757589 18:8299811-8299833 GCTTTCAGAAAAAGTTTCCCTGG - Intronic
1156352579 18:36313615-36313637 GATTGCAGAGCAGTTTCCCCTGG + Intronic
1157872745 18:51245691-51245713 GAGGTTAGATAAATTTCCCGAGG + Intergenic
1161878161 19:6927938-6927960 CATTTCAGGTACATTTGCCCAGG + Intronic
1164930512 19:32172197-32172219 GACTCCAGATAAATTACCCAGGG + Intergenic
925751965 2:7096978-7097000 GCTTTCAGATAGATCTCCTCCGG - Intergenic
926296256 2:11571104-11571126 GATTTAAAATAATGTTCCCCAGG + Intronic
927360824 2:22230706-22230728 GCTTTCAGAAAAATTTCCCTAGG - Intergenic
929479974 2:42296381-42296403 GTTTTCTGAGACATTTCCCCTGG + Intronic
929859133 2:45660931-45660953 GATTTCAGTTATATTTCCTCTGG - Intronic
931563662 2:63590645-63590667 GAGGTCAGATAATTTTCCCAAGG + Intronic
934160096 2:89241318-89241340 GATTCCTAATAAATTTCCCTTGG - Intergenic
934207180 2:89941116-89941138 GATTCCTAATAAATTTCCCTTGG + Intergenic
934219356 2:90067646-90067668 GATATCAGATCACTGTCCCCTGG - Intergenic
934542101 2:95184068-95184090 GAATTGAGATGAATTTCCTCTGG + Intronic
934608448 2:95716268-95716290 GATGTCAGATGAATTCCCCAAGG + Intergenic
935635294 2:105245059-105245081 CATTTCAGATAATTTTCTTCAGG + Intergenic
936328095 2:111522922-111522944 GAATGCAAATAAATTTCCCTAGG + Intergenic
936541785 2:113358152-113358174 GATGTCAGATGAATTTCCCAAGG + Intergenic
939071856 2:137553711-137553733 GATTTCATTTAACTTTCCCATGG + Intronic
941841806 2:170093227-170093249 GATTTCAGTGAGATTTTCCCAGG - Intergenic
942275469 2:174319301-174319323 AATTTCTTATAAATTTCCCCTGG + Intergenic
944410815 2:199440466-199440488 TATTTCAAATAAATTTCTCATGG + Intronic
944521364 2:200571870-200571892 AAGTTCAGGTAAATTTCACCAGG + Exonic
946734448 2:222740404-222740426 CATTGCAGGTAAATTTCTCCAGG + Intergenic
946952271 2:224889913-224889935 GATTTCAGAGCAATTGCTCCAGG + Intronic
947049662 2:226027882-226027904 CATTTTAAAAAAATTTCCCCAGG + Intergenic
948256784 2:236574209-236574231 GATTTCAGAAAAGTCTCTCCTGG + Intronic
1169304898 20:4481213-4481235 GATTTCAGATAGCTTTCGCCTGG + Intergenic
1169921347 20:10737124-10737146 AATTTCAGATACTTTGCCCCTGG - Intergenic
1170507648 20:17044898-17044920 TATTGCAGCTAAATTTCCCTGGG + Intergenic
1170964099 20:21051070-21051092 TATTACAGGTCAATTTCCCCAGG + Intergenic
1172412207 20:34733489-34733511 GATGTCAGATAATTTACCCAAGG - Intronic
1175165718 20:57042955-57042977 GATTTCATTTTACTTTCCCCAGG - Intergenic
1175568802 20:60002765-60002787 GATTTCAAATAAATTACCAAAGG - Intronic
1177410464 21:20723572-20723594 TATTTTAGATAAGTTTCCACAGG - Intergenic
1178014474 21:28328187-28328209 TATTACAGGTAAATTTCCTCAGG + Intergenic
1179182241 21:39055225-39055247 CTATTCAGAAAAATTTCCCCAGG + Intergenic
1179375379 21:40846399-40846421 GATTACAGAGCAATTTCTCCCGG + Intronic
1179881120 21:44293731-44293753 GGGTTCAGCTACATTTCCCCCGG + Intronic
1185134474 22:49061764-49061786 GATTTCAAATAAATTACTCCAGG + Intergenic
950012852 3:9735306-9735328 GATTTCAGATAAGTCTGGCCAGG - Intronic
951023903 3:17810528-17810550 GATGTGAGATAAATTTCCACTGG - Intronic
951117681 3:18884713-18884735 GATTTCAAATAATTTTCCCTTGG + Intergenic
952870048 3:37890926-37890948 GATTTCAGATAGAATTTCCTTGG - Intronic
954417847 3:50402751-50402773 GAATTCTGATAAATTCCACCTGG - Intronic
954944943 3:54414839-54414861 TATTTAAAATAAATATCCCCAGG - Intronic
955141174 3:56271356-56271378 GAATTCAGTTATATTTCCCAAGG - Intronic
959839459 3:110957795-110957817 GCTTTCAGATACATGGCCCCAGG - Intergenic
959871214 3:111330609-111330631 GAGTGCATATAAATTTCCCAGGG + Intronic
960583391 3:119299262-119299284 GATTACAGACCATTTTCCCCTGG + Intronic
963449067 3:145454395-145454417 GAATTCTGATAAATATCCCAGGG + Intergenic
970189404 4:13498225-13498247 GAATTCAGTTAAATTTCTTCAGG - Intergenic
971543150 4:27847757-27847779 GAGTTCAGAAAAATTTGACCTGG + Intergenic
974753849 4:66178054-66178076 GATTACAGATAAATTTCTAAAGG + Intergenic
977065592 4:92310074-92310096 GTTTTCAGATAATTTTTGCCTGG + Intronic
977134091 4:93280497-93280519 AATATTAAATAAATTTCCCCAGG + Intronic
978876280 4:113643763-113643785 GATATAATTTAAATTTCCCCTGG - Intronic
978937555 4:114396504-114396526 GACTTCAGATATATTTTCCAAGG - Intergenic
980630638 4:135427272-135427294 CATTTCAGATCAATTACCTCTGG + Intergenic
981665953 4:147226883-147226905 GATTTCAGCCTATTTTCCCCTGG - Intergenic
982122122 4:152153061-152153083 GATTTCAGATAAATCTTTCAAGG - Intergenic
983839312 4:172436786-172436808 GATTTCAGCTTATTTTCCTCAGG + Intronic
984047592 4:174820332-174820354 AATTTCAGATAAATAACTCCAGG - Intronic
984283047 4:177695340-177695362 AATTTTTCATAAATTTCCCCAGG - Intergenic
987124072 5:14794555-14794577 GTCTTAAGATAAATGTCCCCAGG + Intronic
987357740 5:17080130-17080152 AATTTTAGATAAAGTTACCCTGG + Intronic
987672964 5:21036957-21036979 GATTTTAAAAAAATTTCCACTGG + Intergenic
991422983 5:66460281-66460303 GATGTCAGTTAAATTTGGCCAGG - Intergenic
992155537 5:73951907-73951929 GCTTCCAGATAAATATTCCCTGG - Intergenic
992413033 5:76526057-76526079 GATCTCAGATTAAGATCCCCTGG + Intronic
995966677 5:117915992-117916014 GCTCTCAGATATATTTCCACAGG - Intergenic
996228099 5:121026597-121026619 TAGTTCAGATAAAATTCTCCTGG + Intergenic
996878441 5:128265931-128265953 CATTTCAGACAGATTTCCCCCGG - Intronic
997361988 5:133301015-133301037 GTTTTCAGACACATTTCACCTGG - Intronic
999588409 5:153116998-153117020 GACTGTAGATAAATTTCTCCAGG + Intergenic
1001867588 5:175118766-175118788 GGGTCCAGATAAATCTCCCCTGG + Intergenic
1005017030 6:21384191-21384213 AATTTCAGAATAATTTCCCTAGG - Intergenic
1006697405 6:35942889-35942911 GATTTCATATACCTTTGCCCAGG + Intergenic
1009018153 6:57925922-57925944 CATTTCAAAAAAACTTCCCCTGG + Intergenic
1010065639 6:71679834-71679856 AATTTTAGCTAAGTTTCCCCTGG + Intergenic
1010749558 6:79602873-79602895 CATTTCAGATAACTTTCTTCTGG - Intergenic
1012452017 6:99362716-99362738 GAGATCAGAGAAATGTCCCCAGG + Intergenic
1014687782 6:124524908-124524930 GATGTCAGATAAAATCCCCACGG + Intronic
1014764467 6:125390784-125390806 GATTTCATATAATTTTACCCAGG + Intergenic
1015649902 6:135445259-135445281 GATTTTGGATAAATTTCATCTGG + Intronic
1016273096 6:142313574-142313596 ACTTTCAGAAACATTTCCCCTGG - Intronic
1016781975 6:147968850-147968872 CATTTAAGACAAATTGCCCCTGG - Intergenic
1018623571 6:165755395-165755417 CATTTCAAAGACATTTCCCCAGG - Intronic
1020863157 7:13520522-13520544 CATTTGAGATAGATTTCACCAGG + Intergenic
1021030629 7:15729552-15729574 GAGGTCAGATAAATTGCCCAAGG - Intergenic
1021687608 7:23202489-23202511 GGTTTCAAATATATATCCCCTGG - Intergenic
1023128457 7:36978285-36978307 GATGTCAGATAGATTTCATCTGG - Intronic
1023395144 7:39745306-39745328 GATATCAGTTCAATTTCCCGGGG + Intergenic
1023478969 7:40612614-40612636 GAGTTGAGGTAAATTTCCCAAGG - Intronic
1027855838 7:83509755-83509777 AATTTTAAAAAAATTTCCCCAGG + Intronic
1028091411 7:86707506-86707528 GATGTCAGATAACTTGCCCAAGG - Intronic
1028140398 7:87267507-87267529 TAGTTCAGGTAAATTTACCCAGG + Intergenic
1033502568 7:141966418-141966440 GATGTCAGCTGAATTTCACCTGG + Intronic
1033573626 7:142658419-142658441 CATTTCTGATAGATTTCCCCAGG + Intergenic
1036708482 8:11062023-11062045 GCTTTCAGATGATTTTCCCCTGG - Intronic
1038529720 8:28308472-28308494 GAATACAGATATGTTTCCCCAGG + Intergenic
1039030255 8:33300864-33300886 TTTTTCCAATAAATTTCCCCAGG - Intergenic
1041122022 8:54595565-54595587 GATTTTGGAGAAATCTCCCCTGG - Intergenic
1042086297 8:65112851-65112873 GATTTGAGGTAAATTCCTCCAGG - Intergenic
1043611403 8:82067773-82067795 GGTTTCAGATAAACTTCCTCTGG + Intergenic
1044321485 8:90806898-90806920 GATGTCAGATAACTTTCTCCAGG + Intronic
1045748295 8:105451209-105451231 AATTTGAGATAAATTTTCCTTGG + Intronic
1047910710 8:129526123-129526145 GATTGCACTTAATTTTCCCCAGG - Intergenic
1049395154 8:142396746-142396768 GACTTCAGGTAAGTTTCCCAAGG + Intronic
1050026739 9:1342612-1342634 GATTTCAGATATCTTTCTCAAGG + Intergenic
1050649401 9:7758884-7758906 GAATTCAGATAAATTATGCCAGG + Intergenic
1050865386 9:10490797-10490819 AATTTCAAATAAATGTTCCCTGG - Intronic
1052138025 9:24939920-24939942 GCATTTAGAAAAATTTCCCCAGG + Intergenic
1052397465 9:27957153-27957175 GATTTTTGATAAAGGTCCCCAGG - Intronic
1052560242 9:30076013-30076035 TATTTCAGACAAATGTCCACAGG + Intergenic
1052886226 9:33650798-33650820 CATTTCTGATAGATTACCCCAGG + Intergenic
1056429480 9:86513019-86513041 GAATTTAGATAAATTTCACTGGG + Intergenic
1057323781 9:94040462-94040484 AATTCCAGATTAATTTCCCCTGG + Intronic
1057476913 9:95411008-95411030 CATTTCAGATTATTTTCCACTGG - Intergenic
1058226924 9:102376384-102376406 TATTTCAGAACTATTTCCCCAGG + Intergenic
1059743854 9:117181294-117181316 GATGTCAAATAACTTGCCCCAGG + Intronic
1061030190 9:128077049-128077071 GATTTCAGATAAAGGGCCCTTGG - Intronic
1061199055 9:129125707-129125729 GATCTCAGTGAATTTTCCCCAGG - Intronic
1185546297 X:948206-948228 GATTTCAGCTAAATTCCCACAGG - Intergenic
1187258357 X:17661625-17661647 CATTTCAGATTATTTTCCCCAGG + Intronic
1187855338 X:23631617-23631639 GAGATCAAATAAATTTCCCAAGG + Intergenic
1194877231 X:99204265-99204287 TCCTTCAGATAAATTTCACCTGG + Intergenic
1195023155 X:100849412-100849434 GATTTCAGATCTATTTCTACTGG - Exonic
1195319779 X:103712214-103712236 GATTTCTTTTATATTTCCCCAGG + Exonic
1196030964 X:111095826-111095848 GATTTCAGATGAATTTTCAGGGG - Intronic
1196340936 X:114596707-114596729 GATTTCCAATTACTTTCCCCTGG + Intronic
1198117885 X:133562187-133562209 GATTTCACATAAATATTCCAAGG - Intronic
1198397363 X:136233667-136233689 GATGGCAGATAAATTTAACCAGG - Intronic
1199762792 X:150918046-150918068 GAATACAGATCAAATTCCCCAGG - Intergenic