ID: 1087558277

View in Genome Browser
Species Human (GRCh38)
Location 11:99750638-99750660
Sequence CAGTATATTTAGTTAGATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 171}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087558277 Original CRISPR CAGTATATTTAGTTAGATTC TGG (reversed) Intronic
908266982 1:62389219-62389241 TACTATTTTTAGTTAGAATCAGG - Intergenic
908654745 1:66376128-66376150 CAGTAAATTTTGTTATATCCTGG + Intergenic
908800954 1:67880253-67880275 AATTATATTTAGTTAGACACTGG - Intergenic
909041544 1:70658797-70658819 CAGGCTATTTAGTAAGATTTGGG + Intergenic
909786022 1:79614689-79614711 CATTATAGTTATTTATATTCAGG + Intergenic
911291198 1:96058387-96058409 GAGTATATATAGTTTGGTTCTGG + Intergenic
911977027 1:104510882-104510904 CAAAATATTTAGGTATATTCTGG - Intergenic
912785020 1:112594247-112594269 CAGTACATCTTGTAAGATTCAGG - Intronic
916316838 1:163458491-163458513 CAGCATATTCATTTAGAATCAGG + Intergenic
917236638 1:172899704-172899726 CAGAATATTAAGTTATAATCTGG - Intergenic
918267005 1:182852641-182852663 CAATATATTTAGTAAGAATAAGG - Intronic
919036949 1:192324207-192324229 CAATATCTTTAGTTATATTTTGG + Intronic
919085739 1:192918414-192918436 CATAATATTTAGGGAGATTCTGG - Intergenic
920211181 1:204329656-204329678 CTGTAAATGTAGTTAGATTTAGG - Intronic
920761250 1:208785553-208785575 AAGGATATTGAGATAGATTCTGG - Intergenic
920967102 1:210710359-210710381 CAGTATATGTAGATACATACAGG + Intronic
920980049 1:210825322-210825344 CAGAATATTAAGCTATATTCAGG + Intronic
921289457 1:213643495-213643517 AAGTACATTTAGTAATATTCTGG - Intergenic
922119367 1:222647960-222647982 CAGTATATTTACTGAGCTTATGG + Intronic
922664243 1:227455170-227455192 CTGTATATTTGGTTTGAATCAGG + Intergenic
922859923 1:228807759-228807781 CATTATATTTTATTAGCTTCTGG - Intergenic
924868508 1:248013322-248013344 AAGTATATTTATTCAGATTATGG - Intronic
1064440880 10:15352231-15352253 TAGTATATTTATTTTGAGTCAGG - Intronic
1068405275 10:56580706-56580728 CAGTATATAGATTTAGATTTGGG - Intergenic
1068578988 10:58717443-58717465 CATTACATTTACTAAGATTCTGG - Intronic
1069063509 10:63918624-63918646 CAAGATGTTTAGTTAGATTGTGG + Intergenic
1069504383 10:68984533-68984555 CAGTGTAATTTATTAGATTCTGG + Exonic
1069537058 10:69261663-69261685 CAGGATATTTTGTGAGATTGAGG - Intronic
1071150202 10:82625363-82625385 CTGTGTATTTAATTAAATTCTGG - Intronic
1072613850 10:97036591-97036613 CAATACATTGATTTAGATTCTGG + Intronic
1074910986 10:117908703-117908725 CTTTATATTCAGATAGATTCTGG + Intergenic
1077448898 11:2622203-2622225 CAGTATATTTTCTTATATTCTGG + Intronic
1079343993 11:19636120-19636142 CAGTACATTTTGTTAGCTTTTGG + Intronic
1079760771 11:24327411-24327433 CCATATATTTAGTGAGCTTCTGG - Intergenic
1080782419 11:35442403-35442425 CAGGATTTTTAGATATATTCTGG + Intronic
1086678927 11:89644312-89644334 CATTTAATTTATTTAGATTCTGG - Intergenic
1087558277 11:99750638-99750660 CAGTATATTTAGTTAGATTCTGG - Intronic
1088112303 11:106276902-106276924 CAGTCAATTTGCTTAGATTCTGG + Intergenic
1088592357 11:111414687-111414709 CAGTATGTTTAATGAGATCCGGG + Intronic
1090057250 11:123433766-123433788 CAGTAGATTTGGTTAGATTTAGG + Intronic
1092392590 12:8094445-8094467 CTGTATATTTAGTTCTATGCAGG + Intronic
1093907020 12:24704981-24705003 AAGTATATGTATTTAGGTTCAGG + Intergenic
1093976987 12:25434055-25434077 CATTATATTTACTAAGATTCTGG + Intronic
1094647812 12:32343995-32344017 CACTAAATTTTGTTACATTCTGG - Intronic
1095355908 12:41274951-41274973 CAGTATAATTAGGTAGATTCAGG + Intronic
1095927015 12:47588777-47588799 CATTATATTTAGGTAGCTGCAGG - Intergenic
1097340503 12:58431916-58431938 CTCTATATTTAGTTAGAATTAGG + Intergenic
1097442394 12:59626324-59626346 GAGTATATCTAGTTATGTTCTGG + Intronic
1098459032 12:70711468-70711490 TAGTATATTTATTTATATTTAGG + Intronic
1098779387 12:74666241-74666263 CACTTTTTCTAGTTAGATTCAGG + Intergenic
1099020757 12:77401234-77401256 CAGAATTTCTATTTAGATTCAGG - Intergenic
1101095506 12:101335007-101335029 CAGTATATATAGTGTGATCCAGG + Intronic
1101507041 12:105356758-105356780 CATTACATTTACTTAGTTTCTGG - Intronic
1101579094 12:106025799-106025821 CAATATATTTCATTAGATTCTGG - Intergenic
1104201026 12:126589089-126589111 AAGTACATTTATTTAGTTTCTGG - Intergenic
1106663894 13:31831555-31831577 TTGTATTTTTAGTTAGATACGGG - Intergenic
1108534814 13:51364018-51364040 AATTATATATATTTAGATTCTGG - Intronic
1108960447 13:56221401-56221423 CAGGATATTTAAATAGGTTCTGG + Intergenic
1110837071 13:80095124-80095146 CAGTATTTTTAGTCAAATTCAGG - Intergenic
1110966453 13:81704442-81704464 AAGCATATTTAGTGAGATTTAGG + Intergenic
1110983956 13:81939610-81939632 CAGTATATTTAATTAGCCTGTGG - Intergenic
1112109331 13:96277162-96277184 AAGTATATTTAGCAAGATACAGG - Intronic
1112481331 13:99778346-99778368 CAGATTATCTAGTTAGAGTCTGG + Intronic
1116948984 14:50861508-50861530 AAGTATATATAGGAAGATTCTGG - Intronic
1116950624 14:50875371-50875393 TAGTAAATGTAGTTAGATTTGGG + Intronic
1119533748 14:75382592-75382614 CAATATATATATTTAGAGTCAGG + Intergenic
1120308086 14:82795970-82795992 CAGGATATTCAGAGAGATTCCGG + Intergenic
1120389241 14:83884575-83884597 CAGAATATTTAGTTTTATTTTGG - Intergenic
1129480997 15:75826186-75826208 CAGTGTATTTACTTGCATTCTGG + Intergenic
1129625696 15:77196481-77196503 CAGTAAATTTAGAGAGATTTGGG - Intronic
1131710411 15:95047904-95047926 CAGTACATTAATTTTGATTCTGG - Intergenic
1133038704 16:3048300-3048322 AAGTATATTTGGTTAGAGACTGG - Intronic
1137329852 16:47482350-47482372 AAGTATATCTAGTTTTATTCTGG + Intronic
1147015419 17:37488574-37488596 CAGCATACTTTGCTAGATTCAGG - Intergenic
1149273329 17:55007164-55007186 TTGTATATTTAGTTAGAGACAGG - Intronic
1149941028 17:60866510-60866532 CAATATATTTATTTAGTTTTTGG + Intronic
1150177754 17:63079445-63079467 CAGGATTTTCAGTTATATTCAGG + Intronic
1150419741 17:65022009-65022031 CCTTATATTTAACTAGATTCTGG + Intronic
1152170969 17:78748151-78748173 CAGCATCTTTAGTTTGTTTCCGG - Intronic
1153002304 18:466509-466531 CATTTTCTATAGTTAGATTCTGG - Intronic
1153029073 18:696782-696804 CATTTTATTCAGTTAAATTCAGG - Intronic
1158964434 18:62610938-62610960 CATTCTATTTAGTTAGAACCAGG + Intergenic
1159975295 18:74703795-74703817 CTGTATATTTAGAAAGAGTCTGG - Intronic
925561056 2:5195846-5195868 TAGTTTATTTGGTTAGAATCAGG - Intergenic
930524042 2:52503949-52503971 CAGGATATTTAGAAAGATACAGG + Intergenic
931726263 2:65114118-65114140 AAGTATATGAAGTTAAATTCTGG + Intronic
932443491 2:71755094-71755116 CTGTATCTATACTTAGATTCAGG + Intergenic
934153060 2:89168233-89168255 CAGTATATGAAATGAGATTCAGG + Intergenic
934214180 2:90013698-90013720 CAGTATATGAAATGAGATTCAGG - Intergenic
937043653 2:118839209-118839231 GAGTATATTTATTTAGGTTTGGG - Intergenic
940730072 2:157378548-157378570 CATTACATTTACTAAGATTCTGG + Intergenic
942041593 2:172069760-172069782 CAGAATATAGAGGTAGATTCAGG - Intronic
942192624 2:173485367-173485389 CAGTGTATCTGTTTAGATTCTGG + Intergenic
942738904 2:179150210-179150232 CAGTTTATTTATTTAGAGACAGG - Intronic
944138396 2:196427180-196427202 CAGTATATTGATTTACATTTTGG + Intronic
945633358 2:212313472-212313494 CAGTAGAGTTAGTTATATACTGG - Intronic
1169424815 20:5487559-5487581 TTGTATTTTTAGTTAGATACAGG + Intergenic
1171039178 20:21743840-21743862 CATTGTATTTAGTTATATTTTGG + Intergenic
1174662739 20:52228430-52228452 CATTATATTGTGTTATATTCAGG - Intergenic
1177048478 21:16201453-16201475 CAGTATATTCAGTTAGCCACAGG + Intergenic
1177446181 21:21199178-21199200 CAGGATATTTTTTTGGATTCAGG + Intronic
1178011619 21:28293273-28293295 CAGTATATTTGTTTGGATTTAGG - Intergenic
1179391054 21:40991593-40991615 CAGAATATTTAAAGAGATTCTGG + Intergenic
1182178350 22:28317416-28317438 CAATTTACCTAGTTAGATTCAGG + Intronic
950822531 3:15776467-15776489 CAGTATATTTTCTTCGAGTCTGG - Intronic
950992975 3:17461147-17461169 CAGTATAATTAGGTAGTTTATGG + Intronic
951310403 3:21118087-21118109 CAGAATATTTGATTTGATTCTGG - Intergenic
952385585 3:32839401-32839423 TTGTATTTTTAGTTAGATACAGG + Intronic
952559296 3:34571622-34571644 CAGAATATTTTGTGAGATTTGGG - Intergenic
956522336 3:70119385-70119407 CAGTATATTTACTTAGAAAACGG + Intergenic
957876349 3:86151629-86151651 CAGTTTATTTAGTTAGAAGAAGG + Intergenic
958655050 3:96990593-96990615 CATTATATTTAATTAGAATCAGG - Intronic
959086999 3:101862133-101862155 TAATATAGTTAGTTAGACTCTGG + Intergenic
959219792 3:103502446-103502468 CACTATGTTTACTTAAATTCTGG + Intergenic
959442817 3:106399564-106399586 CAGTTGGTTTAGTTAGATTAAGG - Intergenic
959983946 3:112551772-112551794 AACTATATTTAGCTAGGTTCTGG - Intronic
961129655 3:124454197-124454219 CATTGTATTTATTTAGATCCTGG + Intronic
961131803 3:124475366-124475388 CAGTTTATATAATTAGAATCTGG - Intronic
963497117 3:146079424-146079446 CACTATATTTAATGAGATTTAGG + Intronic
971060733 4:22966300-22966322 CAGAATATTTAGTTATTTTTTGG + Intergenic
972058978 4:34844148-34844170 CATTATTTTTTGTGAGATTCAGG - Intergenic
973846537 4:54918443-54918465 ATGTTTATATAGTTAGATTCAGG - Intergenic
974009410 4:56593352-56593374 CAGTATATTTGGCTCGAGTCTGG - Intronic
976458376 4:85277905-85277927 TAGTATCTTTGGTTAGATTCTGG - Intergenic
976522405 4:86043938-86043960 CATTGTATTCAGTTAGATTTGGG - Intronic
981532044 4:145762549-145762571 CAGGCAATTTAGGTAGATTCTGG + Intronic
982897391 4:160950067-160950089 CAGTATATTAAATTAGATTGTGG + Intergenic
984279241 4:177648452-177648474 TATTATATTTAGTAAGATTGTGG - Intergenic
985132280 4:186750696-186750718 CAAGATGCTTAGTTAGATTCAGG - Intergenic
986858250 5:11897450-11897472 CAGTATAAATAATTAGATTTTGG - Intronic
986917226 5:12636095-12636117 CAGTAGATTCAGATAGACTCTGG + Intergenic
988436732 5:31184199-31184221 CAATATATTTAATGAGGTTCAGG - Intergenic
989733521 5:44675688-44675710 CAGGATATTTAGCAACATTCTGG + Intergenic
990959286 5:61377002-61377024 CATTACATTTACTAAGATTCTGG - Intronic
992877801 5:81075171-81075193 CAGTATAAGTAGTTGGATTCTGG + Intronic
993373217 5:87117912-87117934 CAGTCTATTGAGTAAGATCCAGG - Intergenic
993623086 5:90190884-90190906 CAGAATATTGATTTAGATTTCGG + Intergenic
993655463 5:90572960-90572982 CTGTATATTTTGTTAAACTCAGG + Intronic
993736340 5:91480537-91480559 CAGTTTATGTAGTTATTTTCGGG + Intergenic
995513523 5:112931314-112931336 CAGCATATTTTGTTGGAGTCAGG + Intergenic
1001996572 5:176165328-176165350 CAATATATTTAGTTTGAATACGG - Intergenic
1003722776 6:8723408-8723430 CAGAATGTTTGGTTAGAATCTGG + Intergenic
1005032202 6:21521001-21521023 GAGTGTATTTAGTTAGATAAAGG + Intergenic
1005152051 6:22762919-22762941 CAGGATCTTTAATTAGATTAGGG - Intergenic
1009481700 6:64167211-64167233 CCATATATTTATTTAGTTTCTGG + Intronic
1009934276 6:70215445-70215467 TAGTATCTTTAGTTAGTTTATGG - Exonic
1013456925 6:110338147-110338169 ATGTATATTTAGCTAGATTAAGG - Intronic
1021590674 7:22257864-22257886 CATTATATTTAATTAAAGTCAGG + Intronic
1022593668 7:31690635-31690657 CAGGTTATTTAGTTTGAATCTGG - Intronic
1024882484 7:54104601-54104623 CAGTATATTTAAATAGCTACAGG + Intergenic
1027212264 7:76159707-76159729 TTGTATTTTTAGTTAGATACGGG - Intergenic
1027414145 7:77957289-77957311 CATAAAATTTAGTTAGATTTGGG + Intronic
1027966326 7:85014322-85014344 TAGTATATTTAGCTAGCATCAGG + Intronic
1028597479 7:92561111-92561133 CATTACATTTACTAAGATTCTGG + Exonic
1028891588 7:95994001-95994023 CAGTTTATTTAGTAACACTCAGG + Intronic
1035039903 7:155919956-155919978 CAGGATGTTTTGTTACATTCAGG - Intergenic
1037088509 8:14882893-14882915 CCATATATTTTGTTAAATTCTGG - Intronic
1037874552 8:22534728-22534750 CAGTTTATTTATTTATATTTCGG - Intronic
1040607965 8:48953300-48953322 CAGTATATGTTGTTAAATTTTGG + Intergenic
1040615547 8:49033400-49033422 TTGTATATTGAATTAGATTCTGG - Intergenic
1041460475 8:58105988-58106010 CAGTGTATTTATTTATATTGGGG - Intronic
1043267271 8:78282206-78282228 TAGTATATTTAGGTATATTGAGG + Intergenic
1045530580 8:102981527-102981549 CAGAAAATTTAGCTAAATTCTGG - Intergenic
1046272845 8:111918425-111918447 CAGAACATTTAGAGAGATTCTGG - Intergenic
1050161658 9:2726039-2726061 CAGTATATTAAGATGGATTGCGG + Intronic
1055276936 9:74628415-74628437 CAGGATATTTAGCTAATTTCTGG + Intronic
1055563556 9:77546042-77546064 TTGTATATTTAGTTAGAGACGGG - Intronic
1057202463 9:93149466-93149488 ACGTTTATTTAGTTATATTCTGG - Intergenic
1187037194 X:15553157-15553179 CAGTGTAGTTAGTTGGATTTTGG + Intronic
1187281778 X:17862882-17862904 CTGTGTCTTTAGTTGGATTCAGG - Intergenic
1188218965 X:27516323-27516345 AAGTATTTTTAGTTAGATACTGG + Intergenic
1188619013 X:32196503-32196525 CTGAATATTTAGTTTGCTTCAGG + Intronic
1188788069 X:34373607-34373629 TAGTATATGAAGTTAGAATCAGG - Intergenic
1193318440 X:80092276-80092298 TAGTATATTCAGGTATATTCAGG + Intergenic
1196345331 X:114649065-114649087 CAGTACATAAATTTAGATTCAGG + Intronic
1196578147 X:117345767-117345789 CATTTAATTAAGTTAGATTCAGG - Intergenic
1198204724 X:134454956-134454978 TTGTATTTTTAGTTAGAGTCAGG + Intergenic
1202161957 Y:21943506-21943528 AGGTATATTTAGATAGATTTTGG + Intergenic
1202229399 Y:22642867-22642889 AGGTATATTTAGATAGATTTTGG - Intergenic
1202313756 Y:23553298-23553320 AGGTATATTTAGATAGATTTTGG + Intergenic
1202360176 Y:24100573-24100595 TATTATATTTAGTTACATTTGGG - Intergenic
1202510601 Y:25569541-25569563 TATTATATTTAGTTACATTTGGG + Intergenic
1202557046 Y:26117297-26117319 AGGTATATTTAGATAGATTTTGG - Intergenic