ID: 1087564836

View in Genome Browser
Species Human (GRCh38)
Location 11:99841652-99841674
Sequence AAGGAGAAGGAGAATGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3640
Summary {0: 1, 1: 11, 2: 79, 3: 505, 4: 3044}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087564836 Original CRISPR AAGGAGAAGGAGAATGAAGA AGG Intronic
Too many off-targets to display for this crispr