ID: 1087567031

View in Genome Browser
Species Human (GRCh38)
Location 11:99874048-99874070
Sequence CTGGGAACTCTGAAAGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 387
Summary {0: 1, 1: 0, 2: 3, 3: 53, 4: 330}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087567031 Original CRISPR CTGGGAACTCTGAAAGAGGG AGG Intronic
900343385 1:2199213-2199235 CTGGGGACTTTGAGAGAGGGCGG - Intronic
900478161 1:2885820-2885842 CTGGCATCCCTGTAAGAGGGGGG - Intergenic
901053920 1:6440058-6440080 CAGGGACCTCTGAGGGAGGGTGG + Intronic
902409739 1:16205902-16205924 CTGGGGGCTCTGAAAGGGGCGGG - Intronic
902955915 1:19924007-19924029 GTGGAAACTCTGAAACAGGACGG - Intergenic
903157739 1:21459668-21459690 CTGGGAACGCTGAAGATGGGAGG + Intronic
903256598 1:22106433-22106455 CTCAGAACTCTGGAAGAAGGGGG - Intergenic
904233406 1:29096582-29096604 CTGGAAACTTCGAATGAGGGTGG - Intronic
904243762 1:29170793-29170815 AGAGGAAGTCTGAAAGAGGGAGG - Intronic
904825816 1:33273062-33273084 CTGGGACCTGTACAAGAGGGTGG - Intronic
905493183 1:38361389-38361411 CTGGCAACTCTCAGAGAGGTGGG + Intergenic
905618617 1:39420567-39420589 CAGGGAACACTGAAAAAGGAAGG - Intronic
906187414 1:43871972-43871994 CTGGGATGTGAGAAAGAGGGTGG + Intronic
906265832 1:44428657-44428679 ATGCGAAGTCGGAAAGAGGGAGG - Intronic
906546272 1:46621374-46621396 CTGGCAACTCTGAGGCAGGGAGG - Intergenic
908651392 1:66337092-66337114 CTTAGAACTCTGTAAGAGAGAGG + Intronic
909416265 1:75409168-75409190 CTGGAGACTCTAAAAGATGGGGG + Intronic
909725187 1:78826522-78826544 CTGGGAATTCTGAAATCAGGGGG - Intergenic
911666683 1:100560945-100560967 CCGGGAAGTCTTAAGGAGGGAGG + Intergenic
911709120 1:101048895-101048917 CTGGGGACTCCAAAAGGGGGAGG + Intergenic
911860708 1:102944481-102944503 CTGGGATAACTGAAAGAGGATGG + Intronic
913044806 1:115064821-115064843 CTGGAATATGTGAAAGAGGGAGG + Intronic
913544483 1:119853720-119853742 CTGGGAACGCTGAAGGTGGGAGG - Intergenic
913602316 1:120433658-120433680 CTGGGAACGCTGAAGGTGGGAGG + Intergenic
913991862 1:143620499-143620521 TTGGGAACGCTGAAGGTGGGAGG - Intergenic
914084730 1:144442979-144443001 CTGGGAACGCTGAAGGTGGGAGG - Intronic
914190742 1:145408145-145408167 CTGGGAACGCTGAAGGTGGGAGG - Intergenic
914363490 1:146957264-146957286 CTGGGAACGCTGAAGGTGGGAGG + Intronic
914488187 1:148129870-148129892 CTGGGAACGCTGAAGGTGGGAGG - Intronic
914588551 1:149084990-149085012 CTGGGAACGCTGAAGGTGGGAGG - Intronic
917124071 1:171670521-171670543 CTGGGAACGCCGAAGGTGGGAGG + Intergenic
921013012 1:211161568-211161590 CTGGGAGCTCTGTCCGAGGGAGG + Intergenic
921396888 1:214678003-214678025 CTGGGAAATCTTAAAGAGAGGGG + Intergenic
1063146149 10:3296874-3296896 CTGGCAACTCTCAAAGAGGGAGG + Intergenic
1063611047 10:7562204-7562226 CTGGGAACTATGACAAAGGCTGG + Exonic
1064020086 10:11801977-11801999 CTGGAGACTCAGAAGGAGGGAGG + Intergenic
1064832409 10:19485162-19485184 TTGGAAACTCAGAAAGAGGGAGG + Intronic
1065082311 10:22140605-22140627 CTGCAAACTCTGAAAAAGAGGGG + Intergenic
1065821817 10:29532710-29532732 CTGTGAAATCTGACAGAGAGCGG + Exonic
1066463323 10:35631699-35631721 CTGGGGACTCCAAAAGTGGGAGG - Intergenic
1066471495 10:35702226-35702248 CTGGGGACTCTAGAAGGGGGAGG - Intergenic
1067083731 10:43227497-43227519 CTGGGGAAGCTGAAAGAAGGTGG + Intronic
1067299118 10:44993340-44993362 CTGGGGACTTTGGAAGAGGCAGG - Exonic
1070536612 10:77383151-77383173 CAGGGTTCTCTGAATGAGGGAGG - Intronic
1070795616 10:79214706-79214728 CTGGTACTTCTGAAAAAGGGGGG - Intronic
1071292994 10:84200900-84200922 CTGGGGACGTTGGAAGAGGGAGG - Intronic
1071500400 10:86199629-86199651 CTGGGTGCCCTGAAAGAGCGTGG - Intronic
1072544941 10:96429991-96430013 CTGGGAAGTATGAAGGATGGTGG + Intronic
1072682309 10:97516306-97516328 CTGGGTCCTCTGTAAGAGGGAGG - Intronic
1072722384 10:97789022-97789044 CCGAGAACTCTGCAGGAGGGTGG - Intergenic
1072747982 10:97955181-97955203 CTGGTGAATCTGAAGGAGGGTGG - Intronic
1073637893 10:105218450-105218472 ATGGAAACTCTGTAAGAGGAGGG - Intronic
1074904196 10:117846756-117846778 CTGGGAACACTTAAGCAGGGAGG - Intergenic
1076115482 10:127894116-127894138 CAGGGAACTCTCAAAGAGCCTGG + Intergenic
1077609806 11:3637229-3637251 CGGTGAACTCTGGCAGAGGGAGG + Intergenic
1078406194 11:11071887-11071909 CTGAGAACTGTGAAAAGGGGTGG - Intergenic
1078447402 11:11414688-11414710 CTGGGAGCTCTGTAAGAGCAGGG + Intronic
1078456896 11:11482493-11482515 CTGGGCTCACTGAGAGAGGGAGG + Intronic
1079168863 11:18072946-18072968 CTTGGAACTCTGTGAGAGAGTGG - Intronic
1079186392 11:18241736-18241758 CTGGAGACTCAGAAAGATGGAGG + Intronic
1079581272 11:22067238-22067260 CTGGGAACTCTGTCCCAGGGAGG - Intergenic
1084674992 11:70629131-70629153 CTTGGAACACTGACAGAGGAGGG - Intronic
1087242072 11:95790683-95790705 CTGGGCAGGCTGAAAGATGGCGG + Exonic
1087260933 11:96011554-96011576 CTGGGGACTCCAAAAGGGGGAGG + Intronic
1087567031 11:99874048-99874070 CTGGGAACTCTGAAAGAGGGAGG + Intronic
1087915335 11:103803459-103803481 CTGGGAACTCTTGAGAAGGGTGG - Intergenic
1089877789 11:121742297-121742319 CTGGGAAGTCTGACAGGGAGGGG + Intergenic
1090242307 11:125192750-125192772 CTGTGGCCTCTGAAACAGGGAGG - Intronic
1090824580 11:130375380-130375402 CTGAGAACTCTAAAGGATGGGGG - Intergenic
1091252827 11:134158172-134158194 CTGGGAGGTTTGAATGAGGGTGG - Intronic
1091845374 12:3652087-3652109 CTGGGAATTGAAAAAGAGGGAGG - Intronic
1092037957 12:5357004-5357026 CTGGGATTTCTGAGAGAGGCAGG - Intergenic
1093524297 12:20089869-20089891 CTGGGGACTCCGAAAGAGGCAGG + Intergenic
1094174949 12:27531690-27531712 GTGGGGAGTCTGAAAGGGGGAGG + Intronic
1094612890 12:32010618-32010640 CTGGGAAAGCTGGAAGATGGGGG + Intergenic
1095226336 12:39681306-39681328 CTGGGGACTCTGGTGGAGGGTGG + Intronic
1097395601 12:59070291-59070313 CTGGTAAATGTGAAATAGGGTGG + Intergenic
1097988445 12:65808931-65808953 CTGGAAACTGAGAAAGAGGATGG - Intergenic
1098641310 12:72840920-72840942 CTGGCAACCCTGAAAGAGAAAGG + Intergenic
1100022038 12:90080985-90081007 CTGGGAATTCCAAAAGAGGGAGG + Intergenic
1100411254 12:94322031-94322053 CTGGGAACTCTGTCCCAGGGAGG + Intronic
1100411392 12:94322833-94322855 CTGGGAACTCTGTCCCAGGGTGG + Intronic
1100637945 12:96453609-96453631 CTGGGGACTCCAAAAGGGGGAGG + Intergenic
1100706825 12:97209930-97209952 CTGAGAATTCTGATACAGGGTGG - Intergenic
1100893853 12:99157643-99157665 CTGGAGACTCAGAAAGGGGGAGG + Intronic
1101464474 12:104933906-104933928 CTGGAGACTCAGAAAGGGGGAGG + Intronic
1101745384 12:107537819-107537841 CTGGGGACTCTGAAAAACTGCGG - Intronic
1101822066 12:108191819-108191841 AAGGGAGCTCTGAAAGTGGGGGG + Intronic
1102547992 12:113670456-113670478 CTGGGGCCTCTGGAAGTGGGTGG + Intergenic
1102731970 12:115119405-115119427 CTGGGAAGGATGAAAGAGAGTGG + Intergenic
1102744937 12:115242269-115242291 CTGGGAAGTCAGAGAGAGGGTGG + Intergenic
1102934465 12:116884828-116884850 CTGGGGACTTGGGAAGAGGGAGG + Intergenic
1103343223 12:120232378-120232400 CTGGGACCTCTGGAGGAGGGAGG - Intronic
1105214990 13:18278881-18278903 CTGGGAGCTAAGAAAGAAGGGGG + Intergenic
1105734288 13:23251663-23251685 CTGGGGAGTCTGAGACAGGGAGG + Intronic
1106610491 13:31274857-31274879 CTGGGGACTCTAAAAAGGGGAGG - Intronic
1106695165 13:32164952-32164974 CTGAGAGCTTTGAAAGAGGAGGG - Intronic
1107175812 13:37396540-37396562 TTGGCAACTCTGAAAGAGAAAGG + Intergenic
1108854537 13:54775977-54775999 CTGCCAACTCTGAAAGGGGCGGG + Intergenic
1109212231 13:59547867-59547889 CTGGGCACTCTGAGAGAGGTAGG - Intergenic
1110797185 13:79652955-79652977 CTGTGAACTGTGAATGAGGAGGG + Intergenic
1113751686 13:112780914-112780936 CTGGGAACGCGGAGAGAGAGAGG + Intronic
1114255935 14:21001389-21001411 GAGGGGACTCTGAAGGAGGGCGG + Exonic
1114491501 14:23105112-23105134 CTGGCACCTCTGGAAGAGGGTGG - Intergenic
1114645074 14:24251159-24251181 CTGAGCTCTCTGAAGGAGGGAGG + Intronic
1114666358 14:24379384-24379406 CTAAGATCTCTGAGAGAGGGTGG + Exonic
1115494825 14:33992793-33992815 GTGGGAAATGTGTAAGAGGGAGG + Intronic
1115740382 14:36381550-36381572 TTGGAGACTCAGAAAGAGGGAGG + Intergenic
1117207162 14:53455300-53455322 CTGGAGACTCAGAAAGAGTGAGG + Intergenic
1117642628 14:57816363-57816385 CTGGGAGGGCTGAAAGAGTGGGG - Intronic
1121404926 14:93713935-93713957 CTGGGAGCCCTGGAAGATGGTGG + Intergenic
1202836192 14_GL000009v2_random:79017-79039 CTGGGAGCTCTGACTCAGGGAGG - Intergenic
1124346846 15:28928734-28928756 CTGGTGACTCTGGCAGAGGGAGG - Intronic
1124393643 15:29281981-29282003 CTGGGACCTGAGAAAGGGGGAGG + Intronic
1125073884 15:35590194-35590216 CTGGGAATTCTGAAAGGGAGGGG - Intergenic
1126105588 15:45144946-45144968 CGGGGAGCTCTGAAGGAGAGCGG + Exonic
1127520989 15:59742781-59742803 CTAGGAACTGTGCCAGAGGGTGG + Intergenic
1128254043 15:66184375-66184397 GTGGGAGCTGTGGAAGAGGGAGG - Intronic
1128299983 15:66560577-66560599 CTGGGAATTTTGAAGGAGGAAGG - Intronic
1129275327 15:74441683-74441705 CTGGGTAAGCAGAAAGAGGGAGG + Intergenic
1130680902 15:85995912-85995934 CTGGGGACTCCAAAAGAGGGGGG + Intergenic
1133733405 16:8595466-8595488 CTGGGAACTGGGAAAGGGGAAGG - Intergenic
1134095034 16:11413406-11413428 CTGGGTAATCTGAAACAGGAGGG + Intronic
1134634448 16:15781616-15781638 AGGGGAACTCTGAAAGTGGATGG - Intronic
1135799604 16:25480351-25480373 CTGGAAACTCAGAAAGGGAGGGG + Intergenic
1136033171 16:27518240-27518262 CAGGGAACACTGAATGACGGAGG + Intronic
1136267108 16:29128259-29128281 CAGGGAGCAGTGAAAGAGGGAGG + Intergenic
1136289789 16:29264679-29264701 CTGGGAGCTCTGACAGGGAGGGG + Intergenic
1136543751 16:30943833-30943855 AAGGGAACTATGAAAGAGAGGGG - Intronic
1137039134 16:35593406-35593428 CTTGGAACTGTGAAAGATGTTGG - Intergenic
1137355833 16:47762906-47762928 CTGGGGACTCCAAAAGAGGGAGG + Intergenic
1138111802 16:54330021-54330043 CTGGGAATCCTGAAAGGTGGAGG - Intergenic
1138178125 16:54921751-54921773 TTTGGAACTGTGAAAGGGGGCGG - Intergenic
1138194904 16:55044830-55044852 CTGGGAACTGGGAAAAAGGGTGG - Intergenic
1138440026 16:57028635-57028657 CTGGGATTTCAGAAAGAGGGAGG - Intronic
1140748766 16:78004472-78004494 CAGATAAATCTGAAAGAGGGTGG + Intergenic
1141258798 16:82431629-82431651 CTGGGGACTCCAAAAGTGGGAGG + Intergenic
1141417495 16:83887688-83887710 CGGGGAATTCAGAAGGAGGGAGG + Intergenic
1142070399 16:88088582-88088604 CAGGGAGCAGTGAAAGAGGGAGG + Intronic
1142398735 16:89848160-89848182 CTGGGCACAGTGACAGAGGGCGG - Intronic
1142511328 17:395498-395520 CTCGTAACTCTGAAAGAGATTGG - Intergenic
1143173950 17:4945906-4945928 CTGGGAACGCCGAAGGTGGGAGG + Exonic
1143341298 17:6213408-6213430 ATGAGAACTCTGGAAGATGGTGG - Intergenic
1146708918 17:35023846-35023868 CAGGGAACTCTGAAATAAGCTGG + Intronic
1147211351 17:38874249-38874271 CTGGGGCCTTTAAAAGAGGGGGG + Intronic
1147384161 17:40071887-40071909 CTGGGTACCCAGAAAGAGGCTGG - Intronic
1148584707 17:48769157-48769179 CTGAGGACTCTGCAAGAGGAGGG + Exonic
1148638699 17:49168901-49168923 GTGGGAAGGCTGAAAGAGTGAGG + Intronic
1148830247 17:50426335-50426357 CTGCCAACTCCGAGAGAGGGCGG - Exonic
1149038044 17:52157358-52157380 CTGGGAACTTTGAAAGCCAGGGG + Intronic
1153560497 18:6367724-6367746 ATGGGAAATCTGGAAGTGGGTGG - Intronic
1153769435 18:8403363-8403385 CTGGGAACTCCAAAAGAGCAGGG + Intronic
1155184672 18:23376747-23376769 CTTGGAACTGTGGAAGATGGGGG + Intronic
1156788906 18:40948614-40948636 CTGGGCTCTGTGAAAGAGTGTGG - Intergenic
1157114683 18:44851916-44851938 GTTGGCACTCAGAAAGAGGGTGG - Intronic
1157115981 18:44863247-44863269 CTGGGGACTCTGAAACAGGCAGG - Intronic
1157904844 18:51560615-51560637 CTGGGATCTCTGGAAGAGGGAGG + Intergenic
1158294098 18:55974889-55974911 CTGTGAACTCTGTATGAGTGTGG - Intergenic
1159823018 18:73170912-73170934 CTGGGAACTCCTAAAGGGAGTGG - Intronic
1160350489 18:78174302-78174324 CTGCGAGCTCTGAATGAGGGAGG + Intergenic
1160677622 19:399710-399732 CTGGGAACCCTGGAAGAGTGAGG - Intergenic
1160677632 19:399739-399761 CTGGGAACCCTGGAAGAGTGAGG - Intergenic
1160677719 19:399977-399999 CTGGGAACCCTGGAAGAGTGAGG - Intergenic
1160677729 19:400006-400028 CTGGGAACCCTGGAAGAGTGAGG - Intergenic
1160677739 19:400035-400057 CTGGGAACCCTGGAAGAGTGAGG - Intergenic
1160677749 19:400064-400086 CTGGGAACCCTGGAAGAGTGAGG - Intergenic
1160677759 19:400093-400115 CTGGGAACCCTGGAAGAGTGAGG - Intergenic
1160677769 19:400122-400144 CTGGGAACCCTGGAAGAGTGAGG - Intergenic
1160677848 19:400331-400353 CTGGGAACCCTGGAAGAGTGAGG - Intergenic
1160677858 19:400360-400382 CTGGGAACCCTGGAAGAGTGAGG - Intergenic
1160677937 19:400569-400591 CTGGGAACCCTGGAAGAGTGAGG - Intergenic
1160677947 19:400598-400620 CTGGGAACCCTGGAAGAGTGAGG - Intergenic
1160677957 19:400627-400649 CTGGGAACCCTGGAAGAGTGAGG - Intergenic
1160677987 19:400716-400738 CTGGGAACCCTGGAAGAGTGAGG - Intergenic
1160678030 19:400835-400857 CTGGGAACCCTGGAAGAGTGAGG - Intergenic
1160678040 19:400864-400886 CTGGGAACCCTGGAAGAGTGAGG - Intergenic
1160967341 19:1752581-1752603 CTGGGAACTGGGATAGATGGGGG - Exonic
1161142229 19:2654579-2654601 CTGGGACCTCAGCAAGGGGGAGG - Intronic
1164535201 19:29080783-29080805 CTAGGAACTCTGAAAGAGACTGG + Intergenic
1164611704 19:29636810-29636832 TGGGGAACTCTTAGAGAGGGAGG - Intergenic
1165269113 19:34689565-34689587 CTGGGAAGTCGGAAAGAGCTTGG + Intergenic
1166536376 19:43577289-43577311 CTGGGACCTCAGGAAGAGAGAGG + Intronic
1167366756 19:49058556-49058578 CTGGGGACCCAGAAAGATGGGGG - Exonic
1167846847 19:52171633-52171655 TTGGGAACCCTGAAAGGGTGGGG + Intronic
1202636444 1_KI270706v1_random:48345-48367 CTGGGAGCTCTGACTCAGGGAGG + Intergenic
926604262 2:14881347-14881369 CTGGGAACTCCAAAAGTAGGGGG + Intergenic
926631460 2:15140257-15140279 CTGGGAAAACTGAAAGGGTGGGG - Intergenic
928567180 2:32564848-32564870 CTTGGACCTCTGGGAGAGGGAGG + Intronic
928572943 2:32627123-32627145 CTGGGCAATAGGAAAGAGGGAGG - Intergenic
930169520 2:48236700-48236722 GTGAGCTCTCTGAAAGAGGGCGG - Intergenic
930277120 2:49324708-49324730 CTGGGGACTCCAAAGGAGGGAGG + Intergenic
934954492 2:98606239-98606261 CTGGGGACTCTGAAAGACCAAGG - Intronic
935329381 2:101965360-101965382 CTGGAAACTCTGGAGGTGGGTGG + Intergenic
937969031 2:127535766-127535788 CTGGGCACCCTGAAAGAGCCAGG - Intergenic
938246246 2:129780024-129780046 CTGGGGAGCCTGAATGAGGGTGG - Intergenic
938282268 2:130072756-130072778 CTGGGAGCTCTGACTCAGGGAGG + Intergenic
938332896 2:130461328-130461350 CTGGGAGCTCTGACTCAGGGAGG + Exonic
938356912 2:130659343-130659365 CTGGGAGCTCTGACTCAGGGAGG - Intergenic
938433348 2:131266149-131266171 CTGGGAGCTCTGACTCAGGGAGG - Intronic
938637217 2:133241703-133241725 CTGGGATATGTGAAAGAAGGAGG - Intronic
938866021 2:135421574-135421596 GTTGGAAATCTGGAAGAGGGAGG - Intronic
938980368 2:136520595-136520617 CTGGGAAATCTGAAAAAGATTGG + Intergenic
939460177 2:142488754-142488776 CAGGGAACTCATGAAGAGGGTGG - Intergenic
939541982 2:143505268-143505290 CTGGGACCTCTTATGGAGGGAGG - Intronic
940012105 2:149065458-149065480 TTTAGAACTCTGAAAGAAGGTGG + Intronic
940035079 2:149304294-149304316 CTGGGAGCTCTGCAAAAGAGAGG - Intergenic
940246927 2:151628952-151628974 CTGCCATCTCTGAAAGAGGTGGG - Intronic
942611824 2:177750149-177750171 CAGGGATCTCTGAAAGGAGGTGG - Intronic
943699309 2:190972502-190972524 GTTGCAGCTCTGAAAGAGGGTGG - Intronic
944471439 2:200057141-200057163 TTGGCATCTCTGAAAGAGAGAGG + Intergenic
945026854 2:205627921-205627943 CTGGGAAGCCTGCAAGAGGGAGG + Intergenic
946427092 2:219605132-219605154 CTGGGCATTTTAAAAGAGGGCGG + Intronic
948100755 2:235370891-235370913 CTGGGAAGTCTGGAAGTGAGAGG - Intergenic
948567093 2:238894199-238894221 CTGGGAACCCCGGAAGAGGGTGG - Intronic
948948093 2:241231673-241231695 GTGGGATCTCTGAGTGAGGGAGG - Intronic
1168848000 20:958615-958637 CAGGGAAGTCAGAGAGAGGGTGG + Exonic
1169513731 20:6294267-6294289 CTGGAGACTCAGAAAGGGGGAGG - Intergenic
1169698587 20:8420531-8420553 CTGGGGATTCCAAAAGAGGGTGG - Intronic
1170430565 20:16272887-16272909 CTGGGACCTCCCAAAGTGGGTGG - Intronic
1170748225 20:19120030-19120052 CTGGGACCTCTGAGAGAAAGAGG + Intergenic
1171755388 20:29103456-29103478 TTAGGAACTCTGAAAGAGACAGG - Intergenic
1171787290 20:29479430-29479452 TTAGGAACTCTGAAAGAGACAGG + Intergenic
1171860660 20:30399956-30399978 TTAGGAACTCTGAAAGAGACAGG - Intergenic
1171882577 20:30629271-30629293 CTGGGAGCTCTGACTCAGGGAGG + Intergenic
1175197976 20:57258729-57258751 CATTGATCTCTGAAAGAGGGAGG + Intronic
1175269271 20:57722409-57722431 GTGGGAACGCTGGCAGAGGGTGG + Intergenic
1176050321 20:63115884-63115906 CTGGAAACTATGGAAGAGGTGGG + Intergenic
1176179923 20:63745025-63745047 CTGAGAATTCTCAAAGAGGCCGG + Exonic
1176271686 20:64238710-64238732 CTGGGGACTCTGAGAAGGGGAGG - Intronic
1176946652 21:14990348-14990370 CTGGGAACTGTGTACTAGGGAGG + Intronic
1177825919 21:26082765-26082787 CTATCAACTCTGTAAGAGGGAGG + Intronic
1178506691 21:33168631-33168653 CTGGGAGGAGTGAAAGAGGGAGG + Intronic
1178923002 21:36751660-36751682 CTGGGAACTCTGCTAGGGAGTGG - Exonic
1180296246 22:10938669-10938691 TTAGGAACTCTGAAAGAGACAGG + Intergenic
1180364424 22:11925969-11925991 CTGGGAGCTCTGACTCAGGGAGG - Intergenic
1180727057 22:17954078-17954100 CGGGAAACTATGAAAGAAGGTGG + Intronic
1182066387 22:27434438-27434460 CTGTGAGCTCTGAAAGGGTGGGG - Intergenic
1182236776 22:28883010-28883032 CTGGGAACTGTGAATTGGGGCGG + Intergenic
1182847345 22:33442492-33442514 TGGGGACCTCTGAAAGGGGGTGG + Intronic
1182993178 22:34787820-34787842 CTGGGAATGCTGAAAAAGGCAGG - Intergenic
949229237 3:1730873-1730895 GTTGGAACTATGAAATAGGGTGG - Intergenic
949433326 3:4002095-4002117 CTGGGAAAACTGCATGAGGGTGG + Intronic
949668873 3:6375208-6375230 CTGGGGAATGTCAAAGAGGGTGG - Intergenic
950141682 3:10620298-10620320 CTGGGAACTCTGGAGGAAGACGG + Intronic
950551337 3:13667962-13667984 CTGTGAACTCGGAAACAGGTGGG + Intergenic
951008409 3:17646900-17646922 CTGGGGACTCAAAAAGTGGGAGG - Intronic
951432715 3:22627121-22627143 CTGGGATATCTGAAAGAGACGGG - Intergenic
952553799 3:34508796-34508818 ATTTGAACTCAGAAAGAGGGTGG + Intergenic
952564567 3:34639911-34639933 CTGGGCACTTTTAAAGAGGAAGG - Intergenic
953545542 3:43861520-43861542 CTGGGAACACAGTAAGAGGAAGG + Intergenic
954199566 3:49016233-49016255 CTTGTAACTCTCAAAGAGTGTGG + Exonic
956151066 3:66243036-66243058 CAGTAAACTCTGAAAGAGTGGGG + Intronic
956314503 3:67919515-67919537 TTGGAGACTCTGAAAGTGGGAGG - Intergenic
956930546 3:74038289-74038311 CTTAGAACTGTGACAGAGGGAGG - Intergenic
959348251 3:105227122-105227144 CTGGGCAATCTGGAAGAGGGAGG - Intergenic
961902349 3:130225291-130225313 CAGGGGACTCTGAAAGGGGAGGG - Intergenic
963566122 3:146933139-146933161 CTGAGAATTATGATAGAGGGAGG - Intergenic
963672610 3:148270771-148270793 CTGGGAAGTCTGAAATTGAGGGG - Intergenic
964120225 3:153175438-153175460 CTGGGACTCCTAAAAGAGGGAGG - Intergenic
964718529 3:159748554-159748576 CTGGGCACAGTGAAGGAGGGTGG - Intronic
965860647 3:173146024-173146046 ATGAGAAATCTGAGAGAGGGCGG + Intergenic
966825697 3:183963326-183963348 TTGGGAAATCAGAAACAGGGAGG - Intronic
966908800 3:184546371-184546393 CTTAGAACTCTGCAAGAGAGAGG - Intronic
969091220 4:4695360-4695382 CAGGGAACTTAAAAAGAGGGAGG + Intergenic
969296866 4:6275473-6275495 CTGGGAACTTGGAAACAGGATGG + Intronic
969380511 4:6793799-6793821 CTGAGAACTCTGAGAGAGATGGG + Intronic
970868568 4:20786281-20786303 CTAGGAACTCCAAAAGAAGGAGG + Intronic
971484577 4:27146260-27146282 GTGGGAACTGTGAAAGAGGTTGG + Intergenic
971884991 4:32433020-32433042 CTGGCATCTCTGAAAGAGATGGG + Intergenic
973366251 4:49211714-49211736 CTGGGAGCTCTGACTCAGGGAGG + Intergenic
973394352 4:49580721-49580743 CTGGGAGCTCTGACTCAGGGAGG - Intergenic
976317765 4:83677451-83677473 CTGGGAAATTTGAAAGTGAGGGG + Intergenic
976647212 4:87399352-87399374 CTGCCAACTCAGAAAGGGGGTGG - Intergenic
976950366 4:90821288-90821310 CTGCGAACTATTAAACAGGGTGG + Intronic
977180670 4:93869711-93869733 CTATGAACTCTGAAGGAGGCAGG + Intergenic
978264332 4:106804478-106804500 CTGGGAACCCTGAAAAAATGTGG + Intergenic
981388835 4:144163658-144163680 CTGGCATCTCTGAAAGGGAGAGG - Intergenic
982452250 4:155566843-155566865 ATGGGAACTATTAAAGTGGGTGG - Intergenic
982954761 4:161749845-161749867 CTGGGGACTCCAAAAAAGGGAGG + Intronic
985439483 4:189970015-189970037 TTAGGAACTCTGAAAGAGACAGG - Intergenic
1202763761 4_GL000008v2_random:134215-134237 CTGGGAGCTCTGACTCAGGGAGG + Intergenic
985785204 5:1889713-1889735 CTGGAAACTCAGCAGGAGGGTGG - Intergenic
986138802 5:5009800-5009822 CTGGGACATCTACAAGAGGGAGG - Intergenic
987001867 5:13668073-13668095 ATGGGATCTCTGCATGAGGGAGG + Intergenic
987022668 5:13890519-13890541 CTGGGAATCCTGAGAGAGGCAGG - Intronic
987211041 5:15683534-15683556 CTGGGACATCATAAAGAGGGTGG + Intronic
987624072 5:20375235-20375257 TTGGGAACTTTGAAAGAGAATGG - Intronic
988386893 5:30576262-30576284 CTGGGAACACTAGAAAAGGGTGG + Intergenic
988558094 5:32255660-32255682 CTGGGAACCCTGAAAGGTGTGGG - Intronic
989191939 5:38678869-38678891 CTGGTCACTCAGAAAGAGGGAGG - Intergenic
990678518 5:58215701-58215723 TTGGGATTTCTGAAAGATGGAGG - Intergenic
990695179 5:58408599-58408621 TTGGGATCTCTGGAAGAGAGAGG - Intergenic
992247139 5:74837505-74837527 TTGGGAACTTTGAAAGAGATGGG - Intronic
992695079 5:79278112-79278134 CTGAGAACTATGAAACAGGCAGG - Intronic
993792225 5:92222566-92222588 CTGGGACCTCTGTACCAGGGAGG + Intergenic
994939665 5:106305998-106306020 TTGGAAACTCTGAAAGTGAGTGG - Intergenic
996189949 5:120527751-120527773 CTGGGAACACTCAAATAGGAAGG - Intronic
996817101 5:127586664-127586686 CTGGGGACTCCAAAAGAGTGTGG + Intergenic
998348286 5:141483989-141484011 CTGGGAGGTCTGGATGAGGGTGG + Intronic
1000188050 5:158880165-158880187 CTGGGTGCTCTGAGAAAGGGAGG + Intronic
1001009340 5:168083923-168083945 CTGGGGACTATTAGAGAGGGCGG - Intronic
1001054291 5:168436388-168436410 CTGGGCCCTCTGATATAGGGAGG - Intronic
1002823550 6:752301-752323 GTGGTAACTGTGAAAGAGGTGGG + Intergenic
1006505481 6:34486178-34486200 CTGGGAACCCAGGGAGAGGGAGG + Intronic
1007061286 6:38942881-38942903 CTGGGTTATTTGAAAGAGGGTGG + Intronic
1007778680 6:44238523-44238545 CTGGGAACTCTCATAGGGAGCGG - Intergenic
1010307838 6:74345606-74345628 GTGGCAACTGTGAAGGAGGGTGG - Intergenic
1010433980 6:75809625-75809647 CTGGGAAATCTCGAAGTGGGGGG + Intronic
1010777612 6:79905242-79905264 CTGGGATCTCTGAATGACTGTGG + Intergenic
1011612791 6:89169512-89169534 CTGGGAACTCCAAAAGGGGGTGG - Intergenic
1011805362 6:91066563-91066585 CTTGGAACTCTGAATGAGGCTGG - Intergenic
1013938738 6:115633842-115633864 CTAAGAACTCTGAAAAAAGGTGG + Intergenic
1014183236 6:118407757-118407779 CTGGGAGCTCTGTACCAGGGAGG - Intergenic
1016648831 6:146440718-146440740 CTGGGAACTCTGGGAGACAGTGG + Intergenic
1016925472 6:149342137-149342159 TTGGTAATTCTTAAAGAGGGAGG - Intronic
1017230708 6:152070307-152070329 CTGGGAACAAGGACAGAGGGAGG - Intronic
1018143606 6:160863438-160863460 CTGGGAACTGTGACAGATGGTGG - Intergenic
1018937228 6:168281469-168281491 CTGGGAAATGTGAAAGCAGGTGG + Intergenic
1021870776 7:25004117-25004139 CTGGGAACTCAGATGTAGGGAGG - Intergenic
1022603225 7:31781652-31781674 GTGGGAACACTGAAAGAGTCTGG + Intronic
1024544234 7:50503432-50503454 CTAGGATCTCTGAATGAGGAAGG + Intronic
1024566813 7:50688219-50688241 CTGGGAAAACTGAAAGATGTTGG - Intronic
1024584747 7:50832394-50832416 CTGGAAATTCAGAAATAGGGTGG + Intergenic
1026154091 7:67812213-67812235 CTGGGAACTTGGAGAGAGTGGGG + Intergenic
1028547906 7:92025311-92025333 ATAGAAACTCTGAGAGAGGGTGG - Intronic
1029805036 7:102987139-102987161 CTGGAGACTCTGAAAGGGAGAGG + Intronic
1030889806 7:114985643-114985665 CTGGGAACTTTCAGAGAGGGAGG - Intronic
1031340044 7:120588701-120588723 ATGAAAACTCTAAAAGAGGGTGG + Intronic
1031735369 7:125352980-125353002 CTGGGAACTCAAAAAGGGGAAGG + Intergenic
1032228446 7:130052814-130052836 CTGGGAACACTGATAGAGTTAGG - Intergenic
1032372515 7:131372072-131372094 CTAGGAACTGTGAAAGATGAAGG + Intronic
1032537681 7:132678234-132678256 CTGGGGATACTGGAAGAGGGAGG + Intronic
1032871520 7:135991139-135991161 CGGGGAACTCTGAATGGAGGTGG - Intergenic
1033547431 7:142414065-142414087 CTAGGAACTTGGTAAGAGGGAGG + Intergenic
1035253901 7:157614084-157614106 CAGGGAACCATGAAAGAGGTGGG + Exonic
1035522910 8:289833-289855 ATGGAGACTCTGAAAGAGGGAGG - Intergenic
1035619276 8:1025252-1025274 CGGGGGAGTGTGAAAGAGGGCGG - Intergenic
1036533054 8:9614875-9614897 CTGGGAATTCTTAAATATGGAGG - Intronic
1038621995 8:29153076-29153098 CTTGGAACTTTGAAAAATGGGGG - Intronic
1039007842 8:33060490-33060512 CAGGGAACTCTGAAGCAGGACGG - Intergenic
1039656725 8:39417594-39417616 CTAGGAACTCTGAAGGAAAGGGG - Intergenic
1039740214 8:40376084-40376106 CTGGGAAGTATGGAAAAGGGAGG - Intergenic
1039846617 8:41330135-41330157 TTGGAAACTCTGAAAGAGCAAGG + Intergenic
1040600513 8:48879173-48879195 CTGGTAACAATCAAAGAGGGCGG - Intergenic
1041330800 8:56721803-56721825 CTGGGAAATATGAAAGAGAAGGG + Intergenic
1042089779 8:65146041-65146063 CTGGGGACTGTGAAAGAGAATGG + Intergenic
1043471527 8:80567637-80567659 CTGGGAAATTTTACAGAGGGAGG + Intergenic
1044121533 8:88402995-88403017 CTGGGCACTGTGGAAGAGTGTGG - Intergenic
1044791290 8:95849696-95849718 CTGTCTACTCTTAAAGAGGGAGG + Intergenic
1045045337 8:98269839-98269861 CTGGGAACTCTGGAGGAGGGAGG - Intronic
1047345547 8:124024357-124024379 CTGAAAACTCAGAAAGGGGGAGG - Intronic
1048232076 8:132652210-132652232 CTGTGTACTCTGCAAGTGGGTGG - Intronic
1048652362 8:136492507-136492529 CTGGCAAGTCTGATAAAGGGTGG - Intergenic
1048961715 8:139585149-139585171 CTGGGAAAGCTGGAAGAAGGTGG + Intergenic
1050361148 9:4832178-4832200 CTGGGAGCTCTGAATGCAGGAGG + Intronic
1051634239 9:19167080-19167102 CTGGGGACTATGAGAGAGGAGGG - Intergenic
1051818194 9:21134114-21134136 CTTGGAACCATGAAAGATGGAGG - Intergenic
1052036877 9:23692809-23692831 CTGGGCACCCTGGAACAGGGTGG - Exonic
1053130394 9:35611300-35611322 CTAGGGACCCTGAAACAGGGTGG - Intronic
1054338537 9:63831410-63831432 TTAGGAACTCTGAAAGAGACAGG + Intergenic
1058910792 9:109518325-109518347 CTGTGAACTCTGCAGGAGGTGGG - Intergenic
1059405940 9:114098453-114098475 CGGGGCACTCTGGAGGAGGGCGG + Intronic
1059405972 9:114098531-114098553 CGGGGCACTCTGGAGGAGGGCGG + Intronic
1060394322 9:123304863-123304885 CTGCGAACTCTGCAAGGGTGAGG + Intergenic
1060910323 9:127344602-127344624 CTGTGTTCTCTGGAAGAGGGGGG - Intronic
1061245500 9:129399423-129399445 CTGGGGACCCTGAGAGAAGGAGG - Intergenic
1202803099 9_KI270720v1_random:19704-19726 TTAGGAACTCTGAAAGAGACAGG + Intergenic
1203447892 Un_GL000219v1:76917-76939 TTAGGAACTCTGAAAGAGACAGG + Intergenic
1203544515 Un_KI270743v1:119088-119110 CTGGGAGCTCTGACTCAGGGAGG + Intergenic
1186016155 X:5196526-5196548 CTGGGGACTCCAAAATAGGGAGG + Intergenic
1186561517 X:10618507-10618529 TTCAGAACTTTGAAAGAGGGTGG - Intronic
1187080287 X:15979042-15979064 CTGGAGACTCAGAAAGGGGGAGG + Intergenic
1188482503 X:30649917-30649939 CTAGGGACTCTCCAAGAGGGAGG + Intergenic
1190534417 X:51411520-51411542 CTGTGAACTGGGAAAGAGGTGGG + Intergenic
1191743827 X:64464537-64464559 CTGGGAGCTCTGATCCAGGGAGG + Intergenic
1191870133 X:65738706-65738728 GTGGGAAGTATGAAAGAGGGAGG - Intronic
1192189130 X:68980041-68980063 CAGGGACCTCTGAAGGTGGGTGG + Intergenic
1192806273 X:74512225-74512247 CTGGGAACTCTGAAGAGGTGTGG + Intronic
1193028866 X:76876255-76876277 CTGGCATCTCTGAAAGGGAGGGG + Intergenic
1193456816 X:81741779-81741801 CTGGGGACCCTGAAGTAGGGAGG - Intergenic
1195113960 X:101677094-101677116 AAGGGAAATCAGAAAGAGGGTGG - Intergenic
1195991505 X:110687027-110687049 CTGTGTACTCTGGAAGATGGGGG + Intronic
1198730476 X:139722550-139722572 CTGGCAGTTCTGAAAGAGGAAGG + Intergenic
1199269440 X:145865460-145865482 CTGGGAAGAGAGAAAGAGGGAGG + Intergenic
1199849553 X:151715629-151715651 CTGGGGACTCTGGATGGGGGAGG + Intergenic
1200420026 Y:2955258-2955280 CTGGGAACTTTAAGAGAGGGTGG - Intronic
1202588704 Y:26459451-26459473 CTGGGAACCCCCAAACAGGGTGG + Intergenic