ID: 1087570349

View in Genome Browser
Species Human (GRCh38)
Location 11:99919432-99919454
Sequence ATGTAGTAGCTGAATGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 204}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087570349 Original CRISPR ATGTAGTAGCTGAATGAAGA GGG (reversed) Intronic
900735781 1:4298634-4298656 ATGGAGTGGGTGAATGAGGAGGG + Intergenic
901108872 1:6779436-6779458 ATGTAATAGCTGGATGATGAGGG + Intergenic
901305163 1:8227477-8227499 ATGAAGTAGGTGGAGGAAGATGG + Intergenic
906241566 1:44245342-44245364 TTGTAGTCTTTGAATGAAGAGGG - Intronic
909714475 1:78691368-78691390 TTGTAGAAGCTGAGTGATGAAGG + Intergenic
910742672 1:90537439-90537461 GTGTGGTTGCTGAATGAAGCAGG - Intergenic
911500140 1:98675568-98675590 ATGTAGTAGGTAAAAGAAGTAGG + Intronic
912411957 1:109485811-109485833 ATGCAGCAGGTGAAGGAAGATGG + Intronic
913435606 1:118844538-118844560 ATGAAGGAGCTAAATGATGATGG - Intergenic
913558065 1:119989141-119989163 ATGCAATAGCTGAGTGAATATGG + Intronic
913570379 1:120114041-120114063 ATGTATTAGCTGACTAAATAAGG - Intergenic
914291183 1:146275018-146275040 ATGTATTAGCTGACTAAATAAGG - Intergenic
914552227 1:148725801-148725823 ATGTATTAGCTGACTAAATAAGG - Intergenic
915170767 1:153975712-153975734 ATGGAATATCTGAAAGAAGAGGG - Intronic
917202201 1:172529674-172529696 AGGTAGTAACTAAATAAAGAAGG + Intergenic
918574372 1:186038815-186038837 ATGTAATAACTGAAAGAAGAAGG - Exonic
919782156 1:201228156-201228178 ATGTAGTCCCGGAACGAAGATGG + Intronic
920331938 1:205215092-205215114 ATCTAGGAATTGAATGAAGAGGG - Intergenic
921453880 1:215343272-215343294 ATGTAGTAACTTAAGGATGAAGG + Intergenic
921556475 1:216604279-216604301 ATCTAGAAGCTCAGTGAAGAGGG + Intronic
922660660 1:227427691-227427713 ATGAAGTAGGTGGAAGAAGAAGG - Intergenic
924656586 1:245978093-245978115 TTGTAGGAGCTGAGTGAACATGG + Intronic
1062781956 10:220275-220297 ATGTAGTAACCAAATGAACAAGG - Intronic
1064726254 10:18282725-18282747 ATATACTAGGTGAATGAACAAGG - Intronic
1068017477 10:51535608-51535630 ATGTAGTAGCTTAAATGAGAAGG + Intronic
1070268905 10:74932721-74932743 ATGTACCACCTGAATGAGGATGG + Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1071020568 10:81050084-81050106 ATTTAGAAGATGAATGAAAAGGG - Intergenic
1071079078 10:81788585-81788607 AGATAGAAGCTAAATGAAGAGGG - Intergenic
1071797534 10:89022447-89022469 AAGAAGTAGATAAATGAAGAGGG - Intergenic
1072481239 10:95810619-95810641 ATTTTGTACCTGAGTGAAGAAGG - Intronic
1073364383 10:102926335-102926357 AAGTAGGAGCTGGATGAAGCGGG + Intronic
1075769531 10:124921553-124921575 ATGTAGTAGGTAAGTCAAGATGG - Intergenic
1076850942 10:133092715-133092737 AAGAAGCACCTGAATGAAGAAGG + Intronic
1078896126 11:15598877-15598899 ATATGGTAGCTGGATGGAGAAGG - Intergenic
1079876906 11:25869988-25870010 ATGTAGAAGTTGATGGAAGATGG + Intergenic
1080341339 11:31268946-31268968 ATGTTTTAGCTCAATGAAAAGGG - Intronic
1082775099 11:57238447-57238469 ATGTAGGAGGTGAGTGAAAAGGG + Intergenic
1082908630 11:58343553-58343575 ATGTAATACCTGAATAAAAATGG - Intergenic
1082914851 11:58422140-58422162 ATGTAATACCTGAATGAGGAAGG - Intergenic
1083104466 11:60344781-60344803 ATGAAGTAGCTGAAGGAAATAGG - Intronic
1083161087 11:60854491-60854513 ATGGAGTAAGTGAATGAACAGGG - Intronic
1086283157 11:85214190-85214212 AAGTAGCAGCTGAAAGGAGAGGG - Intronic
1086673554 11:89575751-89575773 ATGAAGTAGAAGAAAGAAGAAGG - Intergenic
1087250863 11:95898053-95898075 ATGTAGTATTTGAAAGAAAAAGG - Intronic
1087296648 11:96384880-96384902 ATGAAATATCTGAGTGAAGATGG + Intronic
1087321493 11:96665145-96665167 ATTTAGTTTCTGAATGAAAATGG - Intergenic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1088039861 11:105366867-105366889 AAGTAGAAGCTGTAAGAAGAGGG - Intergenic
1090457190 11:126860431-126860453 AGGAATTTGCTGAATGAAGAAGG + Intronic
1091885372 12:4013396-4013418 TTGGAGTAGCTGCATGGAGATGG - Intergenic
1091970935 12:4786375-4786397 AATTAGTACCTTAATGAAGATGG - Intronic
1092204144 12:6605640-6605662 ATGTAATAGCCTAGTGAAGAGGG - Intronic
1092307259 12:7314140-7314162 ATGTAGAAGATGAAGGAAGAAGG + Intronic
1092694849 12:11159936-11159958 ATATAGTAGCTGACTGAAAGTGG - Intronic
1095503530 12:42867262-42867284 ATGTAGTAGCTAGATTATGAGGG + Intergenic
1097652297 12:62315942-62315964 ATGTTCTAGCTAAATGAAGAGGG - Intronic
1099359290 12:81679560-81679582 ATGTAGAAGATGAATGAAAAGGG + Intronic
1100945271 12:99776427-99776449 ACCTATTAGCTGAATGAACATGG - Intronic
1101400985 12:104386535-104386557 ATGTAGTTGCTCACTGAAGCTGG + Intergenic
1104172271 12:126293335-126293357 CTCTTGTAACTGAATGAAGATGG + Intergenic
1106436120 13:29724291-29724313 ATGTAGTGGCTGGTTGAACAAGG + Intergenic
1107026445 13:35806641-35806663 AGTTAGAAACTGAATGAAGAAGG - Intronic
1107370988 13:39747443-39747465 ATGTATTACATGAATGAAGGAGG - Intronic
1109167937 13:59058960-59058982 ATGTAGAATGGGAATGAAGACGG + Intergenic
1109568198 13:64147923-64147945 ATGTTGTAACCGAAAGAAGAAGG + Intergenic
1110386321 13:74915071-74915093 ATATAGTAGCTGAAGTAAGTAGG - Intergenic
1110477058 13:75928417-75928439 ATGTATTAGCGGCATGAAAATGG + Intergenic
1110599364 13:77354446-77354468 ATGAATTAACTGAATGAAGCAGG + Intergenic
1111188110 13:84770335-84770357 TTTTAATAGCTAAATGAAGATGG - Intergenic
1111497545 13:89071669-89071691 ACGTAGTAACTGAGTGAAAAGGG + Intergenic
1111868856 13:93804818-93804840 ATGTAATAGCTGCATGACGTTGG + Intronic
1114207431 14:20585950-20585972 ATGTAGGAGATCAATGTAGAAGG - Intronic
1116902640 14:50376576-50376598 ATGTTATTGCTGAGTGAAGAAGG + Intronic
1117610073 14:57473997-57474019 AAGAAGTAGCTGGATGAAGTGGG - Intronic
1117756521 14:58979926-58979948 ATGTAGTAGATGTATGATGTGGG + Intergenic
1120591697 14:86382083-86382105 ATACAGTAGCTGAATGGAAATGG - Intergenic
1120811093 14:88804103-88804125 AGGTAGTAGCTAAGTAAAGAAGG - Intergenic
1121508022 14:94491248-94491270 ATGTACTAGCGGTATGCAGAAGG + Intronic
1121589489 14:95091871-95091893 ATCTAGTGGCTTAATGAAGAGGG - Intronic
1122685066 14:103500120-103500142 ATGTAGAAGCAGAGAGAAGAGGG - Intronic
1124096291 15:26651400-26651422 AGCAAGTAGCTGAATGCAGAAGG - Intronic
1124395539 15:29297947-29297969 ATCTAGCAGCTGAATGCACATGG + Intronic
1134788955 16:16971160-16971182 ATCTAGAAACTGAAGGAAGATGG - Intergenic
1136625719 16:31461045-31461067 AAATAGTAGCTGAATGATGGGGG - Intronic
1136998966 16:35212350-35212372 ATGTATCAGATGGATGAAGATGG + Intergenic
1137343663 16:47635253-47635275 ATGTATTAGCTGTATGATGTTGG + Intronic
1140123649 16:72103660-72103682 ACGCAGTACCTGCATGAAGATGG + Exonic
1153368760 18:4289165-4289187 AAGGACTGGCTGAATGAAGATGG + Intronic
1154504725 18:15024488-15024510 ATGTTGTAGCTTACTGAACAAGG + Intergenic
1159051690 18:63426427-63426449 AGGTAGTGACAGAATGAAGAGGG - Intergenic
1159289829 18:66402264-66402286 ATATAGGAGCGGAATGAAAATGG - Intergenic
1164335919 19:24321266-24321288 AAGGAGTAGCTGAAGGGAGAGGG - Intergenic
1164535601 19:29084558-29084580 AAGAAGTAGCTGAAAGAGGAAGG + Intergenic
1166001736 19:39881548-39881570 ATGTAGTAACTGTACGAACAGGG - Intronic
1166004518 19:39897799-39897821 ATGTAGTAACTGTACGAACAGGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
925141462 2:1552633-1552655 GCTTAGTAGCTGAATGCAGATGG + Intergenic
928829889 2:35468206-35468228 ACATAGTTGTTGAATGAAGAAGG + Intergenic
928909052 2:36400318-36400340 ATGATGTAGTTGATTGAAGAGGG + Intronic
931632407 2:64312786-64312808 ACGTAGGAGCTGAGTGGAGAAGG - Intergenic
932132979 2:69204334-69204356 ATGGAGATGCTGAACGAAGATGG - Intronic
932889285 2:75577928-75577950 AGGTAGAAGGTGAATGAAGTTGG + Intergenic
936642315 2:114328501-114328523 ATCTAATAACTGATTGAAGAGGG - Intergenic
938027179 2:127959884-127959906 ATGTAATAACTGAAATAAGACGG + Intronic
938503914 2:131854694-131854716 ATGTTGTAGCTTACTGAACAAGG + Intergenic
939237196 2:139510811-139510833 ATGTAGTAGCTTAAAGATGTTGG + Intergenic
939511035 2:143104960-143104982 AAGTAGTTGCTGAATGAATTAGG + Intronic
939678322 2:145099459-145099481 ATGTACTAGCTGAGTGAACCAGG + Intergenic
941695590 2:168547848-168547870 TAGTAGAAGCGGAATGAAGATGG + Intronic
943559633 2:189445220-189445242 ATGTATTAGCTGAATGATGTTGG - Intronic
945105345 2:206307162-206307184 AATTAGTCACTGAATGAAGAGGG - Exonic
945447842 2:209959422-209959444 ATGTAGCAGCTGTGAGAAGAGGG - Intronic
945618982 2:212109473-212109495 AAGTAATAGCTGAAAGAAGTGGG - Intronic
946759098 2:222975383-222975405 ATTTGGTGGCTAAATGAAGATGG + Intergenic
1170421706 20:16199904-16199926 ATGTGGTAGCTGACTGAATCAGG - Intergenic
1171814000 20:29767287-29767309 CTGTAGAAGCTGAATGGATAAGG - Intergenic
1177060772 21:16371689-16371711 ATATACTAGCTGAATGATCATGG + Intergenic
1177266404 21:18790256-18790278 ATGTATTCTCTTAATGAAGATGG - Intergenic
1177992517 21:28055470-28055492 ATGTTGTAGCTTACTGAACAAGG - Intergenic
1179244837 21:39623932-39623954 ATGTAGCAGATACATGAAGAGGG - Intronic
949171842 3:1009223-1009245 ATGTAGCTGCACAATGAAGAAGG - Intergenic
950571802 3:13805131-13805153 ATGCATTAACTGAATGAGGATGG + Intergenic
952563062 3:34618509-34618531 ATAGAGAAGCTGAATGAATAAGG - Intergenic
953085761 3:39665167-39665189 ATGTCTTAGCTGAATGGGGAGGG + Intergenic
953394022 3:42552403-42552425 CTGGAGTAGGTGAATGAACATGG - Intronic
953549444 3:43890001-43890023 TTGGAGGAGCTGAAGGAAGAAGG - Intergenic
953627373 3:44581813-44581835 ATTTAGAAGCTGAATGACCAGGG - Intronic
954005315 3:47585940-47585962 ATGGAGAAAATGAATGAAGAAGG - Exonic
955185001 3:56706622-56706644 ATATAGTATCAGAATGAAAATGG + Intergenic
958699825 3:97574294-97574316 ATGTGGTAGTTGAATGAAAGAGG + Intronic
958825415 3:99024136-99024158 ATGTGGTAGCTGAGTGAATTAGG + Intergenic
962714070 3:138112217-138112239 ATTTAGTAGCTGAGTGAGCAGGG - Intronic
969340921 4:6540713-6540735 ATGTGGTTTCTGCATGAAGATGG + Intronic
970926068 4:21453787-21453809 ATGTGCTAGCTGAAAGGAGATGG - Intronic
971259494 4:25043402-25043424 AGGTAGAAGCTGAAAGAAGATGG + Intergenic
971406489 4:26325299-26325321 ATGTAGAAGCTGGATAAAGGTGG - Intronic
974178828 4:58359452-58359474 ATGTATTAGCAGAATGAGAAAGG + Intergenic
975425601 4:74223399-74223421 AAGTAGGAGCTAAATGATGAGGG + Intronic
976486520 4:85611872-85611894 ATTAAATATCTGAATGAAGAAGG - Intronic
978870231 4:113566923-113566945 TTGTAGTAGTTGAAGGAGGAGGG - Intronic
979048927 4:115904848-115904870 ATGTTGAAGGAGAATGAAGAGGG + Intergenic
979656854 4:123205309-123205331 ATTTAGTAGCTGTATGAACCTGG + Intronic
980461474 4:133120662-133120684 ATGTACTAGATGAGTGAAAAAGG - Intergenic
981272509 4:142861030-142861052 AAGTAGTGCCTCAATGAAGAAGG + Intergenic
981797528 4:148613945-148613967 ATCTAGAAGCTGGATGAATATGG + Intergenic
983853525 4:172613049-172613071 ATGTGGAAGCTGAATGAATGTGG - Intronic
984745101 4:183207591-183207613 CTGTATTAGGTGAATGAAGGTGG + Intronic
985612232 5:896701-896723 ATTTTCCAGCTGAATGAAGATGG + Exonic
986412670 5:7496491-7496513 ATATAATAGCTGAATGAATTCGG + Intronic
988246748 5:28694202-28694224 AAGAAGTAGCTGAAAGAATATGG + Intergenic
991100466 5:62786463-62786485 ATTTAGTTGCTGATTCAAGAGGG - Intergenic
992398411 5:76388685-76388707 ATGAAATAGCTGAATGAAGAAGG - Intergenic
992681847 5:79161327-79161349 ATGTAGGAGCTGAAAAAAAAAGG + Intronic
992944892 5:81800326-81800348 ATTTTGTAGCTGAAAGCAGATGG + Intergenic
993858589 5:93105630-93105652 ATGAAGTATCAGAATGAAGGGGG - Intergenic
993877094 5:93320125-93320147 CTGTAGTAGCTGAATGTGGAAGG + Intergenic
994450135 5:99930343-99930365 ATGTGGTGGCAGAATAAAGAGGG - Intergenic
995963754 5:117878438-117878460 GTGTACTAGCTGTATGAACATGG + Intergenic
999691343 5:154148596-154148618 ATACAGTAGTTGAATGAAGTAGG - Intronic
1000774674 5:165404328-165404350 ATTGAGTACCTAAATGAAGATGG + Intergenic
1004492781 6:16131861-16131883 ATTTTGTTTCTGAATGAAGATGG + Intronic
1004726049 6:18312246-18312268 ATTTGGGAGCTGAATGAACAGGG + Intergenic
1008015173 6:46510525-46510547 ATGTGATAGATGCATGAAGAAGG - Intergenic
1012566863 6:100667144-100667166 GTGTAGTATCAGTATGAAGAAGG - Intronic
1013175859 6:107675827-107675849 ATGTAGGAGGTGTATGAAGACGG + Intergenic
1014807716 6:125849170-125849192 TTGTAGTAGCTGAATGAAAACGG - Intronic
1016941610 6:149486929-149486951 ATTAAGTGGCTGAGTGAAGATGG + Intergenic
1017065516 6:150525671-150525693 ATGTGGTAGCTGAAAGGACAGGG - Intergenic
1018677588 6:166236275-166236297 ATGCAGTTTCTGAATGACGAAGG - Intergenic
1018965303 6:168481308-168481330 ACATAGTAGCAGAATGAACAGGG + Intronic
1020494665 7:8834375-8834397 AAGGAATAGTTGAATGAAGAGGG + Intergenic
1022582463 7:31569541-31569563 ATGTACTGGCTCAATGGAGAGGG - Intronic
1024637967 7:51306061-51306083 TTGTACTTGATGAATGAAGATGG + Intronic
1027357344 7:77370880-77370902 TTGTAGTAGCTGAAGGCACAGGG - Intronic
1028082509 7:86596189-86596211 ATGTGTTAGCTAAATGAAAATGG + Intergenic
1028298869 7:89171246-89171268 TTGTAGTAACTCAATGAAGTAGG + Intronic
1028409970 7:90519835-90519857 ATGAAGGAGGTGAAGGAAGAAGG - Intronic
1028661307 7:93279399-93279421 ATAGAGGAGCTGAATAAAGAAGG + Intronic
1029027026 7:97427697-97427719 ATGCAGTAGATGAAAGAAGTAGG + Intergenic
1029957510 7:104655031-104655053 TTGGACTAGCTGAAGGAAGAAGG - Intronic
1031044217 7:116869445-116869467 ATTTAGTAAATGAATGAAGATGG - Intronic
1031938262 7:127759189-127759211 ATGTAGTATGTGACTTAAGATGG + Intronic
1031944942 7:127830071-127830093 CTGTGGTTGCTGAATCAAGAAGG + Intronic
1033322122 7:140349444-140349466 ATGCTGCAGCTGCATGAAGATGG + Intronic
1034001952 7:147424113-147424135 ATGGAGCAGCGGAATGAAGTAGG - Intronic
1034669532 7:152847602-152847624 ATGAAGTAGCTGAAGGAATCTGG + Intronic
1038592310 8:28851060-28851082 AAGTAAAAGCTTAATGAAGAAGG + Intronic
1039095571 8:33881022-33881044 GTGTAGGAGCTGAGTGAAGCCGG - Intergenic
1039408049 8:37329452-37329474 ATGTTGTAGCTGAATTAATTGGG + Intergenic
1039674505 8:39646885-39646907 AAGTAGAAGGAGAATGAAGAGGG + Intronic
1041403275 8:57467191-57467213 CTGTAATTGTTGAATGAAGATGG - Intergenic
1042490330 8:69390592-69390614 AAGAATTAGCTGGATGAAGAGGG - Intergenic
1042894994 8:73656893-73656915 TTGTACTAGCTTAATGAAAACGG + Intronic
1043289693 8:78582062-78582084 CTGTACTAGCTGCCTGAAGAAGG - Intronic
1045823252 8:106366903-106366925 ATGTAATACATGAAAGAAGATGG - Intronic
1046631044 8:116623425-116623447 TTGTAGTAGCTGAAGGCAGGAGG - Intergenic
1046877035 8:119266584-119266606 GTGTAGGAGCAGAATGAAGGAGG + Intergenic
1048579562 8:135719838-135719860 ATGTGGCAGCTGCATGAAGCTGG - Intergenic
1051217879 9:14818027-14818049 ATATACTAGCTGAATGAACTTGG + Intronic
1052406837 9:28072033-28072055 ATGTAGAAGGAGGATGAAGATGG - Intronic
1052703803 9:31969966-31969988 ATGTTGTAGCTAAATAAAAAAGG + Intergenic
1053317731 9:37066441-37066463 AGGGAGTGGCTGTATGAAGAAGG + Intergenic
1053322108 9:37107882-37107904 AGGGAGTGGCTGTATGAAGAAGG + Intergenic
1054990652 9:71321764-71321786 AAGTATTTGCTGAATGAATAAGG - Intronic
1056572087 9:87825114-87825136 CTGTAGAAGCTGACTGGAGAAGG - Intergenic
1056999286 9:91492750-91492772 ATGGAGTAGCTGAAAGATGAAGG + Intergenic
1059197841 9:112387550-112387572 ATTTAGTAGTTGAATAAACATGG + Intronic
1059636077 9:116171883-116171905 AAGCAGAAGCTGATTGAAGAAGG + Intronic
1185993457 X:4916950-4916972 ATGTAGGGGCAGAATGTAGAAGG - Intergenic
1186246509 X:7621917-7621939 ATGTAGCAGATTTATGAAGATGG - Intergenic
1186877993 X:13835855-13835877 ATGTAAAAGTTGAATGAAGTTGG - Intronic
1187775654 X:22753791-22753813 ATTTGGTAGCGGAAAGAAGATGG + Intergenic
1187839430 X:23471517-23471539 AAGTAGTAACAGAATGAAGCAGG + Intergenic
1188657244 X:32713525-32713547 ATATAGTAGCTGAAAGGAAAGGG - Intronic
1189420464 X:40852735-40852757 AAGTAGAAGCTGAAAGAGGAAGG + Intergenic
1189824532 X:44904051-44904073 ATGTAGAAACTGAAAGCAGAAGG + Intronic
1190850897 X:54240507-54240529 ATGTAGTAACTGGATCAAGATGG + Intronic
1191638345 X:63402417-63402439 ATGTAGTGGCTGAATGAATTTGG - Intergenic
1191764469 X:64682266-64682288 ATGTGGTAACTAATTGAAGATGG + Intergenic
1192617004 X:72635931-72635953 ATTTAGTAGCTGAATAAAAAAGG + Intronic
1193011888 X:76685841-76685863 CTGTAGTAGATGAGTGAGGAAGG + Intergenic
1196552039 X:117040188-117040210 AGTTAGTATATGAATGAAGAAGG - Intergenic