ID: 1087570530

View in Genome Browser
Species Human (GRCh38)
Location 11:99921583-99921605
Sequence ATGGAATGCTAGGAGCATTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 166}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087570530_1087570533 26 Left 1087570530 11:99921583-99921605 CCATAATGCTCCTAGCATTCCAT 0: 1
1: 0
2: 0
3: 10
4: 166
Right 1087570533 11:99921632-99921654 TGTTCATAGTTTGTCTCCTTCGG 0: 1
1: 0
2: 1
3: 25
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087570530 Original CRISPR ATGGAATGCTAGGAGCATTA TGG (reversed) Intronic
901450987 1:9337053-9337075 TTAGAATGCCAGGAGCATTTGGG - Intronic
902649379 1:17826632-17826654 TTGGAATTCTAGGGGCATGAGGG + Exonic
903370069 1:22829665-22829687 ATGGAATGGTAGGGCCATTTGGG + Intronic
908215919 1:61951799-61951821 ATTCAATGCTGGGAGCATTAAGG + Intronic
909452093 1:75809364-75809386 ATGCAATACTAGTATCATTAAGG - Intronic
910745600 1:90570782-90570804 TTTGGGTGCTAGGAGCATTATGG - Intergenic
910927779 1:92413809-92413831 ATGGAAAGCTAGAAGCAATCTGG + Intergenic
913722775 1:121616472-121616494 TTGGAATGCTTTGAGGATTACGG - Intergenic
913742535 1:121863728-121863750 TTGGAATGCTTTGAGGATTACGG - Intergenic
913785369 1:122445185-122445207 TTGGAATGCTTTGAGGATTACGG + Intergenic
924391231 1:243561257-243561279 AAGGAATGCTAGTATCATTGGGG + Intronic
1063533927 10:6864004-6864026 ATTGAATGGGAGGAGCAGTAGGG + Intergenic
1064127829 10:12679687-12679709 AAGGAATAGAAGGAGCATTATGG - Intronic
1071130892 10:82392270-82392292 ATTGAATGCTAGTGGCATTTTGG - Intronic
1075711472 10:124533115-124533137 GTGGAATGCTGGGTGCATCACGG + Intronic
1078322665 11:10350720-10350742 ATGGATTGCTATAAGGATTATGG + Intronic
1083446101 11:62708883-62708905 ATGGGATGCAAGGAGCCTAAGGG - Exonic
1086666304 11:89488231-89488253 ATGGAAGACTAGGAGCATAAAGG - Intronic
1087570530 11:99921583-99921605 ATGGAATGCTAGGAGCATTATGG - Intronic
1092915371 12:13184529-13184551 ATGGAATGCTTGGAGGTTTCAGG + Intergenic
1096309707 12:50509873-50509895 ATCTGATGCTAGGAGTATTAAGG + Intronic
1105835592 13:24208434-24208456 CTGGAGTGCTAGGAGCACTGGGG - Intronic
1105970094 13:25421174-25421196 CTGCAATGCTAGGACCACTATGG - Intronic
1111255840 13:85667269-85667291 TTGCAATTCAAGGAGCATTAAGG - Intergenic
1112829501 13:103431022-103431044 ATGGAATTCCAGGAGCAGAAGGG + Intergenic
1117176915 14:53154150-53154172 ATGGAATTCTATGAACTTTAAGG + Intergenic
1121092447 14:91192064-91192086 ATAAAGTGCTATGAGCATTAGGG - Intronic
1122815633 14:104310768-104310790 AGGGAGTGCTAGGAGCATGCAGG + Intergenic
1125106654 15:35979513-35979535 ATGGAATGCTCGGCGCAAGATGG + Intergenic
1127921270 15:63496203-63496225 CTGGCAAGCAAGGAGCATTATGG + Intergenic
1128666810 15:69544362-69544384 ATACAATCCGAGGAGCATTAGGG - Intergenic
1131933164 15:97469033-97469055 ATTGAATGCTATCAGCAATAAGG - Intergenic
1139287257 16:65826700-65826722 TTGGAATTCAAGGAGAATTAGGG + Intergenic
1139940307 16:70600856-70600878 AGGGGATGCTAGGAGAAGTAGGG + Intronic
1145447463 17:23195130-23195152 ATGGAATGCTTTGAGGACTATGG + Intergenic
1145447957 17:23202258-23202280 ATGGAATGCTTTGAGGACTATGG + Intergenic
1145448498 17:23210241-23210263 ATGGAATGCTTTGAGGACTATGG + Intergenic
1145452125 17:23263522-23263544 ATGGAATGCTTTGAGGACTATGG + Intergenic
1145452449 17:23268275-23268297 ATGGAATGCTTTGAGGACTATGG + Intergenic
1145456150 17:23322231-23322253 ATGGAATGCTTTGAGGACTATGG + Intergenic
1145460093 17:23379748-23379770 ATGGAATGCTTTGAGGACTATGG + Intergenic
1145480040 17:23669348-23669370 ATGGAATGCTTTGAGGACTATGG + Intergenic
1145480541 17:23676477-23676499 ATGGAATGCTTTGAGGACTATGG + Intergenic
1145489154 17:23801651-23801673 ATGGAATGCTTTGAGGACTATGG + Intergenic
1145492641 17:23852376-23852398 ATGGAATGCTTTGAGGACTATGG + Intergenic
1145492821 17:23855095-23855117 ATGGAATGCTTTGAGGACTATGG + Intergenic
1145494581 17:23880714-23880736 ATGGAATGCTTTGAGGACTATGG + Intergenic
1145496462 17:23908202-23908224 ATGGAATGCTTTGAGGACTATGG + Intergenic
1145498303 17:23935177-23935199 ATGGAATGCTTTGAGGACTATGG + Intergenic
1145498780 17:23942132-23942154 ATGGAATGCTTTGAGGACTATGG + Intergenic
1145501528 17:23982171-23982193 ATGGAATGCTTTGAGGACTATGG + Intergenic
1145504838 17:24030348-24030370 ATGGAATGCTTTGAGGACTATGG + Intergenic
1145513583 17:24157394-24157416 ATGGAATGCTTTGAGGACTATGG + Intergenic
1145519892 17:24249028-24249050 ATGGAATGCTTTGAGGACTATGG + Intergenic
1145528361 17:24372550-24372572 ATGGAATGCTTTGAGGACTATGG + Intergenic
1145535917 17:24482284-24482306 ATGGAATGCTTTGAGGACTATGG + Intergenic
1145538395 17:24518416-24518438 ATGGAATGCTTTGAGGACTATGG + Intergenic
1145547568 17:24651901-24651923 ATGGAATGCTTTGAGGACTATGG + Intergenic
1145550190 17:24690237-24690259 ATGGAATGCTTTGAGGACTATGG + Intergenic
1145551600 17:24710771-24710793 ATGGAATGCTTTGAGGACTATGG + Intergenic
1145556135 17:24776410-24776432 ATGGAATGCTTTGAGGACTATGG + Intergenic
1145571304 17:24996905-24996927 ATGGAATGCTTTGAGGACTATGG + Intergenic
1145572199 17:25009969-25009991 ATGGAATGCTTTGAGGACTATGG + Intergenic
1145573788 17:25033202-25033224 ATGGAATGCTTTGAGGACTATGG + Intergenic
1145575297 17:25055085-25055107 ATGGAATGCTTTGAGGACTATGG + Intergenic
1145579187 17:25111739-25111761 ATGGAATGCTTTGAGGACTATGG + Intergenic
1145583275 17:25170961-25170983 ATGGAATGCTTTGAGGACTATGG + Intergenic
1145584277 17:25185559-25185581 ATGGAATGCTTTGAGGACTATGG + Intergenic
1145589118 17:25255629-25255651 ATGGAATGCTTTGAGGACTATGG + Intergenic
1145589484 17:25260891-25260913 ATGGAATGCTTTGAGGACTATGG + Intergenic
1145589681 17:25263775-25263797 ATGGAATGCTTTGAGGACTATGG + Intergenic
1145599042 17:25400690-25400712 ATGGAATGCTTTGAGGACTATGG + Intergenic
1145606129 17:25504194-25504216 ATGGAATGCTTTGAGGACTATGG + Intergenic
1145608572 17:25539493-25539515 ATGGAATGCTTTGAGGACTATGG + Intergenic
1145616195 17:25650638-25650660 ATGGAATGCTTTGAGGACTATGG + Intergenic
1145617286 17:25666599-25666621 ATGGAATGCTTTGAGGACTATGG + Intergenic
1145619586 17:25700247-25700269 ATGGAATGCTTTGAGGACTATGG + Intergenic
1145621005 17:25720954-25720976 ATGGAATGCTTTGAGGACTATGG + Intergenic
1145621893 17:25734021-25734043 ATGGAATGCTTTGAGGACTATGG + Intergenic
1145623673 17:25759743-25759765 ATGGAATGCTTTGAGGACTATGG + Intergenic
1145628461 17:25829143-25829165 ATGGAATGCTTTGAGGACTATGG + Intergenic
1145628995 17:25836953-25836975 ATGGAATGCTTTGAGGACTATGG + Intergenic
1145629541 17:25844931-25844953 ATGGAATGCTTTGAGGACTATGG + Intergenic
1145634816 17:25920990-25921012 ATGGAATGCTTTGAGGACTATGG + Intergenic
1145638225 17:25970377-25970399 ATGGAATGCTTTGAGGACTATGG + Intergenic
1145644040 17:26055061-26055083 ATGGAATGCTTTGAGGACTATGG + Intergenic
1145645587 17:26077451-26077473 ATGGAATGCTTTGAGGACTATGG + Intergenic
1145648518 17:26120379-26120401 ATGGAATGCTTTGAGGACTATGG + Intergenic
1145650646 17:26151079-26151101 ATGGAATGCTTTGAGGACTATGG + Intergenic
1145651967 17:26170087-26170109 ATGGAATGCTTTGAGGACTATGG + Intergenic
1145652526 17:26178066-26178088 ATGGAATGCTTTGAGGACTATGG + Intergenic
1145655708 17:26224218-26224240 ATGGAATGCTTTGAGGACTATGG + Intergenic
1145657008 17:26243048-26243070 ATGGAATGCTTTGAGGACTATGG + Intergenic
1145657928 17:26256456-26256478 ATGGAATGCTTTGAGGACTATGG + Intergenic
1145658301 17:26261885-26261907 ATGGAATGCTTTGAGGACTATGG + Intergenic
1145659046 17:26272742-26272764 ATGGAATGCTTTGAGGACTATGG + Intergenic
1145662592 17:26324184-26324206 ATGGAATGCTTTGAGGACTATGG + Intergenic
1145663837 17:26342341-26342363 ATGGAATGCTTTGAGGACTATGG + Intergenic
1145668645 17:26412438-26412460 ATGGAATGCTTTGAGGACTATGG + Intergenic
1145674937 17:26504095-26504117 ATGGAATGCTTTGAGGACTATGG + Intergenic
1145675302 17:26509358-26509380 ATGGAATGCTTTGAGGACTATGG + Intergenic
1145676965 17:26533637-26533659 ATGGAATGCTTTGAGGACTATGG + Intergenic
1145678454 17:26555198-26555220 ATGGAATGCTTTGAGGACTATGG + Intergenic
1151738522 17:75962477-75962499 ATAGAATGATAAGAGCAATATGG - Intronic
1157265296 18:46214273-46214295 ACGGTATGCTAGGTGCAATATGG - Intronic
1157763969 18:50283820-50283842 ATGGAATGGAAGGAACAATAAGG + Intronic
1159208802 18:65288271-65288293 ATCAAATCCTAGGAGAATTAAGG - Intergenic
1160363358 18:78303280-78303302 AAGGAGTCCTAGGAGCATGAGGG + Intergenic
1165444160 19:35847844-35847866 ATGGAATCCTAGGAAAATTCTGG - Intronic
1166279225 19:41779551-41779573 ATTGAATGCTTGGGGCTTTAAGG - Intergenic
924996135 2:363643-363665 ATGGAATGCTCAGAGCATTTAGG + Intergenic
925465047 2:4099738-4099760 ATGGACTGGAAGGAGCATTAGGG - Intergenic
929613851 2:43292753-43292775 CTGGAATGGTAGGATCATGAAGG - Intronic
929729229 2:44469013-44469035 ATGGAAGGCTAGGAAGAGTAGGG + Intronic
930586498 2:53273606-53273628 ATGGAATGTTAGGATCATATTGG + Intergenic
931133147 2:59362645-59362667 ATGGAATGCTGAGGACATTAGGG - Intergenic
933902911 2:86862041-86862063 TTGCAATGCTAGGAGGATGAGGG - Intergenic
935777634 2:106487228-106487250 TTGCAATGCTAGGAGGATGAGGG + Intergenic
936838337 2:116736562-116736584 ATAGATTGCTTGGAGCAGTATGG - Intergenic
938171499 2:129080997-129081019 CTGGAATGGGATGAGCATTATGG + Intergenic
939456702 2:142446367-142446389 ATGGAACAATAGGAGCACTAAGG + Intergenic
940794919 2:158067527-158067549 ATGGAATCCTACGTGCATCAGGG + Intronic
943646252 2:190409570-190409592 ATGGACTTCTAGAAGGATTAGGG - Intronic
944272691 2:197801597-197801619 ATGGAATTCTAGGATCCTTGAGG + Intergenic
1170127310 20:12978204-12978226 ATGGACTGGAAGGAGCATGAGGG + Intergenic
1177656564 21:24023911-24023933 ATGGATTTCTAAGACCATTAAGG - Intergenic
1178682848 21:34687611-34687633 ATTGAAAGCTAGGAGCAATGTGG + Intronic
1182763269 22:32740057-32740079 AGGAAATGCTGGCAGCATTAGGG + Intronic
950409535 3:12826316-12826338 GTGGAATACTAGCAGCATTGAGG + Intronic
950409786 3:12828040-12828062 GTGGAATACTAGCAGCATTGAGG + Intronic
950743696 3:15069787-15069809 CTGGGATGATAGGATCATTAAGG + Intergenic
951775655 3:26307720-26307742 ATGGAAGACTATTAGCATTATGG - Intergenic
953101599 3:39834934-39834956 ATTGAATGCTAGGAGTAAAAAGG + Intronic
954315676 3:49800045-49800067 ATGGAAGGGGAGGAGGATTAAGG + Intergenic
959658129 3:108833497-108833519 ATGGCATGCTTGGGGCAGTAAGG - Intronic
967699723 3:192577494-192577516 CTGGAATGCTATGTGCATTTTGG + Intronic
967780340 3:193431939-193431961 ATGGAATGGTAGTAGAATTAGGG + Intronic
968257327 3:197288035-197288057 ATGGTTTCCTAGGAGCATTTAGG - Intronic
973648927 4:52978128-52978150 ATGGAATGAAAGGAGAATTGTGG + Intronic
979216924 4:118176503-118176525 ATGGATTCATAAGAGCATTAGGG - Intronic
980045041 4:127978513-127978535 ATGGAATGGTAGAAGCTTTTTGG + Intronic
988088509 5:26503624-26503646 ATGGAACGAGAGAAGCATTAAGG + Intergenic
988207634 5:28160586-28160608 ATGGAATGCTAGGGCCATCGAGG + Intergenic
989749104 5:44869463-44869485 ATGTAATGCTAGGAACATATTGG + Intergenic
998197230 5:140084679-140084701 CTGGAATGCTGGGAGCTGTATGG + Intergenic
1000659955 5:163925972-163925994 ATGGAATGTAAGGATCATTAAGG - Intergenic
1001674084 5:173497985-173498007 TTGGAATGCTTGGATCATAAGGG + Intergenic
1003094808 6:3133682-3133704 ATGGAATGCTTGGGCCATTCTGG - Intronic
1004006718 6:11643572-11643594 ATGGATTCCTAGGAGATTTAAGG + Intergenic
1005652258 6:27895108-27895130 ATGCAATGCTATGAGAATTCAGG - Intergenic
1005933709 6:30502966-30502988 GTGGGATGCCAAGAGCATTAGGG - Intergenic
1008310085 6:49957488-49957510 ATGGAATTCTAGGAAGATTGTGG - Intergenic
1015074495 6:129139120-129139142 ATGGAATAATAGGAGCATTGTGG + Intronic
1015762801 6:136683250-136683272 ATGAAATACTAGAAGCATGAAGG + Intronic
1017441151 6:154465452-154465474 AGGGGATGCTAGGAGACTTAAGG - Intronic
1020948050 7:14640270-14640292 GTGGAATTCCAGGAGAATTAAGG + Intronic
1023727926 7:43163584-43163606 ATGGAAGACCAGGAGCATGAGGG - Intronic
1024196196 7:47061208-47061230 ATGGAATGTTAGTAGAAATATGG + Intergenic
1025570400 7:62555335-62555357 ATGGAGTGCTTTGAGCACTATGG - Intergenic
1031379676 7:121070382-121070404 TTGGAATGACAGAAGCATTAAGG - Intronic
1031396433 7:121279881-121279903 GTGGAATGCTAGGAGGTCTAGGG - Intronic
1031602597 7:123729528-123729550 ATGGAATGCTAGGAACAGTTTGG - Intronic
1034039505 7:147862327-147862349 ATAGAATGCTTGGAGGAGTACGG - Intronic
1039657900 8:39430199-39430221 ATGGAATTGTAGAGGCATTAAGG - Intergenic
1043994141 8:86791759-86791781 ATGGAATACTTGGAGAAGTAAGG - Intergenic
1045424335 8:102048966-102048988 ATGGAATTGGAGGAGCATTAAGG - Intronic
1047653735 8:126952568-126952590 AAGGAATGCTAGTATGATTATGG - Intergenic
1049934556 9:488852-488874 ATGGAATATTAGGGGCATAATGG + Intronic
1052734030 9:32322003-32322025 AGGAAATTCTAGGTGCATTAGGG + Intergenic
1057640965 9:96821098-96821120 ATGGAATGCGGGTAGCAGTAGGG - Intronic
1060276694 9:122187938-122187960 ATGGAAGGGAAGGAGCAATATGG + Intronic
1060426285 9:123509433-123509455 AAGGGCTGCTGGGAGCATTAGGG + Intronic
1061636851 9:131916894-131916916 ATGGGATTCTAGGGGCATAAAGG + Intronic
1188614968 X:32146560-32146582 TAGGATTGCTATGAGCATTAAGG + Intronic
1189620139 X:42827632-42827654 ATGCAATGCAAGGAGGATTATGG + Intergenic
1194596228 X:95861994-95862016 AAGGAATGGTAGAAGCACTAGGG + Intergenic
1194713978 X:97269560-97269582 AAGGAATTCTAGAAGCACTAAGG + Intronic