ID: 1087571090

View in Genome Browser
Species Human (GRCh38)
Location 11:99928517-99928539
Sequence CTTCCATGTGGTGTTGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 4, 1: 15, 2: 20, 3: 36, 4: 164}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087571090_1087571094 -7 Left 1087571090 11:99928517-99928539 CCAGGCTCAACACCACATGGAAG 0: 4
1: 15
2: 20
3: 36
4: 164
Right 1087571094 11:99928533-99928555 ATGGAAGATGCCAAAGTGTGGGG 0: 1
1: 1
2: 19
3: 168
4: 1159
1087571090_1087571096 15 Left 1087571090 11:99928517-99928539 CCAGGCTCAACACCACATGGAAG 0: 4
1: 15
2: 20
3: 36
4: 164
Right 1087571096 11:99928555-99928577 GCTTGCACCCTCCGAAGCCATGG 0: 4
1: 342
2: 823
3: 993
4: 794
1087571090_1087571092 -9 Left 1087571090 11:99928517-99928539 CCAGGCTCAACACCACATGGAAG 0: 4
1: 15
2: 20
3: 36
4: 164
Right 1087571092 11:99928531-99928553 ACATGGAAGATGCCAAAGTGTGG 0: 1
1: 1
2: 19
3: 157
4: 1020
1087571090_1087571093 -8 Left 1087571090 11:99928517-99928539 CCAGGCTCAACACCACATGGAAG 0: 4
1: 15
2: 20
3: 36
4: 164
Right 1087571093 11:99928532-99928554 CATGGAAGATGCCAAAGTGTGGG 0: 1
1: 1
2: 17
3: 148
4: 949

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087571090 Original CRISPR CTTCCATGTGGTGTTGAGCC TGG (reversed) Intronic
900718287 1:4158991-4159013 CCTCCATGTGCTGCTGAGCACGG + Intergenic
900736478 1:4302482-4302504 CTTCCACCTGGAGCTGAGCCAGG - Intergenic
901861884 1:12079636-12079658 TTTCCATGTGGAGCTGAGCGAGG - Intronic
904457126 1:30654505-30654527 CTTCCATGTGGTGGTGGGTGGGG - Intergenic
906164361 1:43674874-43674896 CTTCCATGTGGTGTGGATGTAGG + Intronic
907347967 1:53799777-53799799 GTTCCATGTGTTTTGGAGCCAGG - Intronic
907619393 1:55961129-55961151 CTCCCCTGTGCTGTGGAGCCAGG + Intergenic
908084945 1:60621956-60621978 CTTCCTTGTGGCATTGAGCTGGG - Intergenic
908637320 1:66182573-66182595 CTTTGATTTGGTGCTGAGCCAGG + Intronic
909063433 1:70905110-70905132 CTTCCACATGGTGTTGAGTCTGG + Intronic
909488869 1:76204564-76204586 CTTGGGTGTGGTTTTGAGCCTGG + Intronic
910171453 1:84382018-84382040 CTTCCATGTAGACTTGAGCTCGG + Intronic
916192460 1:162192573-162192595 CTGCCATGTGGTTTTGGGCAAGG + Intronic
921228511 1:213045124-213045146 CCTACAGGTGGTGTTGAGGCTGG - Intergenic
1064720585 10:18225166-18225188 TTTCCATGTTCTGTTGAGCTGGG + Intronic
1065822840 10:29541898-29541920 CTTGTATGTGGTCTTGAGTCAGG - Intronic
1066654477 10:37685686-37685708 CCTACAGGTGGTGTTGAGTCTGG + Intergenic
1066798722 10:39158080-39158102 CTTCCATCTAGTGTTTACCCTGG - Intergenic
1066807636 10:39277194-39277216 CTTCCTTGTAGTTTTGATCCTGG + Intergenic
1066931542 10:41766898-41766920 CTTCCATCTAGTTTTGATCCTGG - Intergenic
1070820197 10:79349901-79349923 CTTCCATGTGCAGTGAAGCCTGG - Intronic
1072712114 10:97722629-97722651 TTTCCATGGGCTGTTGAGGCTGG - Intergenic
1074262726 10:111870376-111870398 CTTCCACGTGGTGTTGAGCCTGG + Intergenic
1076529131 10:131132923-131132945 CTTCCACGTGCTGTGGGGCCAGG + Intronic
1077391897 11:2304108-2304130 CTTCTCTGCGGGGTTGAGCCTGG + Exonic
1079418551 11:20264099-20264121 CTGCCGTGTGGTGCTGAGGCTGG + Intergenic
1080192759 11:29571121-29571143 CTTCCAAGTAGTGTTAAGTCTGG - Intergenic
1080449756 11:32369004-32369026 CTTCCACGTGGTGTTGAGCCTGG - Intergenic
1080931981 11:36820352-36820374 TTACCATGTGGGGTTGAGCATGG + Intergenic
1081261871 11:40971410-40971432 CTTCCACGTGGTGTTAGGCCTGG + Intronic
1081605500 11:44524877-44524899 CTTCCCTGTGGTGTGCAGCGAGG - Intergenic
1082594789 11:55064223-55064245 CTTCCTTGTAGTTTTTAGCCTGG - Intergenic
1085846286 11:80069548-80069570 CTTCTCTTTGGTGTTCAGCCAGG + Intergenic
1085987120 11:81800885-81800907 CTTACACATGGTGTTGAACCTGG + Intergenic
1087571090 11:99928517-99928539 CTTCCATGTGGTGTTGAGCCTGG - Intronic
1089340157 11:117751815-117751837 CTCCCAAGTGGAGTTGAGCAGGG + Intronic
1090988731 11:131796621-131796643 CTGCCTTGTGATGTTGAGGCTGG - Intronic
1091791717 12:3275736-3275758 GTTCCATGTGGGGCTGCGCCAGG + Intronic
1091833450 12:3567423-3567445 CACCCATTTGGTATTGAGCCTGG + Intronic
1095395404 12:41756991-41757013 CTTCCATGTGGTGTTGGACCTGG - Intergenic
1095544148 12:43345091-43345113 CTTTCATGTGGTGTTGAGCCTGG - Intergenic
1095731556 12:45511605-45511627 CTTCCACATGGTTTTGGGCCTGG - Intergenic
1096557887 12:52414919-52414941 CTTCCAGGTGGACTTGTGCCTGG - Intergenic
1096589115 12:52645490-52645512 GTTCCATGGGGTGTTGTGTCAGG - Intronic
1096805595 12:54139203-54139225 CTTCCATGAGCTGTTGAGTCAGG - Intergenic
1097202352 12:57289901-57289923 ATTCCATGTGGAGAGGAGCCTGG - Intronic
1098792080 12:74836921-74836943 CTTCCATGTGGCATTGAGTCTGG + Intergenic
1098830926 12:75361476-75361498 CTTCCATATGGTGTTGAGAGTGG - Intronic
1100244443 12:92743146-92743168 CTTCCAAGTTGTCTTGACCCTGG + Intronic
1102224365 12:111217471-111217493 CTTTCATGTAGTGCTGAGCATGG + Intronic
1103036176 12:117658631-117658653 CTTCCATGTCTTGTTGAGTGAGG - Intronic
1103558278 12:121778943-121778965 CTTCCATGTGGGGTGGAGATGGG + Exonic
1104675716 12:130710654-130710676 CTTCCTGTTGGTGCTGAGCCTGG - Intronic
1104750755 12:131236629-131236651 CTTCCATTTGGGTGTGAGCCCGG - Intergenic
1109182578 13:59231562-59231584 CTTTCATGTTGTGTTGACCAAGG + Intergenic
1110884183 13:80612502-80612524 CATCCATTTGGTGTTTAGTCTGG + Intergenic
1110926873 13:81164662-81164684 CTTCCATGTAGTGTTGAGCCTGG - Intergenic
1111103018 13:83611809-83611831 CTTCCATGTGGTGTTGAGCATGG - Intergenic
1114171063 14:20273026-20273048 CATACATATGGTGTTGGGCCTGG + Intronic
1114917346 14:27285442-27285464 CTTCCATGTAGTATTAAGCCTGG + Intergenic
1115112372 14:29839744-29839766 CTTCCACATGGTGTTCAGCCTGG - Intronic
1118235219 14:63996976-63996998 CTTCCATGTGGTGATTAAGCTGG - Exonic
1118364973 14:65087067-65087089 CTTCCTCATGGTATTGAGCCTGG + Intronic
1119149454 14:72344983-72345005 CTTCCATGTGGTATAGAGGCTGG + Intronic
1119765899 14:77187498-77187520 CCTCCATGGAGTGTGGAGCCTGG - Intronic
1121967843 14:98326861-98326883 GTTCCCAGTGGTGCTGAGCCTGG - Intergenic
1123155914 14:106225634-106225656 CTTCCATGTGGCATAAAGCCTGG - Intergenic
1124892742 15:33748039-33748061 CTTCCATGCGGAGATGGGCCAGG + Intronic
1129392119 15:75225805-75225827 CTCCCATGGGGTGTTCAGCCTGG - Intergenic
1129472261 15:75762359-75762381 CTCCCATGGGGTGTTCAGCCTGG + Intergenic
1129655927 15:77525797-77525819 CTTCCAAGGGGTGCTGAGTCGGG + Intergenic
1130409332 15:83631553-83631575 CTTACACATGGTGTTGGGCCTGG - Intergenic
1131598725 15:93825921-93825943 CTTCCCTGTGGTGGTGTCCCTGG - Intergenic
1131999393 15:98163721-98163743 CATCCCTGTGCTCTTGAGCCGGG - Intergenic
1132342631 15:101087900-101087922 CCTCAATGTGGTGTTGAGGGTGG + Intergenic
1134001415 16:10785912-10785934 CCTACAGGTGGTGTTGAGGCTGG + Intronic
1134001778 16:10788505-10788527 CTTACGGGTGGTGTTGAGGCTGG - Intronic
1135753957 16:25080925-25080947 CTTGCAGCTGGTCTTGAGCCTGG - Intergenic
1143621446 17:8082817-8082839 CCTACAGGTGGTGTTGAGGCTGG + Intronic
1144089430 17:11840933-11840955 CATCCATGTTGTTTTGAGTCAGG + Intronic
1146441347 17:32897798-32897820 CTTCTTTGTGGTCTTCAGCCAGG - Intergenic
1149341117 17:55687374-55687396 CTTCTATGTGGTGTTGAGCCTGG + Intergenic
1150782657 17:68135380-68135402 CTTGCACGCGGTGTTGAGCATGG + Intergenic
1151424425 17:74021511-74021533 CTTCCAAGTGGTGAGGAGCCAGG + Intergenic
1152357805 17:79815124-79815146 CTTCCATGGTGCGGTGAGCCAGG + Intergenic
1159955364 18:74515168-74515190 CTTCCAGGAGATGGTGAGCCCGG + Intronic
1163234511 19:16022891-16022913 CTGCCAGGTGGGGGTGAGCCAGG - Intergenic
1165010626 19:32843785-32843807 CATCCATGGGGTGCTAAGCCCGG - Intronic
1165556430 19:36636552-36636574 CCTACAGGTGGTGTTGAGGCTGG - Intergenic
1165636096 19:37341443-37341465 CTTCCATGTGGGCTTGGGCTTGG + Intronic
926019586 2:9483511-9483533 CTTCGCTGTGATGTAGAGCCTGG + Intronic
928836974 2:35559085-35559107 CCTACATGTGGTGTTGGGCCAGG + Intergenic
932799899 2:74732040-74732062 CTTCCATCTGGAGATCAGCCCGG - Intergenic
934089203 2:88536786-88536808 GTTACATGTGGACTTGAGCCAGG - Intergenic
935448861 2:103187230-103187252 CTTCCACATGGTGCTGAGCCTGG + Intergenic
935735438 2:106103330-106103352 ATTCCATGTGGTGTGGGGGCTGG + Intronic
936146954 2:109986661-109986683 CTTCCAGGTGGTGCTGGGCTGGG - Intergenic
936197738 2:110384822-110384844 CTTCCAGGTGGTGCTGGGCTGGG + Intergenic
936984620 2:118297146-118297168 CTTCCATGTGGTGTTCTGTGTGG - Intergenic
937779773 2:125823611-125823633 ATTCCATTTTGTGCTGAGCCAGG - Intergenic
939506398 2:143052633-143052655 CTTCCATATGGTGTTGAGCCTGG + Exonic
944044049 2:195388466-195388488 CTTCCATGTGGTATCGAGCCTGG + Intergenic
945419889 2:209621652-209621674 CTTCCCTGGATTGTTGAGCCAGG - Intronic
945618690 2:212106871-212106893 CATCCACATGGTGTTGACCCTGG + Intronic
946367207 2:219255764-219255786 TTTCCAAGTGATGTAGAGCCAGG - Intronic
946875913 2:224129779-224129801 CTTCCAGGTGGTGGTGAGAAAGG - Intergenic
947160949 2:227213546-227213568 CTTACATATGGTGTAGAGCTTGG - Intronic
948642424 2:239384125-239384147 CATCGATGTGGTGTGCAGCCAGG - Intronic
1170710607 20:18787112-18787134 CTTCCACATGGTGTTGAACCTGG - Intergenic
1172244197 20:33434372-33434394 CTTCCATGAGATCTTGGGCCAGG + Intronic
1176037202 20:63045370-63045392 CTGCCATCTGGTTTTGAGACTGG + Intergenic
1176085352 20:63293284-63293306 CTTCCCTGTGGTCCTGAGGCTGG + Intronic
1176934103 21:14846306-14846328 CTTCCATGCAGAGTTGGGCCTGG - Intergenic
1177606027 21:23378912-23378934 CGTCCATGTGGTATTGATCCTGG + Intergenic
1178338607 21:31766227-31766249 CTTCCATGTGGTATTGAGCCTGG + Intergenic
1179499918 21:41801707-41801729 CTTCCAGGTAGTGGTGACCCTGG - Exonic
1180158092 21:45987675-45987697 CTCCCATGTGTTGTGGGGCCTGG + Intronic
1182282103 22:29223908-29223930 CTTCCTTGTAGGATTGAGCCAGG + Intronic
1182887659 22:33789259-33789281 CTTCCACATGCTGTTGGGCCTGG + Intronic
1184600861 22:45542545-45542567 CCTCCAAGTGCTGATGAGCCAGG + Intronic
950179038 3:10897979-10898001 CTTCCACGTGGTGTTGAGCCTGG - Intronic
951646592 3:24898832-24898854 CTTGAATGTGGTGTGCAGCCTGG - Intergenic
951875968 3:27425915-27425937 CTTCCATGTGTTGCTGTGCATGG - Intronic
952768556 3:36976646-36976668 CTTCTATGTGGCGATGATCCAGG + Intergenic
953359191 3:42280150-42280172 CTTCCATGTGGTGTTGGGCCTGG + Intergenic
954191231 3:48963090-48963112 CTTCCCAGTTGTGTTCAGCCCGG - Intronic
954449157 3:50562438-50562460 CCTGCATGTGGCTTTGAGCCTGG - Intronic
957953165 3:87150202-87150224 CTTCCATGTGGTGTTGGGCCTGG - Intergenic
958582956 3:96050843-96050865 CTTCCATGTGGAGTTAAGCCTGG - Intergenic
958685419 3:97386902-97386924 CTTCCACATGGTGTTAAGACTGG - Intronic
961067972 3:123892239-123892261 CTTCCATGTTGTGTTGGGCCTGG - Intergenic
962636620 3:137338479-137338501 CTTCCACGTGGTGTTGGTCCTGG + Intergenic
963011676 3:140775937-140775959 CTTTCATGTGGTGTTGAGCATGG - Intergenic
963466072 3:145684836-145684858 CTGCCATGGGGTCTTGATCCAGG - Intergenic
967153172 3:186668109-186668131 CTAACATGTGTTGATGAGCCTGG - Intronic
967318301 3:188171223-188171245 CCTCCATGTACTTTTGAGCCTGG + Intronic
967997771 3:195179846-195179868 CCTAAGTGTGGTGTTGAGCCAGG + Intronic
968480349 4:830429-830451 CTGCCCTGAGGTGTTGAGGCTGG - Intergenic
968953143 4:3704961-3704983 CTTCAATGTGGGGTTGTGCTGGG - Intergenic
970244865 4:14050316-14050338 CTACAATGTTATGTTGAGCCTGG + Intergenic
971094772 4:23388434-23388456 GTTGCATGTGGTGCTGAGCCAGG + Intergenic
971924288 4:32986797-32986819 CTTCCAAGTGCCCTTGAGCCAGG + Intergenic
972370559 4:38419462-38419484 CTTCCATGTGGTGTTGAGCCTGG - Intergenic
974981898 4:68967219-68967241 CTTCCACGTGCTGTTGGGCCTGG - Intergenic
975629022 4:76380964-76380986 CTTCCATGTGGTGTTGAGCCTGG + Intronic
977820958 4:101472198-101472220 CTTCCACATGGTGTTGAGCCTGG + Intronic
978145409 4:105366143-105366165 CTTCCATGTGGTGTTGAGCCTGG + Intergenic
978370770 4:108027717-108027739 CTTCCATGAGGTATGGAACCAGG - Exonic
978696341 4:111584539-111584561 CTTCCATGTGATATTGGGCCTGG - Intergenic
979794225 4:124825865-124825887 CTTCCATGTGGTACTTAACCAGG - Intergenic
983298041 4:165891013-165891035 CTTATATGTGGTGGTGTGCCTGG - Intronic
983647633 4:170007831-170007853 CTCCCCTGTGGTATTTAGCCAGG - Intronic
986350074 5:6868984-6869006 CTCCCCTGTGATGCTGAGCCTGG - Intergenic
988103159 5:26708293-26708315 CATCCAAGAGGTGTTGAGGCTGG + Intergenic
988162860 5:27543929-27543951 CTTCCATGTGTTATTGAGCCTGG + Intergenic
988379004 5:30477177-30477199 CTTCCACGTGATGTTAAGCCTGG - Intergenic
989848728 5:46180157-46180179 CTTCCTTCTGGTTTTGATCCTGG + Intergenic
990204567 5:53414839-53414861 CTCCCTTGTGGTGCTGAGCAGGG - Intergenic
990213725 5:53508130-53508152 CTTCCATGTGATGATGGGCCAGG - Intergenic
990595548 5:57309370-57309392 CTTCCACATGGTGTTGAGCCTGG + Intergenic
991640775 5:68749652-68749674 CTTCCATGTGGTCTAAAGCCTGG - Intergenic
992375669 5:76185552-76185574 CTTACACATGGTGTTGGGCCTGG - Intronic
994548718 5:101204983-101205005 TTTCCACCTGGTGTTGAGCCTGG + Intergenic
994878897 5:105461013-105461035 CTTCCCTGTGGTTTTGGGCCTGG - Intergenic
996157093 5:120115364-120115386 CTTCCATGTGGTGGTAAGCTTGG + Intergenic
997088330 5:130827054-130827076 CTTCCACGTGGTGTTGGTTCTGG - Intergenic
997273733 5:132564881-132564903 CTTCCACATGGTGTTAAGCCTGG + Intronic
1001261842 5:170236482-170236504 CTTCACTGTGGTGTTGAAGCTGG - Intronic
1005641767 6:27803089-27803111 TTACCATGTTGTGTTGAGCAGGG + Intergenic
1006151109 6:31990514-31990536 CCTACAGGTGGTGTTGAGGCTGG - Intronic
1006157410 6:32023252-32023274 CCTACAGGTGGTGTTGAGGCTGG - Intronic
1006905750 6:37532286-37532308 CTGCCATGTGGTCTTGGGCAAGG + Intergenic
1009061899 6:58406756-58406778 CTTCCATCTGGTTTTTATCCTGG + Intergenic
1011025186 6:82860962-82860984 CTTCCATCTTCTGATGAGCCTGG - Intergenic
1011218892 6:85033589-85033611 CTTCCATGAGGTGTTTGGCCTGG - Intergenic
1012981488 6:105834978-105835000 CTTCCAGTTAGTGTTGGGCCAGG - Intergenic
1017413755 6:154197641-154197663 ATTGCATGTGCTGTAGAGCCTGG - Intronic
1018093721 6:160366763-160366785 CTTTCATGTGGTGTTGGTCCCGG - Intronic
1018472906 6:164112269-164112291 GAACCATGTGGTGTTGAACCTGG - Intergenic
1020407684 7:7855437-7855459 CTTCCAGGTGGTGTTGGTCTTGG - Intronic
1020455983 7:8374244-8374266 CTTCAATGCAGTTTTGAGCCTGG + Intergenic
1020729677 7:11866004-11866026 CTTCCATGTGGTGTTGGCATGGG + Intergenic
1020903559 7:14037133-14037155 GTACAATGTGGTGTTGAGCATGG + Intergenic
1021762262 7:23913399-23913421 CTTCCATGTGGTGTTGGTCCTGG + Intergenic
1024243708 7:47454236-47454258 CTGCCTTGTGGAGCTGAGCCTGG - Intronic
1024308451 7:47947613-47947635 CACCCATGTGTTGTTGAGGCTGG - Intronic
1024403391 7:48950191-48950213 CTTCTATGTGGTGTTAAGCCTGG - Intergenic
1027154308 7:75755694-75755716 GTTGCAGGTGGTGTTGAGCATGG - Intergenic
1030415477 7:109238187-109238209 CTTCCATGTGATGTTGGGCCTGG + Intergenic
1031645575 7:124221556-124221578 CTTCCACGTGGTGTTGAGACTGG + Intergenic
1038865937 8:31438941-31438963 CTCCCATGAGGTGGTGAGCTGGG + Intergenic
1039093985 8:33863722-33863744 ATTGCAAGTGGTGTTGAGGCAGG - Intergenic
1039983324 8:42427508-42427530 CATGCGTGTGGTGTTGAGCACGG + Intronic
1040021717 8:42746805-42746827 CTGTCCTGTGGTGGTGAGCCTGG - Intergenic
1040348351 8:46534223-46534245 CCTACAGGTGGTGTTGAGGCTGG + Intergenic
1041121517 8:54591060-54591082 CTTACATGAGGTGTGTAGCCAGG - Intergenic
1042151402 8:65789821-65789843 CTGCCATCTGGTGCAGAGCCTGG - Intronic
1043370333 8:79583865-79583887 CTTACATGTGGTGTTGAGCCTGG + Intergenic
1044087208 8:87955873-87955895 CTTCCACATGGTGTTGAGCCTGG - Intergenic
1044807516 8:96023162-96023184 ATGCCATGTGGTGGTGAGCAAGG - Intergenic
1047628050 8:126677215-126677237 CTTCCATGTGATGTTGAGCCTGG + Intergenic
1048096461 8:131300595-131300617 CTTCCATGTGGTATTAAGCCTGG - Intergenic
1048416808 8:134235609-134235631 CTTCTATGTGGTGTTGGGCCTGG - Intergenic
1052267426 9:26590633-26590655 CTTCCAGATGGTGTTGAGCTTGG - Intergenic
1052472842 9:28921899-28921921 CTTCCCTGAGGTGTTGAATCAGG + Intergenic
1052576053 9:30293226-30293248 CTTCCACGAGGTGTTGAGCATGG - Intergenic
1052877770 9:33580294-33580316 CTTCCACATAGTGTTAAGCCAGG + Intergenic
1053498215 9:38563911-38563933 CTTCCACATAGTGTTAAGCCAGG - Intronic
1055180485 9:73380526-73380548 CTTCCACATGGTGTTGGTCCTGG - Intergenic
1055878466 9:80970719-80970741 CTTCCACGTGGTGTTGAGCCTGG + Intergenic
1056595150 9:88001955-88001977 CTTCCATCTGGTGTTGAGCCTGG + Intergenic
1057677681 9:97148407-97148429 CTTCCACATAGTGTTAAGCCAGG - Intergenic
1058117137 9:101097239-101097261 CTTCCAGGTGATGCTGCGCCTGG + Intronic
1059717159 9:116923931-116923953 CTCCCATGTGCTGTGGAGCAGGG + Intronic
1060931597 9:127492598-127492620 CTTCCTTGTGGGGTTAAGTCAGG - Intronic
1061193137 9:129093852-129093874 CTTCCTTGTGGTCCTGAGGCTGG + Intergenic
1061696440 9:132378729-132378751 CTTGCATGTGGTGTGGTGCACGG + Intronic
1061959171 9:133979309-133979331 CTGCCACGAGGTGCTGAGCCAGG + Intronic
1185753446 X:2632826-2632848 CTCCCATGTGGTTTTGTGCCTGG + Intergenic
1185765573 X:2723396-2723418 CTCCCACGTGGTGTTGAGAAGGG + Intronic
1188325533 X:28796998-28797020 CTTCCACATGGTGTTGAGCCTGG - Intronic
1188587960 X:31800341-31800363 CTTACATGTGGTGTTGGGCCTGG - Intronic
1189549608 X:42079228-42079250 GTTCCATGTGGTGTTGACTGAGG + Intergenic
1190596559 X:52057785-52057807 CTTTCATGTGTTGTTGAACTCGG + Intergenic
1190612265 X:52196288-52196310 CTTTCATGTGTTGTTGAACTCGG - Intergenic
1191268784 X:58434337-58434359 CTTCCTTCTGGTTTTTAGCCTGG + Intergenic
1193717086 X:84945643-84945665 CATGCATGTGGTTGTGAGCCTGG + Intergenic
1194053827 X:89105243-89105265 CTTCCACATGGTGTTGGGCCTGG - Intergenic
1194541455 X:95177695-95177717 CTTCCATGTGATGTTTAGCCTGG + Intergenic
1197372929 X:125646737-125646759 ATTCCACGTGGTGTTGGGCCTGG - Intergenic
1197442846 X:126511979-126512001 CTTACACATGGTGTTGAGCCTGG - Intergenic
1197544875 X:127812352-127812374 CTTACACATGGTGTTGGGCCTGG + Intergenic
1197558438 X:127987707-127987729 CATCCATGTGATGTTGAGGGTGG + Intergenic
1198313141 X:135438960-135438982 CTTCCTTGAGAGGTTGAGCCAGG + Intergenic
1198946835 X:142025381-142025403 CTTCCATGTGGTGTTAAGTCTGG + Intergenic
1199203859 X:145124580-145124602 ATTCCTTGTGGTGTTGGGCCTGG - Intergenic
1199214043 X:145246632-145246654 CTTCCACATGGTGTTAAGCCTGG - Intergenic
1201346827 Y:12993881-12993903 CCTACATGTGATGTTGAGGCTGG - Intergenic
1202091376 Y:21194366-21194388 TTTCCATATGGTGTTGAGCCTGG + Intergenic