ID: 1087571185

View in Genome Browser
Species Human (GRCh38)
Location 11:99929245-99929267
Sequence CTCAGAAGACAGAAAGATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1866
Summary {0: 1, 1: 59, 2: 333, 3: 554, 4: 919}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087571185_1087571189 -6 Left 1087571185 11:99929245-99929267 CCCCCATCTTTCTGTCTTCTGAG 0: 1
1: 59
2: 333
3: 554
4: 919
Right 1087571189 11:99929262-99929284 TCTGAGCCCTCTAAGTCTCTAGG 0: 17
1: 198
2: 247
3: 195
4: 398

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087571185 Original CRISPR CTCAGAAGACAGAAAGATGG GGG (reversed) Intronic
900492226 1:2956356-2956378 CTCAGAAGACAGGAAAATGTGGG - Intergenic
900628322 1:3619880-3619902 CTCAGAAGACAGGAAGCTGTGGG + Intergenic
900817257 1:4857969-4857991 CTCAGAAGACAGAGAGATGTGGG + Intergenic
900986170 1:6073887-6073909 CTCACAAAACAGAAAGAGGGAGG - Intronic
901575608 1:10198424-10198446 CTCAGAAAAAAGAAAAAAGGAGG - Intergenic
902095335 1:13939543-13939565 AGAAGAAGACAGAAAGATGAGGG - Intergenic
902407487 1:16193000-16193022 CTCAAAAAACAGAAAGATGGGGG + Intergenic
902715962 1:18272862-18272884 CTCAGATGACAGAGATATGTGGG + Intronic
902860922 1:19245013-19245035 CTCAGGAGACAGCAATATGTTGG - Exonic
903162711 1:21500802-21500824 CACAGAAGACAGGGAGATGATGG + Intergenic
903503709 1:23817488-23817510 CTTAGGAGACACAAAGCTGGTGG + Exonic
903974683 1:27141745-27141767 CTCAGGTTACAGCAAGATGGGGG - Intronic
904345197 1:29863455-29863477 CTCAAAAAACAAAATGATGGGGG + Intergenic
904490291 1:30854488-30854510 CTCAGGAGGTAGAAAGAGGGAGG - Intergenic
904531287 1:31171360-31171382 CTCAGAAAAAAAAAAGAAGGGGG - Intergenic
904951120 1:34239777-34239799 TTCACCAGAGAGAAAGATGGGGG - Intergenic
905008784 1:34732651-34732673 GACTGAAGTCAGAAAGATGGAGG - Intronic
905091367 1:35433763-35433785 CACAGAACACATACAGATGGAGG + Exonic
905113162 1:35612593-35612615 ATTAGAAGAGAGAAAGAGGGAGG + Intronic
905458257 1:38103489-38103511 ATCAGAGGTCAGACAGATGGAGG - Intergenic
906185409 1:43858709-43858731 CTCAGCAGAGAGCAAGATGCTGG + Intronic
906505105 1:46373175-46373197 ATCAGAAGACAAAAAGATTAGGG - Intergenic
906764071 1:48410405-48410427 CTCAGAAAGCAGGAAGATGTGGG - Intronic
906769939 1:48474906-48474928 CTCAGAAGACAGGAAAATGTGGG + Intergenic
906836013 1:49084129-49084151 CTCGGAAGACAGGAAGATGTGGG - Intronic
906872744 1:49502505-49502527 CTCAGAAGACAAAAAATTGGGGG + Intronic
906894596 1:49757494-49757516 CTCAGAAGACAGTAAGAAGTGGG + Intronic
906938359 1:50234398-50234420 CTCAGAAGACAGGAAGATGCAGG + Intergenic
906991642 1:50745895-50745917 CTCAGAAGACAAGAAGATGAGGG + Intronic
907505890 1:54918078-54918100 CTAAGAGGAGAGAGAGATGGAGG - Intergenic
907584990 1:55609053-55609075 CTCAGAAGATAGGAAGATGTGGG - Intergenic
908006823 1:59736389-59736411 CTCAGAAGATAGGAAAATGTGGG + Intronic
908020089 1:59890167-59890189 CTCAGAAGACAGGAAAATGTGGG - Intergenic
908062905 1:60371246-60371268 TTCAGAAGACAAGAAGATGAGGG + Intergenic
908090928 1:60685169-60685191 CTCAAAAGACAGGAAGATGTGGG + Intergenic
908330505 1:63066220-63066242 CTTAAAAGAGAGAAAGAGGGAGG - Intergenic
908746934 1:67384931-67384953 CTGAGAAGATAGGAAGATGTGGG - Intronic
908885108 1:68780168-68780190 CTCAGAAGACAGGAAGTTGTGGG + Intergenic
909044290 1:70690435-70690457 CTCAGAAGACAGGAAGGTGTGGG + Intergenic
909065668 1:70932295-70932317 CTCAGAAGACAGGAAAATGTGGG - Intronic
909068519 1:70964173-70964195 CTCAGAGGACAGAAAGATGCGGG - Intronic
909068527 1:70964227-70964249 CTCAGAAGATAGGAAAATGTGGG - Intronic
909083619 1:71146230-71146252 CTCAGAAGACAGAAAGACGTGGG + Intergenic
909177731 1:72381404-72381426 CTCCGAAGACAGGAAGATGCTGG - Intergenic
909257120 1:73438426-73438448 CTCAGAAGACAGGAAAATGTAGG + Intergenic
909259799 1:73472880-73472902 CTCAGAAAACACAATCATGGCGG + Intergenic
909269272 1:73601758-73601780 CTACGAAGACAGGAAGATGTGGG - Intergenic
909357592 1:74727087-74727109 CTCAGAAGACAGGAAGATTTGGG - Intronic
909376685 1:74949627-74949649 CTCAGAAGATAGGAAGATGTGGG + Intergenic
909405179 1:75281105-75281127 CTCAGAAGACAGGTAGAGGTGGG + Intronic
909457682 1:75869033-75869055 CTCAGAAGACAGGAAGTTGTAGG + Intronic
909580031 1:77223121-77223143 CTCAGAAGACAGAAAGATGTAGG - Intergenic
909660368 1:78075574-78075596 CTCAGCTGGCAGGAAGATGGTGG + Intronic
909719713 1:78754014-78754036 CTCAGAAGACAGGAAGATGTGGG + Intergenic
910001855 1:82351014-82351036 CTCAGAAGATACAAAAATGTGGG - Intergenic
910083662 1:83372539-83372561 CTCAGAAGATAGGAAAATGTGGG - Intergenic
910287285 1:85569770-85569792 CCCAGAGGAAAGAAAGGTGGAGG + Intronic
910417258 1:87014025-87014047 CTCAGAAGACAGAAAGATGTGGG - Intronic
910625768 1:89304899-89304921 CAGCCAAGACAGAAAGATGGGGG - Intergenic
910707011 1:90140515-90140537 CTCAGAAGACAGGAAGATGTGGG - Intergenic
911235041 1:95403424-95403446 CTCAAAAGACAGGAAGATGAGGG + Intergenic
911512671 1:98826891-98826913 CTGAGAAGATAGGAAGATGATGG + Intergenic
911579287 1:99616913-99616935 CTCAGAAGATAGAACGAGGCCGG + Intergenic
911695965 1:100890802-100890824 CTCAGAAGACAGGAAGATGTAGG - Intronic
911799112 1:102110991-102111013 CTCAGAAGATAGCAAAATGTGGG - Intergenic
912084375 1:105981138-105981160 CTCAGAAGACAAGAAGATGTGGG + Intergenic
912086701 1:106014861-106014883 TTCAGAAGACAGGAAGATGAGGG - Intergenic
912096340 1:106149308-106149330 CTAAGAAGACAGGAAGATGTGGG + Intergenic
912099107 1:106184201-106184223 CTCAGAAGACAGGAAAATGTGGG + Intergenic
912147455 1:106810622-106810644 CTCAGAAGACAGGAGGATGTGGG - Intergenic
912205971 1:107510031-107510053 CTCAGAACACAGGAAGATGTGGG + Intergenic
912267503 1:108173702-108173724 CTCAGAAGACAAAAAGAGGTGGG + Intronic
912811386 1:112797748-112797770 GTCAGAAGACAGAGTGATGTTGG + Intergenic
912861233 1:113215787-113215809 CTCAGAAGACAGGAAGATAAGGG - Intergenic
913018454 1:114763349-114763371 CTCAGAAGACAGGAAGATGTGGG + Intergenic
913094380 1:115502656-115502678 AGAAGAAGACAGAAAGATGTGGG + Intergenic
913595449 1:120371669-120371691 CTCAGAAGACAGAGAGTTGGGGG + Intergenic
913978836 1:143489301-143489323 CTCAGAAGACAGGAAAATGTGGG - Intergenic
914073242 1:144314950-144314972 CTCAGAAGACAGGAAAATGTGGG - Intergenic
914091825 1:144507306-144507328 CTCAGAAGACAGAGAGTTGGGGG - Intergenic
914105912 1:144651410-144651432 CTCAGAAGACAGGAAAATGTGGG + Intergenic
914306714 1:146426558-146426580 CTCAGAAGACAGAGAGTTGGGGG + Intergenic
914595335 1:149146244-149146266 CTCAGAAGACAGAGAGTTGGGGG - Intergenic
915526559 1:156479793-156479815 TTGACTAGACAGAAAGATGGAGG + Exonic
915923300 1:159995191-159995213 CTCAGAAGACAGGAAAATGTGGG - Intergenic
915983022 1:160434291-160434313 CTCAGAAGACAGGAAAATGTGGG - Intergenic
916401113 1:164449451-164449473 CTCAGAAGACAGGAAGATTAGGG - Intergenic
916542134 1:165767226-165767248 CACAGAATACAGAAAGTTGTAGG + Intronic
916735946 1:167607155-167607177 CTCAGAAGATTGGAAGATGGGGG + Intergenic
916802114 1:168225704-168225726 CTCCGGAGACACAAAGACGGGGG - Intergenic
916910444 1:169340581-169340603 CTCAGAAGAAAAGAAGATGTGGG + Intronic
916963775 1:169914653-169914675 CTCAGAAGACAAAAAGCGGGTGG - Intergenic
917140229 1:171827923-171827945 CTTAGAAGACAGGAAGATACAGG - Intergenic
917152275 1:171957853-171957875 CTCAGAAGACAGGAAAATGTGGG - Intronic
917547221 1:175983655-175983677 TTCAGAAGACAGGAAAATGTGGG + Intronic
917587491 1:176442516-176442538 CTCAGATGGCAGAGAGGTGGAGG + Intergenic
917946848 1:179982555-179982577 CTAAGAAGACATAGAGATTGTGG + Intronic
918025947 1:180746268-180746290 CTCAGAAGAGAGGAAGGTGGGGG - Intronic
918167701 1:181966095-181966117 CTCAGAAGACAGGAAGATGTAGG - Intergenic
918738284 1:188095029-188095051 ATCAGAAGACAGAAAGCTCATGG - Intergenic
918766876 1:188498473-188498495 CTCAGAAGACTGGAAGATGAGGG + Intergenic
918786964 1:188775453-188775475 CTCAGAAGACAGGAAAATGTGGG + Intergenic
918897616 1:190367897-190367919 CTCAGAAGACAGGAAGATGTGGG - Intronic
919028009 1:192202238-192202260 CTCAGAAGACAAGAAGATGTGGG - Intergenic
919028015 1:192202292-192202314 CTCAGAAGACAGGAAAATGTGGG - Intergenic
919211805 1:194496438-194496460 CTCAGAAGACAGGAATATGAGGG - Intergenic
919473868 1:198010980-198011002 CTCAGAAGACAGGAAGATGTGGG - Intergenic
919522164 1:198601660-198601682 CTCAGAAGATAGGAATATGTGGG - Intergenic
919593496 1:199533025-199533047 CTCAGAAGACAGGAAAATGTGGG + Intergenic
919663073 1:200266977-200266999 CTCAGTAGAGAGTAACATGGTGG + Intergenic
919761002 1:201098017-201098039 CTAAGAAGATAGACAGTTGGGGG - Intronic
920594605 1:207256299-207256321 GTCAGAAGACAGGAAGATGTGGG - Intergenic
921528242 1:216245178-216245200 CCCAGAAGACAGGAAGATTATGG - Intronic
921531162 1:216284725-216284747 CTCAGAAGACAGAAAGATGTGGG + Intronic
921763094 1:218939882-218939904 CTCAGAAGACAGGAAAATGTGGG + Intergenic
921880415 1:220249210-220249232 CTCAGAAGACAGGAAGAGGTGGG + Intronic
922042648 1:221911858-221911880 CTGTGAAGACAGGAAGATGGGGG + Intergenic
922320281 1:224480830-224480852 CTCAGAAGACAGGAAAATGTGGG - Intronic
922371127 1:224911299-224911321 CTCTGAAGACAGGAAGATATTGG - Intronic
922530359 1:226340587-226340609 CTCAGAAGACAGGAAAATGTAGG + Intergenic
922667923 1:227488602-227488624 CTTAGAAAACAGGAAGATGTTGG - Intergenic
923047508 1:230366378-230366400 CTCAGAAGTCAGATAGATAGTGG - Intronic
923088661 1:230721560-230721582 CTCAGAAGACAGGAAGATGTGGG + Intergenic
923179259 1:231500120-231500142 CTCAGAAGACAGGAAAATCTGGG - Intergenic
923297738 1:232611404-232611426 CTCAGAAGAGAGAAAAATGTGGG + Intergenic
923919473 1:238547136-238547158 CTCAGATGACAGGAAAATGTGGG - Intergenic
924162674 1:241249835-241249857 TTGAGAAGATAGAAAAATGGTGG + Intronic
924751745 1:246899197-246899219 CTGAGGAGACAGAAAGCTTGAGG + Intronic
1062859168 10:796561-796583 CTCAGAAGAAAGGAAGATGTGGG + Intergenic
1063919498 10:10918142-10918164 CTCAAATGACAGAAAGATAAAGG + Intergenic
1063958586 10:11287235-11287257 AACTGAAGATAGAAAGATGGTGG - Intronic
1064584084 10:16822317-16822339 CTCAGAAGACATAAAGATGAGGG + Intergenic
1064936698 10:20686387-20686409 CTCAGTTGACAGAAAATTGGAGG - Intergenic
1065456249 10:25909606-25909628 TTCAGAAGACAGGAAGATGTAGG + Intergenic
1066040553 10:31544738-31544760 CCCAGAAGACGGGAAGATGAGGG + Intergenic
1066154311 10:32658112-32658134 CTTAGAAGGCAGGAAGATGTGGG - Intronic
1066285612 10:33963213-33963235 ATCAGAGGACAGAAAAGTGGGGG - Intergenic
1066449175 10:35512455-35512477 CTGAGTAGCCAGAAAGATGGGGG + Intronic
1067321927 10:45229354-45229376 CTCAGAAGACAGAAAGATGAGGG + Intergenic
1067967007 10:50924233-50924255 CTCAGAAGACAGGAAGATGTGGG - Intergenic
1068045683 10:51883250-51883272 TGCAGAAGCCAGAAAGATGGTGG - Intronic
1068056303 10:52016021-52016043 CTCAGAAGACAAGAAGATGAAGG - Intronic
1068130017 10:52885241-52885263 CTCAGAAGAAAGAAGGAAGCCGG - Intergenic
1068155039 10:53187429-53187451 CTCAGAAGACAGGAAGATGTGGG + Intergenic
1068221458 10:54051329-54051351 CTAGGAAGACAGAAAGAAGTGGG + Intronic
1068222146 10:54058069-54058091 CTCAAAAGGCAGGAAGATGAGGG - Intronic
1068285141 10:54923837-54923859 CTCAGAAGACTGTAAGATGAAGG - Intronic
1068454538 10:57237891-57237913 CTCAGAAGACAGGAAGATGTGGG + Intergenic
1068487489 10:57678510-57678532 AGAAGAAGACAGAAAGATGTGGG - Intergenic
1068495151 10:57777365-57777387 CTCAGAAGACAGGAAGATATGGG - Intergenic
1068495158 10:57777419-57777441 CTCAGAAGACATGAAGATATGGG - Intergenic
1068805862 10:61193264-61193286 TTCAGAAGACAGGGAGATGTGGG - Intergenic
1069077459 10:64052931-64052953 CTCAGAAGACAGGAAGATGTGGG - Intergenic
1069159706 10:65078829-65078851 AGAAGAAGACAGAAAGATGTGGG + Intergenic
1069339787 10:67397217-67397239 CTCAGAAGACAGGAAGGTGTGGG + Intronic
1070456315 10:76620756-76620778 CTCAGAAGAAAGGAAGACGTGGG - Intergenic
1070595386 10:77829348-77829370 CTCAGTGGACAGAAAGGTAGCGG - Exonic
1071061727 10:81577696-81577718 CTCAGAAGACAGGAAGATGTAGG + Intergenic
1071243914 10:83741658-83741680 CTCAGAAGAAAAGAAGATGTGGG - Intergenic
1071244788 10:83750945-83750967 CTCAGAAGACAGGAAGATGTGGG + Intergenic
1071245120 10:83753543-83753565 CTCAGAAGACAGGAAGATGTGGG - Intergenic
1071327645 10:84533195-84533217 CTCAGAAGACAGGAAGATGTGGG + Intergenic
1071338237 10:84619429-84619451 CTCAGAAGACAGGAAGATGAGGG + Intergenic
1071367694 10:84916667-84916689 CTCAGAGGACAGAAAGAAGGAGG - Intergenic
1071514534 10:86288521-86288543 CTCAGAAACCAGAAACAAGGTGG + Intronic
1071776781 10:88798070-88798092 CTCAGAAGACAGGAAAATGTGGG - Intergenic
1071934265 10:90509394-90509416 CTCAGAAGACAGGAAGATGGGGG - Intergenic
1071981120 10:91005096-91005118 CTCAGAAGATAGGAAGATGTGGG - Intergenic
1071990239 10:91094180-91094202 CTCAGAAGACAGGAAGATGAGGG - Intergenic
1071990657 10:91097998-91098020 CTCAGAAGACAGGAAGATTTGGG - Intergenic
1072182253 10:92997323-92997345 CTCAGAATACAGAAACAGGAAGG + Intronic
1072296108 10:94010913-94010935 AGAAAAAGACAGAAAGATGGGGG - Intronic
1072527155 10:96282637-96282659 CTCAAAAGACAGGGAGATAGAGG - Intergenic
1072866583 10:99068169-99068191 CTCAGAAGACAGGAAGATGCGGG - Intronic
1073776324 10:106789686-106789708 ATCAGAAGACTGGAAGATGTGGG - Intronic
1073864507 10:107786613-107786635 CTCAGAAGACAGAAAGATGTGGG + Intergenic
1074650945 10:115523780-115523802 CTCATAAGATAGAAAAATGAGGG - Intronic
1074766105 10:116701060-116701082 CTCGGGAGTCAGCAAGATGGTGG + Exonic
1075008861 10:118851354-118851376 CTCACAGGACAGAGGGATGGAGG - Intergenic
1075279609 10:121128461-121128483 CCCATAAGACGGGAAGATGGAGG - Intergenic
1076346552 10:129782715-129782737 CTCAGAAGTCATAAAGAAGAAGG + Intergenic
1076532199 10:131152511-131152533 CTCAGAAGACAGGAAGATGTGGG - Intronic
1077571073 11:3339054-3339076 CTCAGAAGACAGGCAGCTGCAGG + Intergenic
1077594267 11:3518140-3518162 CTCAGAAGAAAGAGATGTGGGGG + Intergenic
1077627439 11:3785308-3785330 CACAGAAGAGAGATAGATAGAGG - Intronic
1077941436 11:6847811-6847833 CAAAAAAGACAGAAAGATGAGGG + Intergenic
1078514882 11:12013542-12013564 CTCAGAAGACAGGAAGATGTAGG + Intergenic
1078515953 11:12022699-12022721 CTCAGAAGACAGGAAGATGTGGG + Intergenic
1078540815 11:12211609-12211631 GTCAGATGACAGCAAGATGGGGG + Intronic
1079253841 11:18809389-18809411 ATCAGAAGAAAGAAAGAGGAAGG - Intergenic
1079341156 11:19612757-19612779 CTCAGAAGACAGGAAAATGTGGG - Intronic
1079475417 11:20824519-20824541 CCCAGAAGACAGGAAGATGTGGG + Intronic
1079537070 11:21527326-21527348 CTCAGAAGACAGGAAGATACGGG - Intronic
1079568708 11:21915937-21915959 CTCAAAAGATAGGAAGATGTGGG + Intergenic
1079707447 11:23638359-23638381 ATCAGAATACAGGAAGATGAGGG - Intergenic
1079715347 11:23736588-23736610 CTAAGCAAAAAGAAAGATGGAGG + Intergenic
1079716630 11:23756140-23756162 CTAAGAAGACAGGAAAATGTGGG + Intergenic
1079716636 11:23756194-23756216 CTCAGAAGACAGGAAGATGTGGG + Intergenic
1079750632 11:24191926-24191948 ATAAGAAGACAGAAAGATGTGGG - Intergenic
1079785241 11:24664125-24664147 CTCAGAACACAGGAAAATGTGGG + Intronic
1079785249 11:24664179-24664201 CTCAGAAGACAGGAAGATGTGGG + Intronic
1079826877 11:25207066-25207088 ATAAGAAGACAGAAAAATGTAGG + Intergenic
1079834900 11:25322455-25322477 CTCAGAAGACAGAAAGATCTGGG + Intergenic
1079916111 11:26370608-26370630 CTCAAAGGACAGGAAGATGTGGG + Intronic
1079949430 11:26783557-26783579 CTCAGAAGACAGGAAGCTGTGGG + Intergenic
1080182695 11:29443676-29443698 CTCAGAAGACAGAAAAATAGAGG - Intergenic
1080343576 11:31296472-31296494 AGAAGAAGACAGAAAGATGTGGG - Intronic
1080359480 11:31495239-31495261 CTCAGAAGACACGAAGATGTGGG - Intronic
1080477545 11:32609531-32609553 CTCAGAAGACAGGAAAATGTGGG - Intronic
1080936719 11:36871260-36871282 CTCAGGAGAGGGAGAGATGGAGG + Intergenic
1081068460 11:38577875-38577897 ACAAGAAGACAGAAAGATGAGGG - Intergenic
1081077842 11:38697617-38697639 TTCAGAAGACAGGAAAATGTGGG - Intergenic
1081137014 11:39451013-39451035 CTCAGAAGACAAGAAGATGTAGG - Intergenic
1081175316 11:39921107-39921129 CTCAGAAGACAGAAAAATGTGGG + Intergenic
1081238813 11:40678951-40678973 CTCAGAAGACAGGAAAATGTGGG + Intronic
1081270624 11:41078185-41078207 CTCAGAAGAAAGGAAGATGTGGG - Intronic
1081359821 11:42161884-42161906 AGAAGAAGACAGGAAGATGGGGG + Intergenic
1081363924 11:42212522-42212544 CTCAGAAGTCAGAGAGATGTGGG + Intergenic
1081386542 11:42479468-42479490 CTCAGAAGACAGGAAGGTCTGGG + Intergenic
1081437380 11:43041714-43041736 CTCAGAAGACAGGAAAATGTGGG - Intergenic
1081811486 11:45916667-45916689 CTCAGAAAAAAGAAAAGTGGAGG - Intronic
1082734379 11:56839623-56839645 CTCAGAAGACAGGGAAATGTGGG - Intergenic
1082982093 11:59133073-59133095 CTCAGAAGACAGGAAGATGTGGG - Intergenic
1083065334 11:59917721-59917743 CTCAGAAGACAGGAAAATGTGGG - Intergenic
1083135868 11:60676470-60676492 CTCAGAAGACAGAACCACAGAGG + Intergenic
1084250113 11:67891424-67891446 CTCAGAAGAAAGAGATGTGGCGG + Intergenic
1084487642 11:69459709-69459731 CTCAGAAGGGAGACAGATGAGGG - Intergenic
1084803022 11:71558117-71558139 CTCAGTTGACAGAAAAATGCAGG - Intronic
1084822676 11:71703938-71703960 CTCAGAAGAAAGAGATGTGGCGG - Intergenic
1085534046 11:77207567-77207589 CTCAGAAGAGAGAGAGCTGGGGG - Intronic
1085548174 11:77340585-77340607 TTCAGGAGACAGGAATATGGAGG + Intronic
1086000757 11:81983383-81983405 CAGAGAAGACAGAAAAAAGGAGG - Intergenic
1086482794 11:87261224-87261246 CTGAGAAGAAAGGAAGAGGGAGG - Intronic
1086503574 11:87478872-87478894 TTCAGAAGACAGGAAGATGTGGG + Intergenic
1086564804 11:88213067-88213089 CTCAGAAGACAGGAATATGAGGG - Intergenic
1086669203 11:89526921-89526943 AACAGAAGACAGAAAGATGTGGG + Intergenic
1086828775 11:91533828-91533850 CTCAGAAGACAGGAAGATGTGGG + Intergenic
1086954763 11:92924668-92924690 CTCAGAAGACAGGAAGATGAGGG + Intergenic
1087054359 11:93919155-93919177 CTCTGGAGTCAGAAAGATGTGGG - Intergenic
1087255032 11:95944099-95944121 CTCAGAAGACAGGAAGATGTGGG + Intergenic
1087550351 11:99640139-99640161 CTCAGAAGACAGGAAAATGTGGG - Intronic
1087571185 11:99929245-99929267 CTCAGAAGACAGAAAGATGGGGG - Intronic
1087668868 11:101082435-101082457 CTCAGAAGACAGAAAGATATGGG + Intronic
1087730134 11:101769037-101769059 CTCAGAAGACAGGAAGATGTGGG - Intronic
1087793542 11:102432241-102432263 CTCAGAAGACAAAAAGATGTGGG + Intronic
1087831872 11:102827197-102827219 CTTAGAAGACAGGAAGGTGTGGG - Intergenic
1087856067 11:103092688-103092710 CTCAGTAGAGAGAAATTTGGGGG + Intergenic
1087877383 11:103374518-103374540 CTCAGAAGACAGGAAGGTGTGGG + Intronic
1087908370 11:103725252-103725274 CTCAGAAGACAGGAAGATATGGG - Intergenic
1087915475 11:103804748-103804770 CTCAAAAGTCAGACAGAAGGAGG - Intergenic
1088189024 11:107206375-107206397 CTCAGAAGACAGGAAGATGAGGG - Intergenic
1088210089 11:107445183-107445205 CTCATAAGACATATAGATGTAGG - Intronic
1088567034 11:111183308-111183330 AGAAGAAGACAGAAAGATGAGGG + Intergenic
1088643872 11:111900202-111900224 CTCAGAATACAGCAAATTGGGGG - Intergenic
1088762882 11:112949023-112949045 CTTAGAAGACAGGAAGATGTGGG - Intergenic
1088762888 11:112949079-112949101 CTCAGAAGACAGAAAAATGTGGG - Intergenic
1089441824 11:118524024-118524046 CTCTGAAGTAAGAAAGATGAGGG - Exonic
1090179580 11:124684666-124684688 CTCAGAAGACAAGAAGATGTTGG + Intronic
1090316815 11:125798289-125798311 CTCAGAAGGCAGGAAGATGTGGG - Intergenic
1090319781 11:125832300-125832322 CTTAGAAGACAGGAAAATGGGGG - Intergenic
1090506412 11:127320284-127320306 CTCAGAAGACAGTAAGATGTGGG - Intergenic
1090573088 11:128068974-128068996 CTCGGAAGACAGAAAAATGTGGG - Intergenic
1090595440 11:128315826-128315848 AGAAGAAGACAGAAAGATGTGGG - Intergenic
1091811942 12:3406765-3406787 CTCAGAAGACAGAAAGATGTAGG - Intronic
1092420439 12:8326944-8326966 CTCAGAAGAAAGAGATGTGGCGG + Intergenic
1092656242 12:10688046-10688068 CTCAGAAGATAGAAAGACAGGGG + Intergenic
1092665539 12:10792415-10792437 CTCAGAAGACAAAAAGATGTGGG - Intergenic
1092670449 12:10855387-10855409 CTCAGAAGACAGGAAGATAAGGG + Intronic
1092835401 12:12483251-12483273 CTCAAAGGACAGAAAAAAGGAGG + Intronic
1092855193 12:12666582-12666604 TGGAGAAGACAGAAACATGGAGG - Intronic
1092944413 12:13439675-13439697 CTCAGAAGGTAGGAAGATGTGGG - Intergenic
1093141945 12:15518890-15518912 CTCAGAAGACAGTAAAATGTGGG - Intronic
1093206965 12:16263115-16263137 CTCAGAAGACAGGAAAATGTGGG + Intronic
1093238656 12:16641761-16641783 CTCAGAAGACAGGAAGATGTGGG - Intergenic
1093313302 12:17618079-17618101 CTCAGAAGACAGGAAGATGTGGG - Intergenic
1093537209 12:20236808-20236830 CTCAGAAGACAAGAAGATATAGG + Intergenic
1093546217 12:20352237-20352259 CAGAGAAGACAGAAAGTTGCCGG + Intergenic
1093570600 12:20662207-20662229 CTCAGAAGACAGGAAAATATAGG + Intronic
1093581258 12:20786257-20786279 CTCAGAAGACAGGAAAAGGTGGG + Intergenic
1093585891 12:20835710-20835732 CTCAGAAGACAGGAAGATGTGGG - Intronic
1093605048 12:21078975-21078997 CTCAGAAAATAGGAAGATGTGGG - Intronic
1093624159 12:21326468-21326490 CTCGGAAGACAGGAAGATGTGGG + Intronic
1093753604 12:22829076-22829098 CTCAGAAGACAGGAAGATGTGGG + Intergenic
1093988830 12:25568006-25568028 CTCAGAAGATAGAAAGATTAGGG + Intronic
1094254061 12:28400947-28400969 CTCAGGAGCCAGGAAGATGTGGG - Intronic
1094282558 12:28755695-28755717 CTCAGAAGACATGAAGATGTGGG - Intergenic
1094379958 12:29831891-29831913 CTCAGAAGATAGAAAGATGAGGG - Intergenic
1094421257 12:30273503-30273525 CTCAGAAGACAGAAAGATGTGGG - Intergenic
1094489349 12:30949188-30949210 CTCAGAAGACAGGAAAATGTGGG - Intronic
1094780913 12:33790629-33790651 TTCAGAAGACAGGAAGATGTGGG - Intergenic
1095175895 12:39091658-39091680 TCCAGAAGAAAGATAGATGGTGG - Intergenic
1095216608 12:39557065-39557087 CTCAGAAGATGGGAAGATGTGGG + Intronic
1095433932 12:42166951-42166973 ATAAGAAAACAGAAAAATGGTGG - Intronic
1095640964 12:44484302-44484324 CTCAAAAGACAGGAAGCTGTGGG - Intergenic
1095727969 12:45473272-45473294 CTCAGAAGACAGGAAGATGAGGG + Intergenic
1095836902 12:46648874-46648896 CTCAGAAGACAGGAAGATGTGGG - Intergenic
1095854354 12:46843914-46843936 CACAGAAGACAGAAAGGAGTTGG + Intergenic
1095919297 12:47513496-47513518 CTCAGGAGACAGAAAGATGTGGG + Intergenic
1096566001 12:52479782-52479804 CTCAGAAGATACAAAAATGTGGG + Intergenic
1096586911 12:52628837-52628859 CATAGAAGACAAAAAGGTGGGGG + Intergenic
1096877912 12:54644883-54644905 CACAGAAGTCAGAGGGATGGAGG + Intronic
1096955105 12:55517929-55517951 GTCAGAAGACAGAAAAATGTGGG + Intergenic
1096956227 12:55529066-55529088 TTCAGAATGCAGAAAAATGGTGG + Intergenic
1096960347 12:55570772-55570794 CTGAGAAGACAGGAAAATGTGGG - Intergenic
1097329706 12:58319414-58319436 CTCAGAAGACAGGAAAATGTGGG - Intergenic
1097474337 12:60034805-60034827 CTCAGAAGACAGGACGATGTGGG - Intergenic
1097501634 12:60410762-60410784 CTCATAAGACAGGAAGATGAGGG - Intergenic
1097570632 12:61326855-61326877 CTCAGAAGACAGGAAAATATAGG - Intergenic
1097654792 12:62345462-62345484 CTCAGGAGACAGGACGATGTGGG - Intronic
1097654801 12:62345516-62345538 CTCAGAAGACAGGAAAATGTGGG - Intronic
1097686564 12:62696497-62696519 CTTAGGATTCAGAAAGATGGAGG - Intronic
1097735284 12:63175602-63175624 CTCAGAAGACAGGAAGATGTGGG + Intergenic
1098013330 12:66077810-66077832 ATCTGAAGACAGAAAGAAGGGGG - Intergenic
1098050520 12:66447741-66447763 GACAGAAGTCAGAAAGCTGGGGG - Intronic
1098130714 12:67347223-67347245 CTCAGAAGACAGAAAGATAAGGG + Intergenic
1098145045 12:67489343-67489365 CTCAGAAGACAGGAAGATGTAGG - Intergenic
1098203797 12:68084641-68084663 CAAAGAAGACAGGAAGATGTGGG - Intergenic
1098319745 12:69231375-69231397 CTCAGAAGACAGGAAGATGAGGG + Intergenic
1098327435 12:69317123-69317145 CTCAGAAAACAGGAAAATGTGGG - Intergenic
1098559204 12:71852880-71852902 CTCAGAAGATAGGAAGATGAGGG - Intronic
1098578554 12:72071780-72071802 CTCAGAAGACAGGAAAATGTGGG - Intronic
1098713599 12:73800703-73800725 AGAAGAAGACAGAAAGATGTGGG + Intergenic
1098715278 12:73822134-73822156 CTCAGAAGACAGGAAGATGTGGG - Intergenic
1098957722 12:76704826-76704848 CTGAGCAAACAGAAAGATGAAGG - Intergenic
1099076436 12:78114458-78114480 CTCAGGAAACAGAATCATGGTGG + Intronic
1099319876 12:81132671-81132693 TTCAGAGGACAGAAAATTGGTGG + Intronic
1099607842 12:84828187-84828209 GTCAGAAGACAGAAAGATTTGGG + Intergenic
1099621191 12:85004775-85004797 CTCAGAAGACAGAAAAGTGTGGG + Intergenic
1099663568 12:85597313-85597335 CTCAGAAGAGAGGAAAATGTGGG - Intergenic
1099672991 12:85718406-85718428 CTCAGAAGATAGGAAAATGTGGG - Intergenic
1099778730 12:87166787-87166809 CTCAGAAGACAGGAAATTGTGGG - Intergenic
1099858849 12:88204325-88204347 CTCAGAAGACAGGAAAATGTGGG + Intergenic
1099859191 12:88206986-88207008 AGAAGAAGACAGGAAGATGGGGG - Intergenic
1099861075 12:88227041-88227063 CTCAGAAGACAGGAAGATGTGGG - Intergenic
1100372304 12:93979573-93979595 CTCAGTAATCAGAAAAATGGAGG - Intergenic
1100413339 12:94345604-94345626 GTTCCAAGACAGAAAGATGGGGG - Intronic
1100597760 12:96086474-96086496 AGAAGAAGACAGAAAGATGTGGG + Intergenic
1100658060 12:96668126-96668148 CTCAGAAGAAATGAAGATGTGGG - Intronic
1100929221 12:99586454-99586476 CTCAGAGGACAGGAAGATGTGGG - Intronic
1100933559 12:99638237-99638259 CCCAGAAGACAGGAAAATGTGGG + Intronic
1100933566 12:99638290-99638312 CTCAGAAGACAGGAAGATATGGG + Intronic
1100937992 12:99691698-99691720 CTCAGAAGACTGGAAAATGTGGG - Intronic
1101033934 12:100686278-100686300 CTCAGAAGACAGAAAGATGTGGG - Intergenic
1101083669 12:101214018-101214040 CTCGGAAGACAGGAAAATGTGGG + Intergenic
1101190346 12:102326063-102326085 CTCAGAAGACAGGAAAATGTGGG + Intergenic
1101193127 12:102355220-102355242 CTCAGAAGACAGAAAGATGTGGG - Intergenic
1101194738 12:102370609-102370631 CTAAGAAAACAGGAAGATGTGGG - Intergenic
1101663673 12:106789299-106789321 CTCAGAAGACAGGACAATGTGGG - Intronic
1101712599 12:107282436-107282458 CTCAGAAGACAGGAAGATGTGGG - Intergenic
1101757230 12:107630409-107630431 TTCAGAAGAGAGAAAGAGGGAGG - Intronic
1101827380 12:108231131-108231153 CCCAGAAGAGGGAGAGATGGAGG + Intronic
1102052956 12:109876503-109876525 CAGAGAAGAAAGAAAGAGGGAGG + Intronic
1102193813 12:111009613-111009635 CTCAGGACAAAGCAAGATGGTGG - Intergenic
1102296351 12:111739753-111739775 CTCAGAAAAAAAAAAGGTGGGGG + Intronic
1102668788 12:114599746-114599768 CTCAGAAGACAGGAAGATGTGGG + Intergenic
1102945707 12:116986179-116986201 CCCAACAGACAGAAAGAGGGAGG - Intronic
1103057181 12:117831022-117831044 CCCAGGAGACAGGAACATGGAGG - Intronic
1103264441 12:119617207-119617229 CTCAGAAGACAGGAAGATGTAGG + Intronic
1103931956 12:124455496-124455518 CTCAGAAGGCAGAAGCAGGGAGG - Intronic
1104077989 12:125407388-125407410 AGTAGAAGACAGAAAGATGCAGG + Intronic
1104115840 12:125748289-125748311 CTCAGAAGACAGAAAGATATGGG + Intergenic
1104142607 12:126003304-126003326 CTCAGAAGACAGGAAGATGGGGG + Intergenic
1104244704 12:127027101-127027123 CTCACAGGACATAAACATGGTGG + Intergenic
1104373299 12:128243174-128243196 CTGGGAAGACAGGAGGATGGTGG - Intergenic
1105220496 13:18322089-18322111 CTCAGAAGACAGGAAACTGTGGG + Intergenic
1105256835 13:18749246-18749268 GGAAGAAGACAGAAAGATGAGGG - Intergenic
1105650628 13:22373002-22373024 CTCAGAAGTCAGGAAAATGTAGG - Intergenic
1106006884 13:25778974-25778996 CTCTGGAGACAAACAGATGGTGG + Intronic
1106130442 13:26935022-26935044 CTCAGAAGACAGAAAGACAAGGG + Intergenic
1106631661 13:31480457-31480479 CTCAGAAGACAGAAAAATGTGGG - Intergenic
1106718682 13:32417677-32417699 CTCAGAAGACAGGAATATGTGGG + Intronic
1106942700 13:34795308-34795330 CTCAAAACACAGGAAGATGTGGG + Intergenic
1107039536 13:35934211-35934233 CTCAGAAGACAGGAAAATGTGGG - Intronic
1107602546 13:42028381-42028403 CTAAAAAGGCAGAGAGATGGAGG + Intergenic
1107672167 13:42757420-42757442 CTCAGGAAACAGAATCATGGTGG + Intergenic
1107742418 13:43465423-43465445 CTCAAAAAACAAAAAGATGTAGG - Intronic
1107974080 13:45672657-45672679 CTAATATTACAGAAAGATGGAGG - Intergenic
1108074881 13:46669538-46669560 GTCAGAAGACAGAAAGAATGGGG + Intronic
1108100133 13:46945629-46945651 CTCAGAAGACAGAAAGATGTGGG - Intergenic
1108154501 13:47571900-47571922 CTCAGTAGACAGGAAGATGTGGG + Intergenic
1108419366 13:50233184-50233206 CTCAGAAGACAAGAAAATGTTGG + Intronic
1108790588 13:53965586-53965608 CTCAGAAGACAGGAAAATGTGGG + Intergenic
1108829044 13:54453732-54453754 CTCAGAAGACAAGAAGATGTGGG - Intergenic
1108885590 13:55177740-55177762 CTCAGAAGACAGGAAGATGTGGG + Intergenic
1108951509 13:56100067-56100089 TTCAGGAGATAGAAAGATGAGGG - Intergenic
1109030318 13:57181551-57181573 CCCAGAACACAAAAAAATGGGGG - Intergenic
1109108975 13:58292119-58292141 GTCAGAAGACAAGAAGATGTGGG + Intergenic
1109131154 13:58587401-58587423 TTGAAAACACAGAAAGATGGTGG + Intergenic
1109171824 13:59106896-59106918 CTCCGAAGACAGGAAGATGTGGG + Intergenic
1109246035 13:59955712-59955734 CTCAGAAGACAGGAAGATGTGGG + Intronic
1109276265 13:60307253-60307275 TTCAGAAGACAGAAAGATGTGGG - Intergenic
1109416769 13:62051009-62051031 CTCAGAAGACTGGAAGATGTGGG + Intergenic
1109476258 13:62883254-62883276 CTTAAAAGACAGGAAGATGTGGG - Intergenic
1109627805 13:64999873-64999895 CGCAGGAGACAGATAGATGAAGG - Intergenic
1109629816 13:65032238-65032260 CTCGGAAGACAAGAAGATGTGGG - Intergenic
1109667680 13:65559914-65559936 CTCAGGAGACAGGAAAATGTGGG - Intergenic
1109692052 13:65907307-65907329 CTCAGAAGACAGGACGAGGTGGG + Intergenic
1109876193 13:68406649-68406671 CTCAGAAGACAGGAAAACGTAGG - Intergenic
1109913829 13:68953599-68953621 CTCAAATGAGAAAAAGATGGTGG + Intergenic
1110007656 13:70293195-70293217 CTCAGAAGATAGGAAGACGTGGG + Intergenic
1110008719 13:70305287-70305309 TTCAGAAGACAGGAAGATGTGGG + Intergenic
1110022226 13:70490023-70490045 CTCAGAAGACAGGAAGATGTGGG + Intergenic
1110042849 13:70787155-70787177 ATAAGAAGACAGACAGATGAAGG - Intergenic
1110062763 13:71063143-71063165 CTCAGACAACAGGAAGATGTGGG - Intergenic
1110216510 13:73030234-73030256 GTCAGGAGACAGAAAGAGGCAGG - Intergenic
1110293524 13:73835502-73835524 GGAAGAAGACAGAAAAATGGAGG + Intronic
1110496604 13:76174907-76174929 CTCAGAAGACAGGAAAACGTGGG - Intergenic
1110559854 13:76899126-76899148 CTCAGAAGACAGGAAAATGTGGG - Intergenic
1110566326 13:76960700-76960722 CTCAGAAGACAGAAAGATATGGG - Intergenic
1111103108 13:83612505-83612527 GTCAGAAGACAGGAAAATGTGGG - Intergenic
1111107694 13:83668600-83668622 CTCAGAACACAGGAAGATGTGGG + Intergenic
1111142983 13:84146232-84146254 CTCAGAAGAGAGAGACATTGTGG - Intergenic
1111307438 13:86433911-86433933 CTCAGAAGACAGGAGGATGTGGG + Intergenic
1111385376 13:87520726-87520748 CTGAGAAGACAGAAAGATGTGGG + Intergenic
1111403404 13:87770144-87770166 CTCAGAAGACGGGAAGATGTGGG - Intergenic
1111421528 13:88018168-88018190 CTCAGAAGACAGGAAAATGTGGG + Intergenic
1111441484 13:88286867-88286889 CTCAGAAGACAGGAAGATGTTGG - Intergenic
1111457643 13:88505854-88505876 GGAAGAAGACAGAAAGATGTGGG + Intergenic
1111614405 13:90644671-90644693 CTCAGAAGACAGGAAGATGTGGG - Intergenic
1111751424 13:92335885-92335907 CTCAGAAGACATGAAGAGGTTGG - Intronic
1111799162 13:92960890-92960912 CTCAGAAGGCAGGAAGATGCGGG - Intergenic
1111799169 13:92960944-92960966 CTCAAAAGACAGGAAAATGTGGG - Intergenic
1112568315 13:100570041-100570063 CTCAGAAGACAGGAAGGTGTGGG - Intronic
1112769605 13:102781277-102781299 CTTAGAAGACAGAAAGACATGGG + Intergenic
1112815437 13:103267688-103267710 CTCAGAAGACAGGAAAATGTGGG + Intergenic
1112855910 13:103769167-103769189 CTCAGAAGACAGGAAGATGTGGG - Intergenic
1112857342 13:103787479-103787501 CTCAGAAGACAGAAAGATGTGGG - Intergenic
1112859005 13:103807729-103807751 CTCAGAAAACAGGAAGATGTGGG + Intergenic
1112995848 13:105574579-105574601 CTCAGAAGATAGGAAGATGTGGG + Intergenic
1113496888 13:110738005-110738027 AGAAGAAGACAGAAAGATGTGGG + Intergenic
1113937248 13:114001001-114001023 CTCAGAACGCAGAAAGTGGGGGG - Intronic
1114082000 14:19209353-19209375 CTCAGAATACAGGAAGATGAAGG + Intergenic
1114171250 14:20274160-20274182 CTCAGAAGACAGGAAGATAAGGG - Intronic
1114242085 14:20877429-20877451 CACAGGAGAGAGAGAGATGGCGG - Intergenic
1114248953 14:20941046-20941068 CACAGGAGAGAGAGAGATGGGGG - Intergenic
1114347965 14:21817116-21817138 AGAAGAAGACAGGAAGATGGGGG - Intergenic
1114687651 14:24549159-24549181 CTCAGAAGACAGGAAAATATGGG - Intergenic
1114778822 14:25515783-25515805 CTCAGAAGACAAGAACATGTGGG - Intergenic
1114780541 14:25533719-25533741 CTCAGGAGACTGGAAGATGTGGG - Intergenic
1114795832 14:25713944-25713966 CTCAGAAGACAAGAACATGTTGG - Intergenic
1114917267 14:27284676-27284698 CTCAGAAGACAGGAAGACAAGGG + Intergenic
1115010512 14:28539692-28539714 CTCAGAAGACAGGAAGATGAGGG + Intergenic
1115121289 14:29941038-29941060 CTCAGAAGTCAGGAAAATGAGGG + Intronic
1115244538 14:31281851-31281873 CATAGAAGAGAGACAGATGGAGG + Intergenic
1115522560 14:34247365-34247387 CTCAGAAAACAGAATTATGAAGG - Intronic
1115943109 14:38630108-38630130 CTCAGAAGACAGAAAGAGGTGGG - Intergenic
1115967266 14:38904894-38904916 CTCTGAAAAGAGAAAGAGGGAGG - Intergenic
1116199421 14:41771780-41771802 CTCAGAAGACAGAAAGATGAGGG - Intronic
1116272105 14:42785594-42785616 CTCAGAAGACAGGAAGATGTGGG + Intergenic
1116286984 14:42986485-42986507 CTCAGAAGACAGAAAGATGTGGG - Intergenic
1116296753 14:43120463-43120485 CTCAGAAGACAGGAAGGTGTGGG - Intergenic
1116419988 14:44721680-44721702 CTCAGAAGACAGAAAACTATGGG + Intergenic
1116564985 14:46433206-46433228 CTCAGAAGACAGGAAAATGTGGG - Intergenic
1116625188 14:47254592-47254614 CTCAGAAGAGAGGAAGATGTAGG - Intronic
1116714240 14:48407730-48407752 CTCAGAAAACAGGAAGGTGTGGG - Intergenic
1116742571 14:48775760-48775782 AGAAGAAGACAGAAAGATGAGGG + Intergenic
1116780768 14:49235637-49235659 CTCAGAAGACAGGAAGATATGGG + Intergenic
1117085398 14:52195713-52195735 CTCAGAAGACAGGAACATGTGGG + Intergenic
1117198611 14:53365006-53365028 CTCAGAAGACAGAAAAATGTGGG - Intergenic
1117411973 14:55458344-55458366 CTCAGAGGACAGAAAGGCTGAGG - Intergenic
1117749096 14:58902085-58902107 ATAAGAAGACAGGAAGATGTGGG + Intergenic
1117886597 14:60370803-60370825 AGAAGAAGACAGAAAGATGAGGG + Intergenic
1117984655 14:61375322-61375344 CTCAGAAGACAGGGAGATATGGG - Intronic
1118024547 14:61755680-61755702 CTCAGAAGACAGGAAGATGAGGG - Intergenic
1118037485 14:61883591-61883613 CTCAGATGACAGAAAAATGTAGG - Intergenic
1118092580 14:62498469-62498491 AGAAGAAGACAGAAAGATGAGGG - Intergenic
1118383735 14:65238491-65238513 CTAAGAAGAAAGAAAGAGGAAGG - Intergenic
1118669101 14:68102624-68102646 CTCAGAAGACAGGAAGATGTGGG - Intronic
1119013151 14:71018517-71018539 TTCAGATGACTGAGAGATGGGGG + Intronic
1119040300 14:71268690-71268712 CTCAGAAGACAGGAAAATGTGGG + Intergenic
1119150759 14:72357398-72357420 CTTAGAAGACAGGAAGATGTGGG + Intronic
1119596534 14:75939865-75939887 TTCAAAAGACAGATTGATGGTGG - Intronic
1120230448 14:81835773-81835795 CTCAGAAGATAGGAAGATAAGGG + Intergenic
1120317875 14:82919447-82919469 GTCAGGAGACAGAGAGAAGGAGG + Intergenic
1120357965 14:83458538-83458560 CTCAGAAGACAGAAAGATGTGGG + Intergenic
1120377961 14:83733410-83733432 CTCAGAAGACAGGAAGATGTGGG + Intergenic
1120405139 14:84084768-84084790 CTCAGAAGACAGAAAAATGTGGG - Intergenic
1120406944 14:84102344-84102366 CTCAGGAAACAGAATTATGGTGG - Intergenic
1120406972 14:84102590-84102612 CTCAGAAGACAGGACAATGAGGG + Intergenic
1120442414 14:84557699-84557721 TTCAGAAGACAGGAGGATGTGGG - Intergenic
1120485962 14:85113453-85113475 CTCAGAGGACAGGAAGGTGTGGG - Intergenic
1120523467 14:85550978-85551000 TTCACAAGACAGAATCATGGAGG - Intronic
1120582692 14:86272681-86272703 TTCAGAAGACAGAAAGATGTGGG - Intergenic
1120688136 14:87562874-87562896 CTCAGAAGACAGGAAAATGTGGG + Intergenic
1120808851 14:88782049-88782071 CTCCGAAGACAGGAAGATGTGGG + Intronic
1120921161 14:89756528-89756550 CTCAGAAGACAGGAAGATGTGGG - Intergenic
1120934330 14:89879063-89879085 ATCAGAGGACAGGGAGATGGGGG - Intronic
1120947410 14:90011442-90011464 CTCAGAAGACAGGAAGATGTGGG + Intronic
1121128689 14:91426145-91426167 CTCAGAAGACAGGAAGATGTGGG + Intergenic
1121995195 14:98597015-98597037 CTAAGAAGAAAGGAAGATGTGGG + Intergenic
1122217918 14:100215951-100215973 CTCAGAACACAGAAAAAGAGGGG + Intergenic
1123022636 14:105408811-105408833 CTGAGTAGACAGAATGCTGGTGG - Intronic
1123628779 15:22246321-22246343 CTCAGAAAACAGGAGGATGTGGG + Intergenic
1124062523 15:26307311-26307333 CTCAGAGGACAGGAAGATGTGGG - Intergenic
1124225983 15:27895385-27895407 CTCAGAATACAGAAGAATGTGGG + Intronic
1124556160 15:30727877-30727899 CTCAGAAGACAGGAAGATGTGGG - Intronic
1124675109 15:31677893-31677915 CTCAGAAGACAGGAAGATGTGGG + Intronic
1124716881 15:32071997-32072019 CTTAGAAGACAGGAAGATTAGGG + Intronic
1125001222 15:34772127-34772149 CTCAGAAAGCAGAGAGATGGAGG - Intergenic
1125049159 15:35277587-35277609 AGAAGAAGACAGAAAGATGAAGG + Intronic
1125105627 15:35967888-35967910 CACAGAAGGTAGAAACATGGGGG - Intergenic
1125225462 15:37390440-37390462 CTCAGAAGACAGGAAGATGTGGG - Intergenic
1125304311 15:38292294-38292316 CTCAGAAGACAGGAAAATGTGGG - Intronic
1125840566 15:42797410-42797432 AGCAGGAGGCAGAAAGATGGAGG + Intronic
1126215039 15:46145425-46145447 CTCAGAAGACAGAAAGGGATGGG + Intergenic
1126255997 15:46626619-46626641 CTCAGAAGACAGGAAAATGTGGG + Intergenic
1126274642 15:46862544-46862566 CTCAGGAGACAGGAAGATGTGGG + Intergenic
1126374011 15:47976211-47976233 CTCAGAAGACTGGAAGAGGAGGG + Intergenic
1126514533 15:49520283-49520305 CTCAGAAGACAGGAAGATGTGGG - Intronic
1126693053 15:51302770-51302792 TTCAGAAGAGAGAAAGACGTGGG - Intronic
1126696806 15:51333265-51333287 CTCAGAAGGGACAAAAATGGTGG + Intronic
1126825164 15:52541116-52541138 CTCAGAAGACAGAAAGAATGTGG - Intergenic
1126873341 15:53012129-53012151 CTCAGAAGACAGGAAAATGTGGG - Intergenic
1126942180 15:53779394-53779416 CTCAAAAGACAGGAAGATGTGGG - Intergenic
1127053275 15:55106731-55106753 CTCAGAAGACAGAAAAATTAGGG + Intergenic
1127552674 15:60056515-60056537 CTCAGCAAATAGAAAGATGTTGG - Intronic
1127775149 15:62258719-62258741 CTCAGGAGAGAGAAACAGGGTGG - Intergenic
1128119872 15:65137818-65137840 CTCAGAAGACAGGAAAATGTGGG - Intergenic
1128221378 15:65971046-65971068 CTGAGAAGACATAAGGAAGGAGG + Intronic
1129204749 15:74030259-74030281 CACAAAAGAGAGAAAGATGGTGG + Intronic
1129327050 15:74805918-74805940 CCCAGAAGGCACAGAGATGGAGG + Intergenic
1130016440 15:80190167-80190189 CTGAGAGGACAGAAAGAGAGGGG - Intergenic
1131426945 15:92353519-92353541 ATCAGAAGACAGGAAGATGTGGG + Intergenic
1131619656 15:94054143-94054165 AGAAGAAGACAGAAAGATGAGGG + Intergenic
1131899773 15:97074925-97074947 CTTAGCATACAGAAAGATGGCGG - Intergenic
1131921360 15:97332199-97332221 CTCAGAAGACAGGAAGATATGGG + Intergenic
1132121840 15:99183052-99183074 CTCAGAAGACAGGAAGATGTGGG + Intronic
1132122705 15:99191829-99191851 CTCAGAAGACAGGAAAATGTGGG + Intronic
1132303903 15:100794741-100794763 CTCAGAAGACAGGAAGATGTGGG - Intergenic
1133359138 16:5159969-5159991 CTCAGAAGAAAGAGATGTGGGGG + Intergenic
1133879349 16:9765898-9765920 ATGAGAAGACATATAGATGGAGG - Intronic
1134643441 16:15847809-15847831 GTCAAAAGACAGCAAGATGGGGG + Intronic
1135399099 16:22153437-22153459 CCCAGAAGACACAAATATGCAGG - Intronic
1135919126 16:26632537-26632559 CTCAGAAGACAGGAAGATGTGGG - Intergenic
1135995124 16:27241861-27241883 CTCAGAGGTCAGAGAGATGAAGG + Intronic
1136642274 16:31576998-31577020 CTCAGAAGACAGGAAAATGTGGG + Intergenic
1136642288 16:31577106-31577128 CTCAGAAGGCAGAAAGATGTGGG + Intergenic
1136659319 16:31742191-31742213 CTCAAAAAAAAAAAAGATGGGGG + Intronic
1136709824 16:32227824-32227846 CTCAGAAGACAGGACAATGTGGG + Intergenic
1136758085 16:32701587-32701609 CTCAGAAGACAGGACAATGTGGG - Intergenic
1136810022 16:33168788-33168810 CTCAGAAGACAGGACAATGTGGG + Intergenic
1136816498 16:33278868-33278890 CTCAGAAGACAGGACAATGTGGG + Intronic
1137265946 16:46869147-46869169 CTCAGAAGACAGGAAGATGTAGG - Intergenic
1138877197 16:60966379-60966401 GTGAGAACACAGCAAGATGGTGG + Intergenic
1139134101 16:64180381-64180403 CTCAGAAGATAGAAGGTGGGAGG + Intergenic
1139183270 16:64771723-64771745 CTCAGAAGCCAGGCAGATGCAGG - Intergenic
1139646116 16:68331908-68331930 CCCAGAAAAAACAAAGATGGTGG - Intronic
1139716259 16:68815642-68815664 TTCAGGAGGCACAAAGATGGGGG - Exonic
1140023016 16:71257118-71257140 CACAGAAGCCAGATTGATGGAGG + Intergenic
1140146990 16:72320680-72320702 CTCAGAAGACAGAAAGATTTGGG - Intergenic
1140442996 16:75000778-75000800 AGCAGAAGAAAAAAAGATGGAGG - Intronic
1140623280 16:76762562-76762584 CTCAGAAGACAGGAAGATGTAGG + Intergenic
1140844206 16:78871224-78871246 GTCCTAAGACAGAAAGAGGGGGG + Intronic
1141272962 16:82557608-82557630 CTCAGAAGACAGGAATATGTGGG + Intergenic
1141317724 16:82977868-82977890 CTCAGAAGACAGGAAGATGTGGG + Intronic
1141711109 16:85699396-85699418 CTGAGAAGCCAGAAGGAAGGGGG + Intronic
1141975302 16:87511948-87511970 CTCAGAAGACAGGAGGATGTGGG - Intergenic
1203060236 16_KI270728v1_random:961936-961958 CTCAGAAGACAGGACAATGTGGG - Intergenic
1142924521 17:3223089-3223111 CTCAGAAGACAGGAAGATGTAGG + Intergenic
1142948914 17:3462037-3462059 GGCAGAAGAAAGAAAAATGGAGG - Intronic
1143929744 17:10409629-10409651 CTCAAAAGATAGAGACATGGTGG + Intronic
1144091141 17:11857570-11857592 TTCAGAATACAGAAAGTGGGTGG + Intronic
1144151960 17:12456941-12456963 CTAAGAAGAAAGAAAGTAGGAGG - Intergenic
1144285566 17:13770742-13770764 CTCAGAAGGCAGGAAAATGTGGG - Intergenic
1144399748 17:14884606-14884628 CTCAGAAGACAAGAAGATGTGGG - Intergenic
1144406260 17:14955406-14955428 ATGAGAAGAGAGACAGATGGGGG + Intergenic
1144955355 17:19016424-19016446 CTCAGAGGACAACAAGAGGGTGG - Intronic
1146091753 17:29886153-29886175 CTCAGAAGACAGGAAGATATGGG + Intronic
1146452033 17:32982292-32982314 CTCAGAAGACAGGAAGATGTGGG - Intronic
1146468450 17:33105678-33105700 CTCAGAAGACAGGAAGATGGGGG + Intronic
1146571786 17:33959150-33959172 CTCAGAAGACATGAAAATGTGGG - Intronic
1147327475 17:39676409-39676431 CTCAGAACACCGAAAGCAGGGGG + Intronic
1147348677 17:39823083-39823105 TTCAGAAGACAGGAAGATGTGGG + Intronic
1147794658 17:43033850-43033872 GACAGAAGACAGAAAGCAGGAGG + Intergenic
1148074055 17:44925445-44925467 CTCAAAAAAAAAAAAGATGGGGG + Intronic
1148199534 17:45740686-45740708 ATCAGGGGTCAGAAAGATGGGGG + Intergenic
1149029374 17:52066256-52066278 AGAAGAAGACAGAAAGATGTGGG + Intronic
1149072112 17:52555723-52555745 CTCAGAAGACAGGCAGATGTGGG + Intergenic
1149143074 17:53457511-53457533 CTCAGGAGACAGGAAAATGTGGG + Intergenic
1149158881 17:53667005-53667027 CTCAGAAGACAGGAAGATGTGGG + Intergenic
1149190140 17:54051182-54051204 AGAAGAAGACAGAAAGATGTGGG - Intergenic
1149853128 17:60053518-60053540 CTCAGAAGACAGGAAGACAAAGG + Intronic
1150515626 17:65806976-65806998 AAAAGAAGACAGAAAGATGTGGG + Intronic
1150978946 17:70120296-70120318 AGAAGAAGACAGAAAGATGAGGG - Intronic
1151415517 17:73960015-73960037 AGAAGAAGACAGAAAGATGAGGG + Intergenic
1151698095 17:75728276-75728298 CTCAGAAGGGAGGAAGAGGGAGG - Intronic
1152483035 17:80568747-80568769 CACAGAGGAAAAAAAGATGGAGG - Intronic
1152568756 17:81112109-81112131 CTCGGAAGGGAGGAAGATGGAGG - Intronic
1153348447 18:4053017-4053039 CTCAGAAGACAGGAAAATGTGGG - Intronic
1153411129 18:4794347-4794369 AGCAGAAGAAAGAAAGCTGGAGG + Intergenic
1154312371 18:13277241-13277263 CACACAAGCCAGACAGATGGTGG + Intronic
1154426508 18:14276190-14276212 GGAAGAAGACAGAAAGATGAGGG + Intergenic
1154431519 18:14312128-14312150 GGAAGAAGACAGAAAGATGAGGG + Intergenic
1154434200 18:14331431-14331453 GGAAGAAGACAGAAAGATGAGGG + Intergenic
1154506669 18:15046846-15046868 TTCATAAGACAGAAAGATGTGGG - Intergenic
1155108284 18:22688668-22688690 ATCAGAAGACAGGAAGATGAGGG - Intergenic
1155208195 18:23578580-23578602 CACAGAAGAGAAAGAGATGGAGG - Intronic
1155413634 18:25572449-25572471 CTCAGAAGATAGAACAATGTGGG - Intergenic
1155515908 18:26623867-26623889 CTCAGGAGACAGGAAGATGTGGG + Intronic
1155544853 18:26904376-26904398 CTCAGAAGACAGGAAGATGTGGG - Intergenic
1155632233 18:27906944-27906966 CTTAGAAGACAGGAAAATGTGGG - Intergenic
1155821258 18:30380766-30380788 CTCAAAAGACAGGAAGATGTGGG - Intergenic
1155842972 18:30668870-30668892 CTCAGGAGACAGGAAGATGTGGG - Intergenic
1156027660 18:32674034-32674056 ATCAGAAAAGAGAAAGATGTTGG - Exonic
1156169443 18:34464159-34464181 AGAAGAAGACAGAAAGATGTGGG - Intergenic
1156207993 18:34906766-34906788 CTCAGAAGACAGGAAGATGTGGG - Intergenic
1156383185 18:36582292-36582314 CTCAGATGACCCAAATATGGGGG + Intronic
1156550477 18:38011143-38011165 CAAAGAAGACAGAAGGAGGGAGG + Intergenic
1156607303 18:38681067-38681089 CTCAGAAGACAGGAAGACGTGGG - Intergenic
1156632207 18:38983831-38983853 ATGAGAACACAGAAAGAAGGTGG + Intergenic
1156861556 18:41842305-41842327 TTCAAAAGACAGAAATAAGGAGG - Intergenic
1157131763 18:45013856-45013878 CACAGCAGAAAGAAACATGGTGG - Intronic
1157373591 18:47141710-47141732 CTCAAAAAACAAAAGGATGGAGG - Intronic
1157768868 18:50326920-50326942 CTCAGAAGACAGAAAAACTGAGG + Intergenic
1157781673 18:50445229-50445251 CTCAGAAGACAGGAAGATGTGGG - Intergenic
1157843159 18:50978097-50978119 CTCAGAAGACAGGAAGACATGGG - Intronic
1157941022 18:51929359-51929381 CTCAGAAGACAGGAAGATGTGGG + Intergenic
1157990625 18:52491651-52491673 CAATGAAGACAGAAAAATGGAGG + Intronic
1158123982 18:54082024-54082046 CTCAGAAGACAGGAAGACGTGGG + Intergenic
1158129647 18:54138808-54138830 ATAAGAAGACAGAAAGATAAGGG + Intergenic
1158299328 18:56034017-56034039 CTCAGAAGACAGGAAGATGAGGG - Intergenic
1158335709 18:56413519-56413541 CTCAGAAGACAGGAAAATGTGGG + Intergenic
1158335714 18:56413573-56413595 CTCAGAAGACAGAAAGGTGTGGG + Intergenic
1158674692 18:59507513-59507535 CTCAGAAGCCAGACAGAGGGTGG - Intronic
1158822565 18:61178275-61178297 CTCAGAAGACGGGAAGATGTGGG + Intergenic
1158842675 18:61405199-61405221 CACCTAAGGCAGAAAGATGGTGG - Intronic
1159083334 18:63760070-63760092 CTCAGAAGACAGGAAAATGTGGG + Intronic
1159304770 18:66626435-66626457 CTCAAAAAACAGGAAGATGTGGG + Intergenic
1159395719 18:67853470-67853492 CTCAGAAGGCAGGAAGATGTAGG - Intergenic
1159461281 18:68724711-68724733 TTTAGAAGACAGGAAGATGTGGG - Intronic
1159583734 18:70262942-70262964 CTCAGGAAACAGGAAGATGTGGG + Intergenic
1159652502 18:70995025-70995047 TCCAGAAGACAGGAAGATGCGGG + Intergenic
1159718883 18:71859858-71859880 CTCAGAAGACACAAAGATGTGGG - Intergenic
1159873587 18:73786183-73786205 GTCTTAAGATAGAAAGATGGAGG + Intergenic
1160041861 18:75352797-75352819 CTCAGAAGACAGAAAGATGTGGG + Intergenic
1160054350 18:75465174-75465196 CCCAGGACATAGAAAGATGGAGG - Intergenic
1160258344 18:77266356-77266378 CTGAGAAGACAGGAAGATGTGGG - Intronic
1160627326 18:80219822-80219844 CTCAGAAGACAGGAAGATGTGGG - Intronic
1161865923 19:6832216-6832238 CTCTGTGGACAGAAAGAGGGAGG - Intronic
1162549676 19:11351542-11351564 CAGGGAAGACAGAAAGCTGGAGG + Intronic
1162593362 19:11607763-11607785 CTCAAAAGACAGGAAGATGTGGG - Intronic
1164213828 19:23125346-23125368 CTCAGAAGACAGGAAAATGTGGG + Intronic
1164447314 19:28329071-28329093 TTCAGAAGACAGGAAGATGTGGG + Intergenic
1164468733 19:28510490-28510512 GTCAGAAGACAGAGAAATGAGGG + Intergenic
1164813881 19:31179335-31179357 CCCAGAAGAGAGAAAGACAGGGG + Intergenic
1165718326 19:38061530-38061552 CTCAGAAGCCAGAAATGTGCAGG + Intronic
1165933053 19:39372761-39372783 CTGAGAAGGGAGAAAGAAGGAGG + Intronic
1166017416 19:39993202-39993224 CTCAGAAGATAGGAAGATGAAGG + Intronic
1167321672 19:48800386-48800408 CACAGACAACTGAAAGATGGAGG + Intronic
1167352093 19:48981841-48981863 CCAAGAAGCCAGGAAGATGGGGG - Intronic
1167494962 19:49812308-49812330 CTCAGATGACAGAACAATGAGGG + Exonic
925236170 2:2279503-2279525 GTAAGAAGAGAGAAAGAGGGAGG + Intronic
925246706 2:2389950-2389972 CTCAGAAAACAGGAAGATGAGGG - Intergenic
925322854 2:2990252-2990274 CTTAGAAGACAGAAAAAAAGCGG - Intergenic
925354324 2:3227212-3227234 CTCACAAGACAAGAAGATGCAGG + Intronic
925453441 2:3991370-3991392 ATCAGAAGACAGGAAAAGGGGGG - Intergenic
925560110 2:5182507-5182529 CTGAGAAGACAGGAAGATGTGGG + Intergenic
926341956 2:11910917-11910939 CTCAAAAGACAGAGACATTGGGG + Intergenic
926431138 2:12786719-12786741 CTCAGAAGACAGAAAAATGTGGG - Intergenic
926465180 2:13178175-13178197 CTCAGAAGACAAGAAGATGTGGG - Intergenic
926612003 2:14956301-14956323 CTCAGAAGACAGAAAGATATGGG - Intergenic
926734702 2:16064121-16064143 CTCAGAAGACAGGAAGATGCAGG - Intergenic
926734708 2:16064175-16064197 CTCAGAAGACAGGAAAATGTGGG - Intergenic
926840071 2:17070447-17070469 CTCAGATGACAGGAAGATGTGGG + Intergenic
926865339 2:17350985-17351007 ATGTGAAGACAGAAAAATGGAGG - Intergenic
926868874 2:17390885-17390907 CTCAGAAGACAGGAAGATGTGGG + Intergenic
926929702 2:18024487-18024509 CTCAGAACACAGAAAAATGTGGG - Intronic
926952032 2:18253437-18253459 CTCAGAAGACAGGAAAATGTGGG + Intronic
926986720 2:18632392-18632414 CTCAGAAGACAGGAAGGTGTGGG + Intergenic
927242247 2:20929321-20929343 CTCAGAAGATAGGAAAATGTAGG - Intergenic
927341986 2:21993047-21993069 CTCAGGAGATAGGAAGATGTAGG - Intergenic
927360102 2:22223150-22223172 CTCAGAAGACAGGAAAATGTAGG + Intergenic
927389723 2:22581834-22581856 CTCAGAAGACAGGAAAATATGGG + Intergenic
927400841 2:22708040-22708062 CTTAGAAGACCGGAAGATGTGGG - Intergenic
928048782 2:27967634-27967656 CTCAGAAGACAGGAAAATGTGGG + Intronic
928220343 2:29398122-29398144 TGCAGGAGCCAGAAAGATGGGGG + Intronic
928235595 2:29536687-29536709 CTCACAAGACAGGAAGACGAGGG + Intronic
928278760 2:29925328-29925350 AACAGAAGACAGAAAGGTGGAGG + Intergenic
928609831 2:32982062-32982084 CTCAGAAGACAGGAAAATGTGGG + Intronic
928620070 2:33079756-33079778 CTAAGAAGCCAGAAAGGAGGTGG - Intronic
928680229 2:33693795-33693817 CTCAGAAGACAGGAAAATGTGGG - Intergenic
928742979 2:34377522-34377544 CTCAAAAGCTAGAAAAATGGAGG + Intergenic
928812793 2:35249239-35249261 CTCAGAAAACAGGAAGATGAGGG - Intergenic
928836898 2:35558425-35558447 CTCAGAAGACATGAAGATGTGGG + Intergenic
928927467 2:36594211-36594233 CTCAGAAGACAGGAAAATGTGGG - Intronic
929020472 2:37547744-37547766 CTCAGAAGACAGGAAAATGTGGG - Intergenic
929211345 2:39360382-39360404 CTCAGAAGACAGAAAGATGTGGG - Intronic
929259700 2:39851882-39851904 CTCAGAAGAGAGAAAGCAGTGGG - Intergenic
929325938 2:40610726-40610748 CTCAGAAGACAGGAAGATGAGGG - Intronic
929689270 2:44061005-44061027 CTCAGAAGACAGGAAGATGTGGG - Intergenic
929743773 2:44633712-44633734 CTCAGAAGTGACAAAGATGATGG - Intronic
929887234 2:45889745-45889767 ATCAGAACACATAAAAATGGAGG - Intronic
929985280 2:46725444-46725466 CTCAAAAGACAGCAGGAAGGGGG - Intronic
930230041 2:48834303-48834325 TTCAGAAGACAGGAAGATGTGGG + Intergenic
930481504 2:51953396-51953418 CTCAGAAGATAGGAAGATGTGGG - Intergenic
930484749 2:51998165-51998187 CTCAGAAGAAAGAAAAATGTGGG + Intergenic
930560195 2:52950834-52950856 CTCAGAAGACAGGAAGATGTGGG - Intergenic
930626919 2:53708574-53708596 TGAAGAAGACAGAAAGATGAGGG + Intronic
931033606 2:58211936-58211958 CTCAGAAGATAGGAAAATGTGGG - Intronic
931229590 2:60363170-60363192 CTTATAAGGAAGAAAGATGGTGG - Intergenic
932225864 2:70040101-70040123 CTCAGAAGAGAGAAAAATCTAGG + Intergenic
932379402 2:71268846-71268868 CTAAGAGGAAAGAAAGCTGGGGG + Intergenic
932671081 2:73738392-73738414 CTCAGAGGCCAAACAGATGGTGG + Intergenic
932849432 2:75170566-75170588 CTCAGAAGACAGGAAGATGTGGG + Intronic
932895251 2:75633066-75633088 CTCAGTAGAGAAAAAGGTGGGGG + Intergenic
932923214 2:75941194-75941216 AACAGAAGACAGGAAGATGTGGG + Intergenic
933085018 2:78045328-78045350 CTCAGAAGACAGGAAAATGTCGG + Intergenic
933092369 2:78137241-78137263 ATAAGAAGACAGGAAGATGTAGG + Intergenic
933172048 2:79135487-79135509 CACAGAAGACAGCACTATGGGGG + Intergenic
933343257 2:81049411-81049433 ATCAGAAGACAAAAGGATGAGGG - Intergenic
933420400 2:82038290-82038312 CTCAGAAGACAGGAAGATGAGGG - Intergenic
933639994 2:84748642-84748664 CTCAGAAGACAGGAAGATGAGGG - Intronic
934100892 2:88652011-88652033 TTCAGAAGACAGATGGATAGAGG + Intergenic
934183560 2:89650382-89650404 CTCAGAAGACAGGAAAATGTGGG - Intergenic
934293843 2:91724554-91724576 CTCAGAAGACAGGAAAATGTGGG - Intergenic
934491897 2:94767078-94767100 GGAAGAAGACAGAAAGATGAGGG - Intergenic
934610691 2:95733128-95733150 CTCAGAAGACAGGAAAATATGGG - Intergenic
934892025 2:98079017-98079039 CTCAGAAGACAGGCAGATGAGGG - Intergenic
935479156 2:103562924-103562946 CTCAGAAGACAGAAAGATGTGGG - Intergenic
935731593 2:106068659-106068681 CACAGAAGGCAAACAGATGGAGG + Intronic
935931761 2:108134182-108134204 CTCAGAAGACAGGAAGATGAGGG - Intergenic
936076405 2:109404469-109404491 GACAGGGGACAGAAAGATGGGGG + Intronic
936236718 2:110748418-110748440 CTCAGGAGATAGAAAAAGGGAGG - Intronic
936549697 2:113426605-113426627 CTCAGAAGACAGGAATATGTGGG + Intergenic
936663683 2:114570486-114570508 CACAGTAGGCAGAATGATGGGGG + Intronic
936721390 2:115255854-115255876 CTCAGAAGACAGGAAGATGTGGG - Intronic
936862456 2:117033608-117033630 CTCAGAAGACAGGAAAATGTGGG - Intergenic
936872256 2:117146966-117146988 CTCAGAAGACAGGAAGATATGGG - Intergenic
936909509 2:117575780-117575802 CTCAGAAGACAGGAAGATGTGGG - Intergenic
936940777 2:117882229-117882251 CTTAGAAGACAGGAAGATGTGGG + Intergenic
937503044 2:122503850-122503872 CTCACTATACAGAAAAATGGTGG - Intergenic
937762442 2:125622201-125622223 CGAAGAAGACAGAAAAATGTGGG + Intergenic
937806939 2:126157367-126157389 CTTAGAACAAAGAAAGTTGGAGG - Intergenic
938165280 2:129020594-129020616 CTCAGAAGACAGGAAAATGTGGG + Intergenic
938417360 2:131114845-131114867 AGAAGAAGACAGAAAGATGTGGG - Intronic
938494582 2:131787230-131787252 CTCAGAATACAGGAAGATGAAGG - Intergenic
938698062 2:133852540-133852562 CTCAGAAGACAGGAAAATGTGGG + Intergenic
938868252 2:135446995-135447017 CTAAAAAGACAGAAAAATAGAGG - Intronic
938988431 2:136602924-136602946 CTCAGAAGACAGGCAGATGTAGG - Intergenic
939016790 2:136912999-136913021 CTCAGAAGATAGGAAAATGTAGG + Intronic
939037307 2:137148522-137148544 CTCAGAAGACAGGAAAATGTAGG + Intronic
939241854 2:139571839-139571861 CTCTGAAAACAGGAAGATGAAGG + Intergenic
939740622 2:145901649-145901671 CTCAGAAGACAGGAATATGTGGG + Intergenic
939752524 2:146064805-146064827 CTCAGAAGACAGGAAAATGTGGG - Intergenic
939830330 2:147063712-147063734 CTCAGAAGACAGGAAGATGTGGG + Intergenic
939944865 2:148397301-148397323 ATCAGAAGACAGAAACATTTGGG - Intronic
940135829 2:150435158-150435180 CTCAGAAGACAGGAAAATGTGGG + Intergenic
940143679 2:150523061-150523083 CTCATAAGACAGGAAGATGTGGG + Intronic
940156386 2:150661245-150661267 CTCAGAAGACAGGAAGATGAGGG + Intergenic
940484004 2:154274844-154274866 ATCAGAAGACAGGAAGATGTGGG + Intronic
940501864 2:154503756-154503778 CTCAGAAGACAGGAAAATGTGGG + Intergenic
940597877 2:155818348-155818370 AGAAGAAGACAGAAAGATGTGGG + Intergenic
940691227 2:156923280-156923302 CTCAGAAAACAGGAAGATGTGGG + Intergenic
941009244 2:160280053-160280075 CTCAGAAGCCTAGAAGATGGTGG + Intronic
941175281 2:162190777-162190799 CTCTGAAGAGAGAGAGCTGGAGG + Intronic
941289879 2:163662058-163662080 CTTAGAAGACAGGAAAATGTGGG + Intronic
941307869 2:163893008-163893030 CTCAGAAGACAGGAAGATGTGGG - Intergenic
941452083 2:165672083-165672105 CTCAGAAGACAGGAAAATGTGGG - Intronic
941536081 2:166723599-166723621 CTCAGAAGACAGGAAAATGTGGG - Intergenic
941888297 2:170552241-170552263 ATCAGAAGACAGGAAGGTGAGGG + Intronic
941967091 2:171311369-171311391 CACAGAAGAGAGGGAGATGGGGG + Intergenic
941977643 2:171423445-171423467 CTCAGAAGACAGGAAGATGTGGG + Intronic
942234225 2:173888824-173888846 CTCAGAAGACAGAAAGATGTGGG + Intergenic
942283289 2:174389230-174389252 CTCAGAAAACAGGAAGATGTGGG + Intronic
942724849 2:178995025-178995047 CTCAGAAGACAGGAAAATGTGGG - Intronic
942829639 2:180224522-180224544 CTCAGAAGACAGGAACATGTGGG + Intergenic
942880810 2:180858433-180858455 CTCAGAAGACAGGAAGATGTGGG - Intergenic
942904835 2:181167702-181167724 CTCAGAAAATAGGAAGATGTGGG - Intergenic
943006640 2:182393947-182393969 CTCAGAAGACAGTAAGATGTGGG - Intronic
943181003 2:184540949-184540971 CTCACAAGACTGAAATAAGGGGG - Intergenic
943223589 2:185140759-185140781 CTCAGAAGACAGGAAGCGGTGGG - Intergenic
943420815 2:187667029-187667051 CTGAGGAGACAGAAAGACAGTGG - Intergenic
943448444 2:188019000-188019022 CTCAGAAGACAGGAAGATGTGGG + Intergenic
943481595 2:188426853-188426875 AGAAGAAGACAGAAAGATGAGGG + Intronic
943563919 2:189495455-189495477 AGAAGAAGACAGAAAGATGTGGG + Intergenic
943620325 2:190141174-190141196 CTCAGAAGACAGGAAGATGTGGG - Intronic
944021747 2:195113978-195114000 CTCAGAAGACAAGAAGATGCAGG + Intergenic
944272305 2:197797062-197797084 CTCAAAAAACAGGAAGATGTGGG - Intergenic
944303852 2:198157010-198157032 CTTAGAAGACAGGAAAATGAGGG + Intronic
944371286 2:198986317-198986339 CTCAGAAGACAGGAAAATGTGGG - Intergenic
944470412 2:200046642-200046664 CTTAGAAGACAAGAAGATGTGGG - Intergenic
944478006 2:200126587-200126609 CTCAGAAGACAGGAAGATGTGGG - Intergenic
944681071 2:202077181-202077203 CTCAGAAGCCAAACAGCTGGGGG - Intronic
945084821 2:206120358-206120380 CTCAGAAGACAGAAAGATGAGGG + Intronic
945333368 2:208563846-208563868 CTCAGGAAACAGTAAGATGTAGG - Intronic
945410343 2:209499424-209499446 AGAAGAAGACAGAAAGATGAGGG - Intronic
945456256 2:210055516-210055538 CTCACAAGACAGGTAGATGTGGG + Intronic
945457005 2:210062492-210062514 CTCAGAAAACAGAAAAGTGTGGG + Intronic
945535040 2:211005963-211005985 AGCAGAAGACACAAAGAAGGAGG + Intergenic
945709388 2:213277413-213277435 CTCAGAAGACAGGAAAATGTCGG + Intergenic
945995218 2:216430887-216430909 CCCACAACACAGACAGATGGGGG - Intronic
946389462 2:219406747-219406769 GTGAGAAGACAGAAGGATGATGG + Intergenic
946562310 2:220926955-220926977 CTCAGAAGACAGGAAGATGTGGG - Intergenic
946575650 2:221072466-221072488 AGTAGAAGACAGAAAGATGTGGG - Intergenic
946903890 2:224397551-224397573 CTCAGAAGACAGGAAAATGTGGG + Intronic
947183480 2:227433275-227433297 CTCAGAAGACAGGAAAATAAGGG - Intergenic
947443073 2:230140328-230140350 CTCAGAAGACAGGAAGATGAGGG + Intergenic
947481759 2:230507137-230507159 CTCAGAAGACAGAAGCAGGAGGG + Intronic
947858966 2:233345351-233345373 CTCTGAAGCCTGACAGATGGAGG + Intronic
947903012 2:233738436-233738458 CTCAGAAGACAGGAAGATGTGGG + Intronic
948104141 2:235399538-235399560 CTCAGAAGACAGGAAGATAAGGG + Intergenic
948119523 2:235518766-235518788 CTCATAAGCCAGAGGGATGGTGG + Intronic
948147052 2:235715853-235715875 CTCTCAAGCCAGAAAGCTGGAGG - Intronic
948209733 2:236183971-236183993 CAAAGAAGACAGGAAGATGAGGG + Intergenic
948514883 2:238497730-238497752 CTCAGAAGACAAGAGGTTGGAGG + Intergenic
948775490 2:240286666-240286688 CTCATCAGACTGAAACATGGGGG + Intergenic
948837609 2:240633316-240633338 AGAAGAAGACAGAAAGATGTGGG + Intergenic
948878819 2:240845197-240845219 TTCAGAAGACAGAAAGATGTGGG + Intergenic
1168811678 20:708909-708931 TTCAGAAAACAAAAAGTTGGGGG - Intergenic
1168951930 20:1808298-1808320 CTCGGAAGGCAGAAAGATCTGGG + Intergenic
1169580805 20:7021707-7021729 CTCAGAAGACAGGAAAATGTGGG + Intergenic
1169592699 20:7163068-7163090 CTCAGAAGACAGGAAGATGTGGG + Intergenic
1170448642 20:16457847-16457869 CCAAGATCACAGAAAGATGGAGG + Intronic
1170631800 20:18072475-18072497 CTCAAAAGAAAGGAAGAAGGAGG - Intergenic
1170652105 20:18252423-18252445 TTCACAGGACAGAAGGATGGAGG - Intergenic
1171249903 20:23638862-23638884 CTCAGAAAAGGGAAAGATAGAGG + Intergenic
1171818804 20:29813609-29813631 TTCAGAAGACAGAAAAATGAGGG - Intergenic
1172592756 20:36128986-36129008 CTCAGAAGAAAAAAGGCTGGTGG + Intronic
1172638623 20:36427180-36427202 CTCAAAAGAAAGAAAGAGGCTGG + Intronic
1173323524 20:42010810-42010832 CTCAGAAGACAGGAAGATGTGGG - Intergenic
1173491722 20:43488041-43488063 CTCAGAAGACAGGAAAATGTGGG - Intergenic
1173541645 20:43857199-43857221 AGAAGAAGAAAGAAAGATGGAGG + Intergenic
1173571684 20:44081249-44081271 CTCACAAGAGAGAAGGATGTTGG - Intergenic
1174662042 20:52221842-52221864 AGAAGAAGACAGAAAGATGTGGG - Intergenic
1174747550 20:53078668-53078690 ATCAGGTGACAAAAAGATGGTGG + Intronic
1175198328 20:57261622-57261644 CTCTGCAGAAAGAAAGAAGGGGG + Intronic
1175288655 20:57857124-57857146 CTCAGAACAAAGAAAGATGGAGG - Intergenic
1176613348 21:9007041-9007063 CTCAGAATACAGGAAGATGAAGG + Intergenic
1176791197 21:13322255-13322277 TTCATAAGACAGAAAGATGTGGG + Intergenic
1176842824 21:13854291-13854313 GGAAGAAGACAGAAAGATGAGGG - Intergenic
1176848248 21:13893189-13893211 GGAAGAAGACAGAAAGATGAGGG - Intergenic
1176883676 21:14229013-14229035 CTCAGGAGACAGGAAGATGTGGG + Intergenic
1177085344 21:16695858-16695880 AGCAGAAGACAGGAAGATGTGGG - Intergenic
1177115365 21:17079024-17079046 CTCAGATGACAGGAAGATTCTGG - Intergenic
1177259509 21:18711998-18712020 TTCAGAAGATTGAAAGATGTGGG + Intergenic
1177288094 21:19077168-19077190 CTCAGAAGACAGGAAAATGTGGG + Intergenic
1177317248 21:19477873-19477895 CTCAGAAGTCAGGAAAATGTGGG - Intergenic
1177471377 21:21564516-21564538 CTCAGAAGACAGGAAGATATAGG - Intergenic
1177557048 21:22704041-22704063 CTCAGAAAACAGGAAGATGTGGG + Intergenic
1177604563 21:23360868-23360890 CTCAGAAGACAGGAAGATGTGGG - Intergenic
1177614658 21:23501104-23501126 AGAAAAAGACAGAAAGATGGGGG + Intergenic
1177656104 21:24019602-24019624 CTCAGAAGACAGGCAGATGTGGG + Intergenic
1177684623 21:24419727-24419749 TTCAGAAGACAGGAAAATGTGGG - Intergenic
1177740391 21:25146983-25147005 TTCAGAAGACAGGAAAATGTGGG - Intergenic
1177773780 21:25545662-25545684 TTCAGAAGATAGAAAGATGAGGG - Intergenic
1177847055 21:26301879-26301901 CTCAGAAGACAGCAAAATGTGGG - Intergenic
1177854124 21:26382835-26382857 CTCAGAAGACAGGAAGATTTGGG + Intergenic
1177872928 21:26595267-26595289 CTAAGAAGAGAAAAAGATGCTGG - Intergenic
1177918814 21:27124762-27124784 TTCAGAAGACAGGAAGATGTGGG - Intergenic
1177990601 21:28031111-28031133 TTCATAAGACAGAAAGATGTGGG - Intergenic
1178018413 21:28379024-28379046 ATCAGAAAGCAGAAAGTTGGGGG + Intergenic
1178261965 21:31107850-31107872 CTCAGAAGACAGAAAGATGTGGG - Intergenic
1178261974 21:31107904-31107926 CTCAGAAAATAGAAAAATGTGGG - Intergenic
1178387629 21:32166489-32166511 CTCAAAAAACAGAAGGATGGAGG + Intergenic
1178682092 21:34680857-34680879 TTCAGAAGACAGGAAGCTGTGGG - Intronic
1179136565 21:38684879-38684901 CTCACTTGGCAGAAAGATGGTGG + Intergenic
1179384548 21:40929855-40929877 CTCAGAAGGTAGGAAGATGCGGG - Intergenic
1179402164 21:41094304-41094326 CTCAGAAGACATGAAGAGGTTGG + Intergenic
1179432536 21:41333783-41333805 CTCAGAAGACAAGAAGATGAGGG + Intronic
1180101081 21:45586310-45586332 CTGAAAAGTCAGAAAGCTGGCGG + Intergenic
1180322773 22:11338298-11338320 TTCAGAAGACAGAAAAATGAGGG - Intergenic
1180498773 22:15913317-15913339 CTCAGAATACAGGAAGATGAAGG - Intergenic
1181129477 22:20722090-20722112 CTCAGGAAACAGAATCATGGTGG - Intronic
1181135201 22:20760748-20760770 CTGGGAAGACAGAGAAATGGTGG - Intronic
1181896504 22:26112886-26112908 AGAAGAAGACAGAAAGATGAGGG - Intergenic
1182650732 22:31849091-31849113 CTCAAAAGACAGGAAGATGTGGG - Intronic
1182797707 22:33003362-33003384 CTCAGAAGACAAGAAGACGTGGG + Intronic
1182815775 22:33162039-33162061 CTCAGAAGACAGAAAAATGTGGG - Intergenic
1182857999 22:33535080-33535102 CTCAGAAGTCAGAAGGCTTGAGG - Intronic
1182999500 22:34843453-34843475 CTCAGAAGACAGAAGGATTTGGG + Intergenic
1183058071 22:35319123-35319145 GTCAGAAGAAAGAAAGCAGGAGG + Intronic
1183141888 22:35950176-35950198 CTCAGAAAACAGGAAGAAGATGG - Intronic
1183151315 22:36039930-36039952 CTCAGAAGACAGAAAGATGTGGG - Intergenic
1183321439 22:37167343-37167365 CTCAGGAGGCAGAGAGATGGTGG - Intronic
1183741443 22:39670714-39670736 CACAAAGGACAGAAAGGTGGAGG - Intronic
1183793067 22:40089850-40089872 GCCAGAAGACAGGGAGATGGAGG - Intronic
1183950201 22:41348482-41348504 CTCAGCAGACAGCAAGCGGGGGG + Intronic
1184157528 22:42678040-42678062 CTCAAAAGACAGGAAGATGTGGG + Intergenic
1184713358 22:46266293-46266315 CTCAGAAGACAGGAGTATGTGGG - Intergenic
949721909 3:6999362-6999384 CTCAGAAGACAGGAAGATGTGGG - Intronic
949795850 3:7850122-7850144 AGCAGAAGACAAAAAGATTGTGG - Intergenic
950087483 3:10270541-10270563 CTCAGAAGAAAGAGAGGTGAAGG + Exonic
950288373 3:11763139-11763161 CTCAAAAAACAAAAAGGTGGAGG - Intergenic
950412116 3:12845674-12845696 CTCAGAAGACAGGAAGATGTGGG + Intronic
950806198 3:15604935-15604957 CTCAGAAGACAGGAAAATGTGGG - Intronic
950965561 3:17143430-17143452 ATCAGCAGACAGAGAGAAGGAGG - Intergenic
950990778 3:17435131-17435153 CTCAGAAGGTAGGAAGATGTGGG - Intronic
950996651 3:17505320-17505342 CTCAGGAGTAAGAGAGATGGTGG - Intronic
951017322 3:17744743-17744765 CGCAGAACACAAAAAGGTGGTGG - Intronic
951062170 3:18222324-18222346 TTCAGAAGTCAGAAAGTTGAGGG + Intronic
951098336 3:18657451-18657473 CTCAGAAGAGAGACAGAATGAGG - Intergenic
951100544 3:18683481-18683503 CTCAAAAGACAGAAAGATGTGGG + Intergenic
951177190 3:19615708-19615730 CTCAGAAGACAGGAAGATGTGGG - Intergenic
951367920 3:21807045-21807067 ACCAGAAGAGAGAAAGAAGGAGG + Intronic
951449454 3:22819930-22819952 AGAAGAAGACAGAAAGATGAGGG - Intergenic
952014938 3:28945309-28945331 CTCAGAAAACAAAATGATGGGGG - Intergenic
952198587 3:31101902-31101924 CTCAGAAGACAGGAAGATGTGGG - Intergenic
952221496 3:31328111-31328133 CTCGGAAAACAGGAAGATGAGGG - Intergenic
952396985 3:32929824-32929846 CTCAGAAGAGAGGAAAATGTAGG + Intergenic
952589264 3:34931613-34931635 CTCAGAAGGCAGGAAGATGTGGG + Intergenic
952608808 3:35182322-35182344 CTCAGAAAACAGGAAGATGTGGG - Intergenic
952671651 3:35975549-35975571 CGAAGCAGACAGAAAGATGTGGG - Intergenic
952808087 3:37376061-37376083 CTCAGAAGACAGAAAGATGAGGG - Intergenic
952832556 3:37577108-37577130 CAGGGAAGACAGAAAGATGAGGG + Intronic
952849515 3:37716016-37716038 CCCAGGAGACAGAAAGAAGGTGG + Intronic
953574048 3:44098499-44098521 TTCAGAAGAAGGAAAAATGGTGG - Intergenic
953687791 3:45091703-45091725 CTCAGCAGACATATAGCTGGTGG - Intronic
954484715 3:50837082-50837104 CTCAGAAGACAGAAAGATGTGGG - Intronic
954601892 3:51876597-51876619 CTCAGGAGCCAGACTGATGGAGG - Intergenic
954684510 3:52363107-52363129 CTCAGAAGACAGCTTGAAGGTGG - Exonic
954840283 3:53505573-53505595 CTCAGAGGAAGGAATGATGGTGG - Intronic
955472252 3:59297911-59297933 CTCAGAAGACAGGAAAATGTGGG + Intergenic
956149527 3:66225977-66225999 CTCAGAAGACAGGAAGATGTGGG - Intronic
956169633 3:66422630-66422652 CTCAGAAGGCAGGAAGATGTGGG - Intronic
956336827 3:68174368-68174390 CCAAGAAGACAGAAAAATGTGGG + Intronic
956347705 3:68298991-68299013 CTCAAAAGACAGGAAGATGTGGG + Intronic
956474867 3:69609310-69609332 CTCAAAAGACAGGAAAATGCGGG + Intergenic
957064388 3:75509495-75509517 CTCAGAAGAAAGAGATGTGGGGG + Intergenic
957260712 3:77897858-77897880 CGCAGAAGACAGAAAAATGTGGG - Intergenic
957267291 3:77983581-77983603 CTCAGAAGAAAGGAAGTTGTGGG - Intergenic
957300830 3:78389626-78389648 CTCAGAAGACAGGAAGATGTGGG + Intergenic
957457560 3:80472079-80472101 CTCAGAAGACAGGAAGATGTGGG + Intergenic
957477209 3:80740135-80740157 CTCAGAAGACAGGAAGATGTGGG - Intergenic
957765829 3:84622497-84622519 CTTAGAAGACAGGAAGATGTGGG - Intergenic
957857067 3:85892888-85892910 CTCAGAAAGCAGGAAGATGTGGG + Intronic
957878375 3:86178685-86178707 CTTAGAAAACAAAAAGTTGGAGG + Intergenic
957960053 3:87237387-87237409 CTGAGAACACAGCAAGAAGGTGG + Intronic
957987568 3:87590992-87591014 CTCAGAAGACAGGAAGATGTGGG - Intergenic
958005960 3:87812235-87812257 CTCAGAAGACAGGAAGATGAGGG + Intergenic
958018263 3:87967953-87967975 CTCAGAAGACAGGAAGATGTGGG + Intergenic
958050378 3:88336465-88336487 CTCAGAAGACAGGAAGATGTGGG - Intergenic
958057076 3:88427045-88427067 CTCAGAAGACAGAAAGATGTGGG + Intergenic
958128298 3:89385807-89385829 CTTAGAAGACAGAAAGATGTGGG + Intronic
958160211 3:89809298-89809320 CTCAGAAGTCAGGAAGATGTGGG - Intergenic
958553411 3:95644270-95644292 CTCAGAAGAAAGAAAAATGTGGG - Intergenic
958582616 3:96045768-96045790 CTTAGAAGACAGGAAGATGTGGG - Intergenic
958583276 3:96053254-96053276 CTCAGAAGACAGGAAAATGTGGG - Intergenic
958688150 3:97426042-97426064 CTCAGAAGACAGGAAGATTTGGG - Intronic
958823574 3:99003493-99003515 CTCAGAACACAGGAAAATGTGGG - Intergenic
958955245 3:100459494-100459516 CTCAGAAGACAGGAAAATGTGGG - Intergenic
959031908 3:101309166-101309188 CGAAGAAGACAGGAAGATGTGGG - Intronic
959149380 3:102590477-102590499 AGAAGAAGACAGAAAGATGAAGG + Intergenic
959172621 3:102860836-102860858 CTCAGAAGACAGGAAAATGTGGG - Intergenic
959229608 3:103631604-103631626 TTCAGAAGACAGGAAGATGTGGG + Intergenic
959406979 3:105972176-105972198 CTCAGAAGATAGAAAAATGCAGG - Intergenic
959606198 3:108244396-108244418 TTCAAAAGACAGGAAGATGTGGG + Intergenic
959719261 3:109469146-109469168 CTCAGAAGACAGGAAGATGTGGG + Intergenic
959756598 3:109906748-109906770 AAAAGAAGACAGAAAGATGTGGG - Intergenic
959785765 3:110295552-110295574 CTCAGCACACAGGAAGATGTGGG - Intergenic
959788917 3:110333401-110333423 CTCAGAAGATAGGAAAATGTGGG - Intergenic
959818622 3:110704929-110704951 CTCAGAAAACAGGAAAATGTGGG - Intergenic
959827197 3:110812491-110812513 CTTAGAATACAGTGAGATGGAGG - Intergenic
959866703 3:111278803-111278825 CTAAGAAGACGTAAAGATGGTGG - Intergenic
960161358 3:114353232-114353254 CTCACAAGACAGAGAGATTTGGG - Intronic
960224829 3:115157170-115157192 CTCAGAAGACAGGAAAATGTGGG + Intergenic
960224835 3:115157224-115157246 TTCAGAAGACAAGAAGATGTGGG + Intergenic
960255280 3:115505186-115505208 CTCAGAAGACAGGAAGATGTAGG + Intergenic
960473109 3:118092571-118092593 TTCAGAAGACAGGAAGATGTGGG + Intergenic
960478445 3:118159320-118159342 CTCAGAAGATAGGAAGATGTGGG - Intergenic
960618926 3:119620964-119620986 CTCAGAAGATGGAAGCATGGTGG - Intronic
960724829 3:120659605-120659627 CTCAGAAGACAGGAAGATGAGGG - Intronic
960774857 3:121238006-121238028 CTCAGAAGATAAAAAGATGAGGG - Intronic
960794202 3:121467393-121467415 CACCGTAGACAGAAAGATGGAGG + Intronic
961017109 3:123476872-123476894 CTAAGAAGACAAAAAGAGGAAGG - Intergenic
961047022 3:123716104-123716126 CTCCAAATAAAGAAAGATGGGGG - Intronic
961164186 3:124752164-124752186 GTCAGAGGGCAGCAAGATGGTGG - Intergenic
961342740 3:126239620-126239642 CTCAGAAGACAGGAACGTGTGGG - Intergenic
961503905 3:127357546-127357568 CTCAGAAGACTGGAAGATGTGGG - Intergenic
961839626 3:129697927-129697949 CTCAGGAGACAGGAAGATGCAGG - Intronic
961898117 3:130186141-130186163 CTCAGAAGAAAGAGATGTGGCGG + Intergenic
962066914 3:131991289-131991311 CTCAGAAGACAGGAAGATGTGGG + Intronic
962414011 3:135166436-135166458 CTCAGCAGCCAGCAAGAGGGAGG + Intronic
962460921 3:135612032-135612054 CTTAGAAGACAGGAAGATCTGGG + Intergenic
962646508 3:137445801-137445823 CTCAGAAGACAGGAAGATGTGGG - Intergenic
962657655 3:137565096-137565118 GTCAGTAGACAGAAGGATAGAGG - Intergenic
962733096 3:138300710-138300732 ATCAGAAGCCAGAGAAATGGGGG + Intronic
963051854 3:141149782-141149804 CTCAGAAGAAGCAGAGATGGGGG - Intergenic
963297021 3:143557524-143557546 CTCAGAAGACAGGAAGATATGGG + Intronic
963368525 3:144368343-144368365 CTCAGAAGACAGGAAAATGTGGG - Intergenic
963433812 3:145242614-145242636 TTTAGAAGACAGAAAGATGTGGG - Intergenic
963581929 3:147136141-147136163 CTCAGAAGACAGGAAGATGTGGG - Intergenic
963845465 3:150151429-150151451 CTCACATGACAGAAAGAGAGAGG - Intergenic
963926933 3:150960745-150960767 CACAGGAGACAGGCAGATGGAGG + Intronic
963996667 3:151717574-151717596 CTCAGAAGACAGGGAAATGAGGG - Intergenic
964092504 3:152893258-152893280 TTCAGAAGACAGGAAGATGAAGG - Intergenic
964207134 3:154186759-154186781 CTCAGAAGAAAGAAAGAAAGAGG + Intronic
964605421 3:158555574-158555596 CTCAGAAGACAGGAAGATATGGG + Intergenic
964654463 3:159051393-159051415 CTCAGAAGACAACAAGATGTGGG + Intronic
964897119 3:161612078-161612100 CTCAGAAGACAGAAAGATGTGGG + Intergenic
964919949 3:161884436-161884458 CACAGAAGACAGGAAGATGAGGG + Intergenic
964989212 3:162785685-162785707 CTCAGAAGACAGGAAGATGTGGG - Intergenic
965012207 3:163108142-163108164 CTCAGAAGACAGGAATATGTGGG - Intergenic
965045396 3:163571667-163571689 CTCAGAAGACAGGAAAATGTGGG + Intergenic
965046786 3:163588402-163588424 TTCAGAAGACAGCAAGAATGAGG - Intergenic
965121701 3:164567404-164567426 GCCAGAAGAAAGATAGATGGAGG + Intergenic
965275604 3:166678101-166678123 CTCAGAAGACAGGAAGATGTGGG - Intergenic
965281971 3:166765708-166765730 AGAAGAAGACAGAAAGATGTGGG - Intergenic
965341974 3:167502463-167502485 CTCAGAAGACAGGAAGATGAGGG + Intronic
965386754 3:168055220-168055242 AGAAGAAGACAGAAAGATGTGGG + Intronic
965394943 3:168152021-168152043 CTCAGAAGACAGAAAGATGAGGG + Intergenic
965647206 3:170896821-170896843 CTCAGAAGAAAGAAAGATGAGGG + Intronic
965662034 3:171052190-171052212 CTCAGAAGACAGGAACATGTGGG + Intergenic
965864968 3:173195137-173195159 CTCAGAAGACAGGAAAATGTGGG + Intergenic
965990313 3:174810271-174810293 CTCAGAAGACAAGAAGATACAGG + Intronic
966164755 3:177005331-177005353 CTCAAATGACAGGAAGATGAGGG + Intergenic
966241431 3:177758750-177758772 CTGAGAAAACAGGAAGATGATGG - Intergenic
966287104 3:178311092-178311114 CTCACAACACAAAAGGATGGTGG + Intergenic
966314915 3:178634107-178634129 CTCAGAAGACAGGAAGACATGGG - Intronic
966320453 3:178695768-178695790 CTCAGAAGACAGGAAGATGTGGG - Intronic
966730233 3:183144795-183144817 CTCAGGAGACTGAGAGGTGGAGG + Intronic
967330105 3:188281713-188281735 CTTGGAAGAAAGAAAGATGGGGG - Intronic
967406102 3:189118062-189118084 CTCAGAAGACAGGGAGATATGGG + Intronic
967453224 3:189650909-189650931 CTCAGAAGACAGGAAGATGTGGG + Intronic
967505340 3:190246842-190246864 TTCAGAAGGCAGAAAAATGTGGG - Intergenic
967559825 3:190904957-190904979 CTCAAAAGACAGGAAGATGTGGG + Intergenic
967559832 3:190905011-190905033 CTCAGAAGAGAGAAAGGTGAGGG + Intergenic
967564575 3:190958823-190958845 CTCAGAAGACAGGAAGATGTGGG + Intergenic
967586455 3:191220111-191220133 CTAAGAATTAAGAAAGATGGTGG - Intronic
967609052 3:191482525-191482547 CTCAGAAGACATAAAAATGTGGG + Intergenic
967633783 3:191777583-191777605 CTCAGAAGACAGGAAGGTGTAGG + Intergenic
967635102 3:191791625-191791647 CTCAGAAGACAGGTAGCTGTGGG - Intergenic
967937061 3:194737539-194737561 CACAGAAGAGAGGAAGATGAAGG - Intergenic
967957414 3:194887919-194887941 CTTGGAAGACAGGAAGATGTGGG - Intergenic
968351006 3:198051868-198051890 CTTTGAAGACAGGAAGATGAGGG - Intergenic
968380738 4:93788-93810 CTCAGAAGAAGGAAAGATGTGGG - Intergenic
968437702 4:602649-602671 CTCTGGAGCCAGGAAGATGGTGG - Intergenic
968462726 4:733330-733352 CACAGAAGACAGACAGCTCGGGG + Intronic
968482095 4:837774-837796 CTGAGAGGACAGTCAGATGGGGG + Intergenic
968951989 4:3700114-3700136 CTCAGCAAAGACAAAGATGGAGG + Intergenic
969008244 4:4039229-4039251 CTCAGAAGAAAGAGATGTGGGGG + Intergenic
969169434 4:5348222-5348244 CTCAGGGGCCAGAAAGATTGAGG - Intronic
969334173 4:6497225-6497247 TTCAGAAGAGAAATAGATGGAGG + Intronic
969481826 4:7450443-7450465 CTGAGCAGACACAAAGATGATGG - Intronic
969745379 4:9066820-9066842 CTCAGAAGAAAGAGATGTGGGGG - Intergenic
969849881 4:9947872-9947894 GTCAGGAGGCAGAAAGAGGGAGG - Intronic
969992553 4:11279084-11279106 CTCATAAAACAGAAAGGTCGAGG - Intergenic
970127726 4:12833071-12833093 CTCAAAAGACAGGAAAATGGGGG - Intergenic
970150371 4:13082879-13082901 CACAGAAGACAGCAAGATGTGGG - Intergenic
970217711 4:13777144-13777166 CTCAGAAGACAAGAAGATGTGGG - Intergenic
970301998 4:14691473-14691495 CTTAGAAGAAAGGAAGATGTGGG + Intergenic
970308041 4:14753293-14753315 CTCAGAAGACAGGAAGATGTGGG - Intergenic
970351586 4:15206885-15206907 CTCAGAAGACAGGATGATGTGGG + Intergenic
970477596 4:16439453-16439475 CTGGGAAGACAGAAAGCAGGAGG - Intergenic
970665788 4:18334530-18334552 AGAAGAAGACAGAAAGATGAAGG + Intergenic
970758229 4:19451618-19451640 CTCAGAAGACAGGAAGATGTGGG - Intergenic
970773796 4:19648359-19648381 CTCAGAAAACAGGAAAATGTGGG - Intergenic
970818860 4:20190047-20190069 TTCAGAAGACAGGAAGACGTGGG + Intergenic
971071866 4:23103872-23103894 CTCAGAAGAAAGGAAAATGTGGG + Intergenic
971111492 4:23591129-23591151 CTCAGAAGACAGGAAAATGTAGG + Intergenic
971119547 4:23688792-23688814 CTCCGAAGACAGGAAGATGTGGG + Intergenic
971570552 4:28205601-28205623 CTCACAAGACAGGAAAATGTGGG - Intergenic
971681580 4:29707372-29707394 CTCAGAAGACACAAAGATGTGGG - Intergenic
971721004 4:30245198-30245220 AGAAGAAGACAGAAAGATGTGGG - Intergenic
971744762 4:30565712-30565734 CTCAGAAGACAGGAAAATGTGGG + Intergenic
971856855 4:32055041-32055063 AGAAGAAGACAGAAAGATGAGGG - Intergenic
971900399 4:32650801-32650823 CTCAGAAGACAGGAAGATGTGGG - Intergenic
971933703 4:33119002-33119024 GGCAGAAGACAGGAAGATGAGGG - Intergenic
971939704 4:33199259-33199281 CTCAGAAGACAGGAAAATGTGGG + Intergenic
972012754 4:34205339-34205361 CTCAGAAGACAGGAAAATGTGGG + Intergenic
972012760 4:34205393-34205415 CTCAGAAGACAGGAAGATGTGGG + Intergenic
972017469 4:34264218-34264240 CTCAGAAGGCAGGAAGATGTGGG - Intergenic
972056283 4:34806884-34806906 CTCAGAAAACAGGAAGATGTGGG - Intergenic
972056290 4:34806938-34806960 CTCAGAAGATAGAAAAATATGGG - Intergenic
972063346 4:34909398-34909420 CTCAGAAGACAGAAAAATGTGGG + Intergenic
972748771 4:41968187-41968209 CTCAGAAGTCAGGAAGATGCTGG + Intergenic
972749268 4:41972504-41972526 CTCAGAAGACAGGAAAATGTGGG + Intergenic
972847067 4:43003453-43003475 CTCAGAAGACAGGAAGATTAGGG + Intronic
972865593 4:43228371-43228393 CTCAGAAGATAGGAAGATGTTGG - Intergenic
972879436 4:43406048-43406070 CTCAGAAGACAGGAAGATGTGGG + Intergenic
972988728 4:44797961-44797983 CCCAGAAGACAAGAAGATGAGGG + Intergenic
973022790 4:45224491-45224513 CTCAGAAGACAGGAAAATGAGGG + Intergenic
973368113 4:49224087-49224109 GGAAGAAGACAGAAAGATGAGGG - Intergenic
973551750 4:52042448-52042470 CTTAGAAGACACAGAGATGAGGG - Intergenic
973614135 4:52662244-52662266 AGAAGAAGACAGAAAGATGAGGG + Intergenic
974091573 4:57316644-57316666 CTGAGGAGGCAGAAAGAGGGGGG + Intergenic
974178586 4:58357551-58357573 CTCAGAAAACAGAAAAATATGGG + Intergenic
974319838 4:60333358-60333380 CTCATAACACAGAAAGATGTGGG + Intergenic
974377080 4:61092675-61092697 CTCAGAAGCCAGAAGGAGGGTGG + Intergenic
974380056 4:61127770-61127792 CTCAGAAGACAGGAACAAGTGGG + Intergenic
974457316 4:62144933-62144955 CTCAGAAGACAGGAAGATGAAGG + Intergenic
974587415 4:63896994-63897016 CTCAGACAACAGGAAGATGTTGG - Intergenic
974619021 4:64331808-64331830 CTCAGAAAGCAGAAAGATAAAGG + Intronic
974679130 4:65137980-65138002 TGCAGAAGACAGGAAGATGTAGG - Intergenic
974725688 4:65795444-65795466 CTCAGAAGATAGGAAAATGTGGG - Intergenic
974797011 4:66766197-66766219 CTCAGAAGACAGGAAAATGTGGG + Intergenic
974873821 4:67677234-67677256 CCCAGAAGAGAGACACATGGGGG + Intronic
975052646 4:69884533-69884555 CTCAAAAGACAGGAAGATGTGGG - Intergenic
975204148 4:71624764-71624786 CTCAGAAGACAGAAAGATGTGGG - Intergenic
975207426 4:71661585-71661607 CTCAGAAGCCAGAGGGATAGTGG - Intergenic
975350482 4:73340232-73340254 CTCAGAAGACAGAAAAGTGTGGG - Intergenic
975403252 4:73961652-73961674 CTCAGAATACAGGAAGATGTGGG + Intergenic
975626886 4:76359159-76359181 CTCAGAAAACATAATCATGGTGG - Intronic
975628933 4:76380234-76380256 ATCAGAAGACAGAAAGACGAGGG + Intronic
975942049 4:79659763-79659785 CTCAGAAGACAGGAAAGTGTGGG + Intergenic
976050649 4:81008566-81008588 CTCAGAAGACAGGAAGATATGGG + Intergenic
976162373 4:82217015-82217037 AGAAGAAGACAGAAAGATGTGGG + Intergenic
976263802 4:83171473-83171495 CTGAGTAAAAAGAAAGATGGTGG - Intergenic
976277073 4:83288875-83288897 CTCAGAAGGCAGGAAGATGTGGG + Intergenic
976283442 4:83347662-83347684 CCCAGAAGACAGGAAGATGTGGG - Intergenic
976312071 4:83622433-83622455 CTCAGAAGACAGGAAGATGTGGG + Intergenic
976378108 4:84367816-84367838 CCCAGAAGATACAAAGATGATGG + Intergenic
976726579 4:88221511-88221533 CTTAGAAGACAGGAGGATGTGGG + Intronic
976797923 4:88955579-88955601 CTCAGAGGACAGGAAGATGTAGG + Intronic
976848526 4:89517737-89517759 CTCAGAGAATAGAAGGATGGAGG - Intergenic
976875613 4:89850358-89850380 CACAGAAGTCAGGAAGATTGAGG - Intergenic
976947671 4:90790762-90790784 CTCAGAAGACAGGAGGATGTGGG - Intronic
976952317 4:90849163-90849185 CTCAGAAGACAAGGAAATGGGGG + Intronic
977021355 4:91764604-91764626 CTCAGAAGACAGGAAAATGTAGG + Intergenic
977063880 4:92289004-92289026 CTCAAAAGACAGGAAGATGTGGG - Intergenic
977214018 4:94257511-94257533 TTCAGAAAACAGTAACATGGTGG + Intronic
977356486 4:95953226-95953248 CTCAGAAGACAGGAGGATGTGGG - Intergenic
977356495 4:95953280-95953302 CTCAGAAGACAGGAGGGTGTGGG - Intergenic
977707474 4:100087465-100087487 CTCAGAAGACAGGAAGATGAAGG - Intergenic
977783339 4:101005066-101005088 CTTAGAAGACAGCAAGAGGTGGG + Intergenic
977861098 4:101960968-101960990 TTCTCAAGTCAGAAAGATGGAGG - Intronic
977943045 4:102878732-102878754 CTCAGAAGACAGTAAGATGTGGG - Intronic
977952933 4:102994477-102994499 CTCAGAAGAGAGGAAGATGTGGG - Intronic
978083497 4:104622119-104622141 CTCAGAAGACAGAAAAATGTGGG - Intergenic
978213248 4:106163295-106163317 CTCAGAAGACAGGCAGATGTGGG - Intronic
978772489 4:112471414-112471436 CTCAGAAGGCAGAAGGCAGGGGG + Intergenic
978782740 4:112574451-112574473 CACAGAAGAAAGAAAAATGCTGG + Intronic
978948727 4:114529915-114529937 CTCAGAAGACAGGAAGGTATGGG + Intergenic
978948733 4:114529969-114529991 CTCAGAAGACAGGAAAATGAGGG + Intergenic
979038282 4:115753818-115753840 CTCAGAAGACATAAAAATGTGGG + Intergenic
979038289 4:115753872-115753894 CTCAGAAGACAGAAAGATATGGG + Intergenic
979102948 4:116645391-116645413 CTCAGAAGACAGGAAGATGTTGG + Intergenic
979137412 4:117127325-117127347 TTCAGAAGACAGGAAGATGTGGG + Intergenic
979139291 4:117152020-117152042 CTCAGAAGACAGGAAGATTTGGG - Intergenic
979177047 4:117678545-117678567 CTCAGAAGACAGGAAAATGTGGG + Intergenic
979206126 4:118040435-118040457 CTTAGAAGAAAGAAAGAAAGAGG - Intronic
979454729 4:120914572-120914594 CTCAGGAAACAGAATCATGGTGG + Intronic
979645368 4:123061136-123061158 CTCAGAAGACAGGAAGATGTGGG - Intronic
979700105 4:123657423-123657445 CTCAGAAGACAGGAAGATGTAGG - Intergenic
979703148 4:123690141-123690163 CTCAGAAGGCAGGAAGATAAGGG - Intergenic
979895963 4:126157327-126157349 CTCAAAAGACAGGAAGAGGTAGG - Intergenic
979984474 4:127296625-127296647 CTCAGAAGACAGGAAGATTTGGG - Intergenic
980090932 4:128442276-128442298 CTCAGAAGACAGGAAGATGAGGG - Intergenic
980310803 4:131126823-131126845 CTCAGAAGACAGGAAAATGTGGG - Intergenic
980425222 4:132619094-132619116 CTTAGAAGACAGGAAGATGTGGG - Intergenic
980425977 4:132628526-132628548 CTCAGAAGACAGGAAGACATGGG + Intergenic
980441093 4:132845877-132845899 CTCAGAAGATAGGAAGATAAGGG - Intergenic
980532659 4:134074424-134074446 CTCAGAAGACAGGAAGATGTGGG - Intergenic
980702724 4:136454177-136454199 ATTAGAAGACAGGAAGATGTGGG + Intergenic
980707706 4:136520873-136520895 CTCAGAAGATAGAAAGACGTGGG - Intergenic
980720497 4:136688266-136688288 CTCAGAAGACAGAAAAATGTGGG - Intergenic
981184335 4:141783226-141783248 CTCAGAAAACAGGAAGATGTGGG - Intergenic
981285199 4:143009566-143009588 CTCAGAAGACAGGAGGATGAGGG - Intergenic
981359545 4:143830901-143830923 CTCAGAAGACAGGAAGATGTGGG + Intergenic
981370307 4:143951969-143951991 CCCAGAAGACAGGAAGGTGTGGG + Intergenic
981380067 4:144061893-144061915 CCCAGAAGACAGGAAGGTGTGGG + Intergenic
981407293 4:144386234-144386256 CCCAAAAGACAGAAAGATGTGGG - Intergenic
981453083 4:144921324-144921346 CACAGAAGACAGGAAGATGAGGG - Intergenic
981503198 4:145474253-145474275 CACAGAAGACAGGAAGATGTGGG - Intergenic
981642946 4:146966533-146966555 CTCGGAAGACAGGAAAATGTGGG + Intergenic
981657645 4:147130250-147130272 CTCAGTAGTCAGAAAGAGAGAGG + Intergenic
981695145 4:147552206-147552228 CTCAGAAGACAAGAAGGTGTGGG + Intergenic
981862468 4:149373893-149373915 TTCAGAAGACAGAAATAAGGTGG + Intergenic
981915278 4:150026428-150026450 AGAAGAAGACAGAAAGATGTGGG + Intergenic
981985258 4:150846558-150846580 CTCAGAACTCAGAAGGATGAGGG + Intronic
982210288 4:153029258-153029280 CTCAGAAGACAGGAAGATGAGGG - Intergenic
982390004 4:154853517-154853539 CTCAGAAGACAGGAAGATGTGGG - Intergenic
982430245 4:155314543-155314565 CTCAGAAGACAGGAAGATGTGGG + Intergenic
982554193 4:156839714-156839736 CTCAGAAGACAGGAAGATTTGGG + Intronic
982577050 4:157126058-157126080 GTCAGGTGTCAGAAAGATGGAGG + Intronic
982622271 4:157723350-157723372 CTCAGAAGACAGGAAGATGTGGG + Intergenic
982987853 4:162233102-162233124 CTCAAAAGACAGGAAGGTGTGGG - Intergenic
983089618 4:163488058-163488080 AGAAGAAGACAGAAAGATGAGGG - Intergenic
983105547 4:163681916-163681938 CTCAGAAGACAGGAAAATGTGGG + Intronic
983105555 4:163681970-163681992 CTCAAAAGACAGGAAGATGTGGG + Intronic
983298122 4:165891742-165891764 CTCAGAAGACAGGAAGATGTGGG - Intronic
983517729 4:168675160-168675182 CTCCGAAGAGGGCAAGATGGTGG + Intronic
983665408 4:170176545-170176567 CTCAGAAGGCAGGAATATGAGGG + Intergenic
983713867 4:170753871-170753893 CTCAGAAGACAGGAAGATGTGGG + Intergenic
983766270 4:171488779-171488801 CTCAGAAGACAGAAAGATGTGGG + Intergenic
983785807 4:171728526-171728548 CTCAGAAGATAGAAAAATGTGGG + Intergenic
983847319 4:172536360-172536382 CTCAGAAGACAGAAAGATGTGGG + Intronic
983874617 4:172862110-172862132 CTCAGAAGACAGGAAGATGTGGG + Intronic
983889397 4:173015408-173015430 CTCAGAAGACAGGAAAATGCAGG + Intronic
983952690 4:173661276-173661298 CTCAGAAGACAAGAAGATGTGGG + Intergenic
984026235 4:174546924-174546946 CTCAGAAGAAAGGAATATGTGGG + Intergenic
985076688 4:186223344-186223366 CTTAGAAGATAGGAAGATGTGGG + Intronic
985220177 4:187695932-187695954 ATCAGAAGACAGGAAGATGTGGG + Intergenic
985394215 4:189524987-189525009 CTCAGAAGACAGGAAGATGAGGG + Intergenic
985950238 5:3217371-3217393 CTCAGCAGGCAGAAAAATGGAGG + Intergenic
986099640 5:4595333-4595355 CTCAGAAGATAGGAAGATGAGGG + Intergenic
986129162 5:4911100-4911122 TTCAGAAGACAGGAAGATGTGGG - Intergenic
986138349 5:5005041-5005063 AGAAGAAGACAGAAAGATGTGGG + Intergenic
986205646 5:5622772-5622794 AGAAGAAGACAGAAAGATGAGGG + Intergenic
986411787 5:7488450-7488472 CCCACAAGACAGAGGGATGGAGG - Intronic
986455387 5:7913067-7913089 CTCAGAAGACAGGAAAATGTGGG - Intergenic
986507873 5:8471441-8471463 CTCAGAAGACAGAAAGATGTGGG - Intergenic
986563230 5:9084826-9084848 CTCAGAAGACAAAAAAATGTGGG + Intronic
986601467 5:9477409-9477431 CTCAGAAGACAGGAAGATGGGGG + Intronic
986636160 5:9824145-9824167 CGCAGAAGACGGAAAGCTGGTGG - Intergenic
986640704 5:9869029-9869051 CTCAGAAAACAGGAAGATGTGGG - Intergenic
986752359 5:10799976-10799998 CTAAGAAGGTAGAAAGATGTAGG - Intergenic
986869545 5:12030606-12030628 CTCAGAAGACTAGAAGATGAGGG + Intergenic
987216662 5:15744513-15744535 CTCTGAAGACAGGAAGATGTGGG - Intronic
987435155 5:17884997-17885019 CTCAGAAGACAGGAAAATGTGGG + Intergenic
987560320 5:19511438-19511460 CTTAGAAGACAGGAAGACGTGGG + Intronic
987562479 5:19541291-19541313 CTCGGAAGACAGGAAGATGTGGG - Intronic
987662360 5:20893858-20893880 CTCAGAAGATAGGAAAATGTGGG + Intergenic
987789866 5:22551224-22551246 GTGAGAAGACAGGAAGAAGGTGG + Intronic
987802835 5:22720647-22720669 CTCAGAAGACAGGAAGATGTGGG + Intronic
987851664 5:23362721-23362743 CTCAGAAGACAGGAAGATGTGGG - Intergenic
987873185 5:23646929-23646951 CTCAGAAGACAGAAAAACGTGGG + Intergenic
988129221 5:27080869-27080891 TTCAGAAGACAGGAAAATGTGGG - Intronic
988200023 5:28055446-28055468 CTCAGAAGACAGGAAAATGTCGG - Intergenic
988226888 5:28424648-28424670 CTCAGAAGAAAATTAGATGGAGG + Intergenic
988353586 5:30143544-30143566 CTCAGAAAACAGGAAGATGTGGG - Intergenic
988396229 5:30700410-30700432 CTCAGAAGACGGAAAGATGTGGG + Intergenic
988473970 5:31566382-31566404 CTCAGAAGACAGGAAAATGTGGG - Intergenic
988761222 5:34311459-34311481 CTCAGAAGATAGGAAAATGTGGG - Intergenic
988780017 5:34512100-34512122 CTCAGAAATCAGAGAGAGGGAGG + Intergenic
989169648 5:38461817-38461839 CTCTGACGACAGGAAGAGGGAGG - Intronic
989203166 5:38786002-38786024 CTCAGAAGACAGAGAGATGTGGG + Intergenic
989218392 5:38928145-38928167 CTCAGAAGACAGGAAGATGTTGG - Intronic
989229177 5:39066961-39066983 CTCAGAAGACAGGAAAATGAGGG - Intronic
989311788 5:40027269-40027291 CTCAGAAGACAGGAGTATGTGGG - Intergenic
989494934 5:42101354-42101376 CTTAGAAGACAAGAAGATGTGGG + Intergenic
989501967 5:42178123-42178145 CTCAGAAGACAGGAAGACATGGG - Intergenic
989523729 5:42428867-42428889 CTCAGAAAACAGGAAGATGTGGG - Intronic
989662540 5:43815156-43815178 CTCAGAAGACAGGAAGATGTGGG + Intergenic
989703439 5:44298317-44298339 CTCAGATGACAGAAGGGAGGAGG - Intergenic
989966780 5:50474444-50474466 CACAGAAGACAGGAAAATGTGGG + Intergenic
989985035 5:50687422-50687444 CTCAGAAGACAGAAAAATGTGGG - Intronic
989998148 5:50860220-50860242 CTCTGAAGAGAGAAAGAAGATGG - Intergenic
990193394 5:53287069-53287091 CTCAGAAGACAGGAAAATGTGGG - Intergenic
990457038 5:55998061-55998083 CACAGAATAGAGATAGATGGGGG - Intergenic
990525978 5:56628288-56628310 CTCAGAAGACAGGAAAATGTGGG + Intergenic
990701151 5:58476103-58476125 CTCAGAAGATAGGAAGATGTGGG - Intergenic
990794430 5:59524227-59524249 CTCAGAAGACAGAAAGATGTGGG + Intronic
990941554 5:61207331-61207353 CTCAGAAGACAGGAAAATGTGGG - Intergenic
991105021 5:62833672-62833694 CTCAGAAGGCAGGAAAATGTGGG - Intergenic
991295227 5:65073376-65073398 CTCAGCAGACAGACAGCTAGAGG + Intergenic
991335127 5:65538646-65538668 CTCTGCAGACAGAGCGATGGAGG + Intronic
991600566 5:68348040-68348062 CTCAGAAGACAGAAAAACAAGGG + Intergenic
991941260 5:71854420-71854442 CTCCGAAGACAGGAAGATGTGGG - Intergenic
991961007 5:72044211-72044233 CTCACAAGACGGACAGAGGGAGG + Intergenic
991971751 5:72148276-72148298 CTCAGAAGACAGGAAGGAGAGGG - Intronic
992310066 5:75488846-75488868 CTCAGAATAGAGAAAGAGGCTGG - Intronic
993001042 5:82380657-82380679 AGCAGAAGACAGAAAAATGTGGG - Intronic
993036871 5:82768629-82768651 CGAAGAAGACAGAAAGATGTGGG + Intergenic
993117433 5:83734786-83734808 CTCTGAAGACAGGAAGATGTGGG + Intergenic
993198623 5:84782887-84782909 CTCAGAAGATAGAAAGATGAGGG - Intergenic
993413287 5:87597293-87597315 CTCAGAAGACAGGAAGACGTGGG - Intergenic
993451192 5:88073733-88073755 CTCAGAAGACAGGAAGATGTGGG + Intergenic
993531240 5:89027732-89027754 CTCAGAAGACAAGAAGATGTGGG - Intergenic
993569635 5:89521538-89521560 CTCAGAAGACAGGAAGATATGGG - Intergenic
993690620 5:90995666-90995688 CTCAGAAGACATGAAGATGAGGG + Intronic
993743395 5:91566057-91566079 CAAAGAAGACAGAAATATGTGGG - Intergenic
993752957 5:91692824-91692846 CTCAGAAGACAGGTAGATGAGGG - Intergenic
993761436 5:91801312-91801334 CTCAGAAGACAGGAAGATGTGGG - Intergenic
993781051 5:92065791-92065813 CTCAGAAGACAGAAAGATGAGGG + Intergenic
993799790 5:92318844-92318866 AGAAGAAGACAGAAAGATGTGGG + Intergenic
993946684 5:94123794-94123816 AAAAGAAGACAGAAAGATGAGGG - Intergenic
994032822 5:95164966-95164988 TCCAGCAGACAGAAAGAGGGAGG + Intronic
994102289 5:95907226-95907248 TTCAGAAGCCACAAAGAGGGGGG + Intronic
994285070 5:97955108-97955130 CTCAGAAGACAGGAGGATGAGGG + Intergenic
994292849 5:98050570-98050592 CATAGCAGACAGCAAGATGGGGG + Intergenic
994388488 5:99161561-99161583 CTCACAAGTCAGACAGATGTAGG - Intergenic
994397500 5:99237615-99237637 CCCAGGAGACAGAGAGAAGGGGG + Intergenic
994590859 5:101769834-101769856 CTCAGAATACAGAAAGATGTCGG - Intergenic
994764441 5:103899439-103899461 CTCAGAAAACAGGAAGATGTGGG + Intergenic
994902786 5:105797763-105797785 AGAAGAAGACAGAAAGATGAGGG + Intergenic
995055325 5:107753121-107753143 CTCAGAGGACAGGAAGAGGTGGG + Intergenic
995392502 5:111654154-111654176 CTCAGAAGACAGGAAAATATGGG - Intergenic
995429025 5:112054118-112054140 CCCAGAAGATAGGAAGATGTGGG + Intergenic
995703684 5:114962723-114962745 AGAAGAAGACAGAAAGATGGGGG - Intergenic
995997960 5:118323521-118323543 TTCAGAAGACAGAAAGATGTGGG - Intergenic
996033507 5:118733064-118733086 CTCAAAAGACAGGAAAATGTGGG + Intergenic
996149917 5:120022741-120022763 CTCAGAAGACAGAAAGGTGTGGG + Intergenic
996159595 5:120146143-120146165 CTCAGAAGACAGGAAAATGAGGG - Intergenic
996179227 5:120398969-120398991 CTCAGAAGACCAGAAGATGTGGG + Intergenic
996214411 5:120849561-120849583 CTCAGAAGACAGGAAAATGTGGG - Intergenic
996222718 5:120953056-120953078 CTCAGAAGATAGGAAAATGTGGG + Intergenic
996250964 5:121331487-121331509 CTCAGAAGACAGGAATATATGGG + Intergenic
996308117 5:122074177-122074199 CCCACAAAACAAAAAGATGGTGG + Intronic
996325979 5:122274557-122274579 CTGATGAGAAAGAAAGATGGAGG + Intergenic
996529458 5:124512387-124512409 ATCAGAAGACAGAAGGAGAGAGG - Intergenic
996637047 5:125704702-125704724 GAGAGAAGACAGAAAGATAGAGG + Intergenic
996642854 5:125777879-125777901 CTCAGAAGGCAAAAAGATAGAGG - Intergenic
996809221 5:127495695-127495717 CACAGAAGACAGAAAAAGAGTGG + Intergenic
996829265 5:127721522-127721544 AGAAGAAGACAGAAAGATGAGGG - Intergenic
996897541 5:128503437-128503459 CTCAGAAGACAGGAAGATGTGGG + Intronic
997102166 5:130981236-130981258 CTCAGAAGACAGGAAGATGTGGG - Intergenic
997857106 5:137382304-137382326 AGAAGAAGACAGAAAGATGTGGG - Intronic
998500972 5:142632321-142632343 CTAAGGAGACTTAAAGATGGGGG + Intronic
999589719 5:153131741-153131763 CTCAGAAGACAGGAAGATGTGGG - Intergenic
999758004 5:154679663-154679685 CAGAGAAGACAGACAGATGGTGG - Intergenic
1000030592 5:157397956-157397978 CTCAGAAGACAGGATAATGTGGG - Intronic
1000270553 5:159679540-159679562 CTCAGAAGACAGGAAGATGTGGG + Intergenic
1000516078 5:162237585-162237607 AGAAGAAGACAGAAAGATGTGGG - Intergenic
1000575329 5:162969040-162969062 CTCAGAAGACACGGAGATGGGGG + Intergenic
1000609533 5:163359195-163359217 CTCAGAAGACAGGAAGATGTGGG + Intergenic
1000659410 5:163919701-163919723 CTCAGAAGACAGCAAGATGTGGG + Intergenic
1000751463 5:165100581-165100603 CTCAGAGGACAGGAAGATGTGGG - Intergenic
1000784564 5:165527893-165527915 CTCCGAAGACAGGAAGATGTGGG + Intergenic
1000788146 5:165571381-165571403 CTCAGGAGACAAGAAGATGTGGG - Intergenic
1001457641 5:171877259-171877281 CTGAGATGACAGGAAGAAGGAGG + Intronic
1001473483 5:172032573-172032595 CTCAGAAGACAAGAAGATGGGGG - Intergenic
1001538331 5:172516239-172516261 CACAAAAGGCAGAAAAATGGTGG + Intergenic
1001632206 5:173183757-173183779 CCCAGAAGAGAGAAAGATGAAGG - Intergenic
1001943734 5:175760493-175760515 CTCAGAAGACAAGAAAATGTGGG + Intergenic
1001943741 5:175760547-175760569 CTCAGAAGACAGGAAAATGTGGG + Intergenic
1001994168 5:176142031-176142053 CTCAGGAGACAGGAAGATTAGGG + Intergenic
1002722437 5:181271090-181271112 CTCAGAAGCCAGAAAAACAGTGG - Intergenic
1002794146 6:457202-457224 CTCAGAAGACAGGAAGATGGGGG - Intergenic
1003226974 6:4214889-4214911 CTCAGAAAACAGGAAGATTTGGG - Intergenic
1003227523 6:4219660-4219682 TTCAGAAGACAGGAAGATGTGGG - Intergenic
1003227532 6:4219714-4219736 CTCAGAAGAAAGGAAAATGTGGG - Intergenic
1003484518 6:6564086-6564108 CTCAGAAGATAGGAAGATGAGGG - Intergenic
1003767960 6:9262063-9262085 CTCAGAAGACAGAAAGATATGGG - Intergenic
1003988769 6:11464917-11464939 CTCAAAAAACAGAAATATGTTGG + Intergenic
1004834468 6:19515531-19515553 ATCAGAAGACAGGAAGATGTGGG + Intergenic
1005101042 6:22172759-22172781 CTCAGAAGACAGGAAGATGTGGG + Intergenic
1005113843 6:22314869-22314891 CTCAGAAGACAGGAAAATGAGGG - Intergenic
1005153511 6:22778760-22778782 CTCAGAAGATAGGAAGATGTGGG + Intergenic
1005353378 6:24959146-24959168 CTAAGAAGACACAGAGATGCAGG - Intronic
1005368129 6:25100233-25100255 CAGAGAAGTCAGATAGATGGTGG + Intergenic
1005597523 6:27393665-27393687 CTCAGAAGATGGGAAGATGAGGG + Intronic
1005848943 6:29804191-29804213 TTCAGAAGACAAGAAAATGGGGG + Intergenic
1005893033 6:30155256-30155278 CACAGATGACAGAAGGAGGGCGG - Intronic
1005908290 6:30284779-30284801 CTCCGAAGATAGGAAGATGAGGG - Intergenic
1005982895 6:30851054-30851076 CTCAGAAGACAGGAAAATGTGGG + Intergenic
1005984289 6:30861141-30861163 CTCAGAAGACAGGAAAGTGTGGG - Intergenic
1006062879 6:31438554-31438576 CTCCGAAGACAGGAAGATATGGG + Intergenic
1007286600 6:40752392-40752414 CTCAGACGACAGAACCAAGGTGG - Intergenic
1007866285 6:44973469-44973491 CTCAGGAGACATGAAGATGTAGG - Intronic
1008057910 6:46964164-46964186 CCCAGAAGAGAGGAAGAAGGAGG - Intergenic
1008320767 6:50110814-50110836 CTCAGGAAAAAGAAAGATGAGGG - Intergenic
1008445668 6:51587144-51587166 AGAAGAAGACAGAAAGATGTGGG - Intergenic
1008504751 6:52218994-52219016 CTCAGAGGACAAGAAGATGAGGG + Intergenic
1008681553 6:53877806-53877828 CTCAGAAGACAGGAAAACGTGGG - Intronic
1008820283 6:55624247-55624269 TTCAGAAGACAGATAGATCTTGG + Intergenic
1008848055 6:55992618-55992640 CTCAGGAGACATAATCATGGTGG + Intergenic
1009051504 6:58282239-58282261 CTCAGAAGACAGACAGATGTGGG + Intergenic
1009316191 6:62223920-62223942 TTCAGAAGACAGGAAAATGTGGG - Intronic
1009546114 6:65021510-65021532 ATCAGGAGACAGGAAGATGTGGG - Intronic
1009699658 6:67160183-67160205 AGAAGAAGACAGAAAGATGTGGG + Intergenic
1009769231 6:68122822-68122844 CTCAGAAAACAAGAAGATGTGGG - Intergenic
1009773300 6:68173356-68173378 CTCAGGAAACAGAATCATGGTGG - Intergenic
1009805029 6:68591406-68591428 CTTAGAAGACAGGAAGATGTGGG - Intergenic
1009825344 6:68859315-68859337 CTCAGAAGACAGGAAGATGTGGG - Intronic
1009980575 6:70721498-70721520 CTCAGAAGACAAGAAAATGTGGG - Intronic
1010055040 6:71555535-71555557 CTCAGAAGATAGAAAGATGTAGG + Intergenic
1010061162 6:71624776-71624798 CTGAGAAGACAGCAAGGTGTGGG + Intergenic
1010550935 6:77221940-77221962 CTCAGAAGACAGACAGATGTGGG + Intergenic
1010605866 6:77889236-77889258 CTGAGAAGACAGGAAGATGTGGG + Intronic
1010610687 6:77951268-77951290 TTCAGAAGACAGGAAGATGTGGG + Intergenic
1010630288 6:78190466-78190488 CTCAGGAGAGAGGAAGATGGGGG - Intergenic
1010631904 6:78208246-78208268 CTCACAAGACAGGATGATGTAGG - Intergenic
1010651121 6:78456310-78456332 CTCAGAAGACAGGAAGATGTGGG - Intergenic
1010819338 6:80395287-80395309 CTCAGAAGACAGGAAGATGTGGG + Intergenic
1010882801 6:81200636-81200658 CTCATGAGACAGGAAGATGTGGG + Intergenic
1010900471 6:81422109-81422131 CTCAGAAGACAGGAAGATGTGGG + Intergenic
1010913383 6:81586492-81586514 CTCAGAAGACAGGAAGATGTGGG - Intronic
1011031644 6:82930500-82930522 CTCAGAAGACAGAAAGATATGGG + Intronic
1011046296 6:83087046-83087068 TTCAGAACACAGCAAGAGGGAGG + Intronic
1011210951 6:84956020-84956042 AGAAGAAGACAGAAAGATGTGGG + Intergenic
1011462051 6:87614870-87614892 CTCAGAAGACAGGAAAATGTGGG - Intronic
1011518914 6:88182712-88182734 CTCAGAAAACATAATCATGGTGG - Intergenic
1011544403 6:88468018-88468040 CTCAGAAGACAGGAAGATGAGGG + Intergenic
1011738350 6:90334630-90334652 CTCAGAAGACAGAAAGACGTGGG - Intergenic
1011845084 6:91552980-91553002 CTCCTAAGACAGGAAGATGTGGG - Intergenic
1011867872 6:91853791-91853813 CGCAGAAGACAGGAAGATGTGGG + Intergenic
1011870371 6:91885599-91885621 CTCGGAAGACAGGAAGATGTGGG + Intergenic
1011895170 6:92216396-92216418 GTCAGAAGACAGGAATATGTGGG + Intergenic
1011956497 6:93030599-93030621 ACCAGAAGACAGGAAGATGTGGG - Intergenic
1011981783 6:93387426-93387448 CTCAGAAGACAGGAAGATGTGGG - Intronic
1012029125 6:94036349-94036371 ATCAGAAGACAGAAAGATGGAGG + Intergenic
1012045279 6:94264869-94264891 CTCAGAAGACAGGGAGATGTGGG - Intergenic
1012068304 6:94578025-94578047 CTCAGAAGACAGGAAGATGTGGG - Intergenic
1012076388 6:94691780-94691802 CTCAGAAGACCCAAAGATGTGGG - Intergenic
1012078761 6:94728394-94728416 CTCAGAAGACAGGAAGATGTGGG - Intergenic
1012097273 6:94978030-94978052 CTCAGAAGACAGAAAGATGTGGG - Intergenic
1012141409 6:95630911-95630933 ATCAGAAGACAGGAAAATGTGGG + Intergenic
1012179958 6:96140308-96140330 CTCAGAAGACAGTAAGATGTGGG - Intronic
1012485818 6:99721879-99721901 AGAAGAAGACAGAAAGATGTGGG + Intergenic
1012514118 6:100038887-100038909 CTCAGAAGACAGAAAGATGTGGG + Intergenic
1012677778 6:102138553-102138575 CAAAGAAGACAGGAAGATGAGGG - Intergenic
1012751303 6:103167350-103167372 AAAAGAAGACAGAAAGATGTGGG + Intergenic
1012768220 6:103396634-103396656 CTCAGAAGACAGAAAGATGTGGG + Intergenic
1012771213 6:103437306-103437328 CTCAGGAGACAGGAAGATATGGG - Intergenic
1012780170 6:103547536-103547558 CTTGGAAGACAGGAAGATGAGGG - Intergenic
1012956122 6:105572039-105572061 CTCAAAAAAGAGAAAAATGGGGG + Intergenic
1012967050 6:105686379-105686401 AGAAGAAGACAGAAAGATGTGGG + Intergenic
1013017241 6:106170999-106171021 CTCAGAAAACAAAAGGAAGGGGG + Intergenic
1013087363 6:106867812-106867834 CATAGAAGACAGACAGATGAGGG - Intergenic
1013149345 6:107429083-107429105 CTGAGAAGACAGAAACTTTGAGG + Intronic
1013169190 6:107620769-107620791 CACAGAAAAAAGAAATATGGTGG - Intronic
1013404506 6:109831002-109831024 CTCAGAAGACAGGAAATTGTGGG + Intergenic
1013549405 6:111192413-111192435 CTCAGAAGAAAGGAAGATGTAGG - Intronic
1013559558 6:111290860-111290882 CTCAGAAGACAGGAATATGTGGG - Intergenic
1013829194 6:114252715-114252737 CTCTGAAGACCCAAAGATGATGG - Intronic
1013864847 6:114682992-114683014 CTGAGATACCAGAAAGATGGCGG - Intergenic
1013925176 6:115463659-115463681 CTCAGAAGACAGGAAGATGTGGG + Intergenic
1014040871 6:116823520-116823542 CAAAGAAGACAGGAAGATGAAGG - Intronic
1014101720 6:117518386-117518408 CTAAGAAGACAGGAAAATGTGGG - Intronic
1014135536 6:117884591-117884613 CTCAGAAGACAGGAAGATGTGGG - Intergenic
1014168224 6:118249758-118249780 CTCAGAAGACATAAACAAGAGGG - Intronic
1014327692 6:120019132-120019154 CTCAGAAGTCAGAAAAATGTGGG - Intergenic
1014469906 6:121801171-121801193 CTCAGAAAACAGGAAGATATGGG + Intergenic
1014525981 6:122502200-122502222 CTCAGAAGACAGAAAGATGAGGG - Intronic
1014705207 6:124737658-124737680 CTCAGAAGACAGAAAGACGTGGG + Intronic
1014721374 6:124921556-124921578 CTCAGAAGACAGGGAGATGTGGG - Intergenic
1014883159 6:126747287-126747309 CTCAGAAGACAGGAAGACATGGG - Intergenic
1014895113 6:126892119-126892141 CTCAGAAGACAGGAAGATGTGGG + Intergenic
1015039762 6:128703024-128703046 CTCAGAAGACAGGAATATGTGGG + Intergenic
1015110806 6:129589530-129589552 CTCAGAAGACAGGAAGACGTGGG - Intronic
1015361991 6:132350649-132350671 CTGTGAAGAAAGAATGATGGTGG + Intronic
1015995675 6:138993482-138993504 CTCAGGAGACAGGAAGATGTGGG + Intergenic
1016000915 6:139040333-139040355 CACAGAAGGCACAAAGAAGGTGG + Intronic
1016084247 6:139893557-139893579 TTCTGAAGGGAGAAAGATGGAGG + Intergenic
1016151348 6:140746142-140746164 CTCAGAAAACAGGAAGATATTGG + Intergenic
1016586012 6:145686914-145686936 ATCAGACGCCAGAAAGGTGGGGG - Intronic
1016587630 6:145707895-145707917 CTCAGAAGACAGGAAGATGTGGG + Intronic
1016592785 6:145765196-145765218 TTCAGAAGACAGGAAGATGTGGG + Intergenic
1016721458 6:147303628-147303650 GGAAGAAGACAGAAAGATGTAGG + Intronic
1016721462 6:147303682-147303704 CTCAGAAGACCGAAAGATATGGG + Intronic
1016778290 6:147930296-147930318 AGAAGAAGACAGAAAGATGAAGG - Intergenic
1016780155 6:147948979-147949001 AACAGGAGACAGAAAGATGGAGG + Intergenic
1016790324 6:148060806-148060828 CTCAGAAGACAGGAAAATGTAGG - Intergenic
1016876572 6:148871187-148871209 CTCACATGACAGAAAGAGAGGGG - Intronic
1017011047 6:150064134-150064156 CTAAGAAGAGAGAAACCTGGGGG - Intronic
1017245010 6:152214905-152214927 CTCAGACTACAGAAAGATTCAGG - Exonic
1017860649 6:158394333-158394355 CTCAGAAGACAGGAGGATTGTGG - Intronic
1017958016 6:159195378-159195400 CTCCCAAGAGAGGAAGATGGTGG + Intronic
1018093736 6:160366890-160366912 CTCAAAAGACAGGAAGATGTGGG - Intronic
1018510194 6:164516717-164516739 CTCAGAAGACAAGAAGATGTGGG - Intergenic
1018511053 6:164525361-164525383 CTCAGAAGACACGAAGGTGTGGG + Intergenic
1018535537 6:164814951-164814973 CTCAGAAGACAGGAAGATGTGGG - Intergenic
1018585085 6:165349204-165349226 CTCAGAAGACAGGAAGAAGTGGG + Intronic
1018592715 6:165444228-165444250 CTCAAAAGACAGGAAGATGAAGG - Intronic
1018601040 6:165541087-165541109 CTCAGAAGACAGGCTGAAGGGGG + Intronic
1019024695 6:168949293-168949315 CTCAGCTGACAGAAAAATGCAGG - Intergenic
1019039270 6:169090107-169090129 AGAAGAAGACAGAAAGATGTGGG + Intergenic
1020328758 7:6997371-6997393 CTCAGAAGAAAGAGATGTGGGGG + Intergenic
1020565373 7:9788139-9788161 CTTAGAAGACAGGAAGATGAGGG - Intergenic
1020729600 7:11865352-11865374 CTCAGTATACAGGAAGATGTGGG + Intergenic
1020730019 7:11868842-11868864 CCCAGAAGATAGAAAGATGTGGG + Intergenic
1020775557 7:12450127-12450149 CTCAGAAGACAGGAAGATGGGGG + Intergenic
1020869232 7:13606929-13606951 CTCAGAACACAGGAAGATGTGGG + Intergenic
1021001909 7:15341536-15341558 AGAAGAAGACAGAAAGATGTGGG - Intronic
1021175078 7:17440718-17440740 CTCAGAAGACAGGAAGATTTTGG - Intergenic
1021758734 7:23882314-23882336 CTTAGAAGACAGGAAGATGAGGG - Intergenic
1021882734 7:25110141-25110163 CTCAGAAGACAGGAAAATGTGGG + Intergenic
1022417139 7:30188206-30188228 CTCAGAAGACAGGAAGATGTAGG - Intergenic
1022629511 7:32071505-32071527 CGCACAAGAGAGAGAGATGGGGG - Intronic
1022921374 7:35018916-35018938 CTTAGAATAAAGAAATATGGTGG + Intronic
1023030751 7:36088592-36088614 CTCAGAAGACAGGAAGATGAGGG + Intergenic
1023275582 7:38515724-38515746 AGAAGAAGACAGAAAGATGAGGG + Intronic
1023391247 7:39713701-39713723 CTCAGAAAACAGGAAGATGAGGG + Intergenic
1023634651 7:42197613-42197635 CTCAGTACAGAGAAGGATGGGGG + Intronic
1023766413 7:43515186-43515208 CTCAGAAGAGAGAAAGAGGCTGG + Intronic
1024015241 7:45307672-45307694 CTCAGAAGACAGGAAGATGAGGG + Intergenic
1024021518 7:45374912-45374934 CTCAGAAGACAGGATAATGTGGG - Intergenic
1024394962 7:48855665-48855687 CCCTGAAGACAGACAGGTGGTGG - Intergenic
1024400304 7:48916976-48916998 CCCTGAAGACAGACAGGTGGTGG + Intergenic
1024413853 7:49079673-49079695 CTCAGAAGACAGGAAGATGTGGG - Intergenic
1024413860 7:49079727-49079749 ATAAGAAGACAGAAATATGTAGG - Intergenic
1024667166 7:51558635-51558657 AGAAGAAGACAGAAAGATGTAGG + Intergenic
1024741657 7:52362045-52362067 CTCAGAAAAAAGAAAGATTACGG - Intergenic
1024771615 7:52730642-52730664 CTCAGAAGACAGGAAGATGTGGG + Intergenic
1024860448 7:53834277-53834299 CTCAGAAGACAGGAAGATGTGGG + Intergenic
1025038465 7:55618603-55618625 GTCAGAAGACAGGAAGATGTGGG + Intergenic
1026212658 7:68319517-68319539 CTTAGAAAACAGAGAGAAGGAGG + Intergenic
1027300491 7:76828677-76828699 CTCAGAAGACAGGAAAATGTGGG - Intergenic
1027526704 7:79278288-79278310 CTCAGAAGCCAAACAGATGCTGG + Intronic
1027650369 7:80859711-80859733 CTCAAAAGACAGCTAAATGGAGG - Intronic
1027834055 7:83218538-83218560 CTCAGAAGATAGGAAAATGTGGG + Intergenic
1027953836 7:84855150-84855172 ATCAGAAGACAGCAAGATATGGG - Intergenic
1027993634 7:85395958-85395980 CTCAGAAGACAAGAAGATGTGGG - Intergenic
1028044987 7:86107053-86107075 GTCAGAAGACAGGAAGATGTGGG + Intergenic
1028084141 7:86616238-86616260 CTCAGAAGACAGAAAGATGTGGG + Intergenic
1028133733 7:87205755-87205777 CTCACAAGACAGGAAGATGTGGG - Intronic
1028844068 7:95460347-95460369 CTCAGAAGACAGGAAAATATGGG + Intergenic
1028847234 7:95495804-95495826 CAAACAAGACAGAGAGATGGAGG - Exonic
1028990904 7:97047877-97047899 CTCAAAGGACAGAAAGATTAGGG - Intergenic
1029914798 7:104198262-104198284 CTCAGAAGACAGGAAGAAATGGG + Intronic
1029961355 7:104691796-104691818 CTCAGAAGACAGGAAAATATGGG + Intronic
1029961361 7:104691850-104691872 CTCAGAAGATAGAGAAATGTGGG + Intronic
1030369831 7:108686368-108686390 AGCAGGAGACAGAAAGATGCAGG - Intergenic
1030415391 7:109237527-109237549 CTCAAAAGACAGGAAGATGTGGG + Intergenic
1030470065 7:109952497-109952519 CTCAGAAGATGGGAAGATGTGGG - Intergenic
1030527741 7:110673838-110673860 CTCAGAAGACAGGAAGATATGGG - Intronic
1030722490 7:112885687-112885709 CTCAGAAGATAGGAAGATGTGGG - Intronic
1030851154 7:114487871-114487893 CTCAGAAGACAGGAAAATGTGGG - Intronic
1030986302 7:116245531-116245553 CTCAGAAGACAGGAAGATGTGGG - Intronic
1031170808 7:118290217-118290239 CTCAGAAGACAGGAAGATGTGGG + Intergenic
1031172582 7:118309956-118309978 CTCAGAAGACAGGAAGATGTGGG - Intergenic
1031186184 7:118482533-118482555 CTCAGAAGACAGGAAGACGTGGG - Intergenic
1031194115 7:118590619-118590641 CTCAGAAGACAGGAAGACATGGG + Intergenic
1031287360 7:119886682-119886704 CTCAGAAGAAAGGAAGATGTGGG - Intergenic
1031330478 7:120457653-120457675 CGCAGAAGACAGGAAGATGTAGG - Intronic
1031360761 7:120845791-120845813 CTCAGAAGACAGAAAGATGAGGG - Intronic
1031500982 7:122516026-122516048 CTTTGAAGACAGAAAGCAGGGGG + Intronic
1031521830 7:122776650-122776672 CTCAGAAGACAGGAAGATGTGGG + Intronic
1031521981 7:122777988-122778010 GTCAGAAGACAGGAAAATGTGGG + Intronic
1031521988 7:122778042-122778064 CTCAGAAGACAAGAAAATGTAGG + Intronic
1031576231 7:123418508-123418530 CTCATAAGACAGGAATATGTGGG - Intergenic
1031637468 7:124119251-124119273 CTCAGAAGACAGAAAGATGTGGG + Intergenic
1031716026 7:125109717-125109739 CTCAGAAGACAGGAAGACATGGG - Intergenic
1031725411 7:125231265-125231287 CTCAGAAGACAGCAATATGTGGG - Intergenic
1031769864 7:125829840-125829862 CTCCAAAGACAGAAAGATGTGGG - Intergenic
1031790219 7:126093179-126093201 AGAAGAAGACAGAAAGATGTGGG - Intergenic
1032963509 7:137068624-137068646 CTCAGTAGAAAAAAAAATGGAGG + Intergenic
1033531905 7:142272587-142272609 CTAAGAACACAAAACGATGGAGG - Intergenic
1033721386 7:144062415-144062437 CTCAGAAGACAGAATAATGTGGG - Intergenic
1033777471 7:144628737-144628759 TTAAGAAGACAGGAAGATGTGGG + Intronic
1033805927 7:144954218-144954240 TTCAGAAGACAGAAAGATGAGGG - Intergenic
1033843420 7:145403009-145403031 AGAAGAAGACAGAAAGATGAGGG + Intergenic
1034003328 7:147441876-147441898 CTCAGAACAGAGAGAGACGGAGG - Intronic
1034094387 7:148392990-148393012 CTTAGAAGTCATAACGATGGAGG - Intronic
1034510829 7:151533262-151533284 CTCAGAAGACAGAAAGATGTGGG - Intergenic
1034718457 7:153265130-153265152 CTCAGAAGACAGAAAGATATGGG - Intergenic
1034728946 7:153366664-153366686 CTCAGAAGACAGGAAGATAAGGG - Intergenic
1034751144 7:153570019-153570041 CTCAAAAGACAGCAAGATGTGGG - Intergenic
1034874608 7:154714190-154714212 CTCAGAAGACAGGAAGATGTGGG - Intronic
1034876232 7:154726986-154727008 CTCAGAAGACAGAGAGATGAGGG - Intronic
1034951267 7:155298210-155298232 CTCAGAAGAGACAAAGAGCGAGG - Intronic
1036367864 8:8136761-8136783 CTCAGAAGAAAGAGATGTGGGGG - Intergenic
1036406476 8:8459827-8459849 CTCAGAAGAAAGGAGGAAGGTGG + Intergenic
1036774252 8:11599252-11599274 CTCAGAAGACATACAGAGTGTGG + Intergenic
1036883016 8:12528889-12528911 CTCAGAAGAAAGAGATGTGGGGG + Intergenic
1037081853 8:14797178-14797200 CTCAGAAGACAGGAAAATGTGGG + Intronic
1037108305 8:15137004-15137026 CTTAGAAGACAGGAAGATGTGGG + Intronic
1038410545 8:27355302-27355324 AGCAGAAGTCAGAAAGAGGGAGG + Intronic
1038880547 8:31606140-31606162 CTCAGAAGACAGAAAGATGTGGG - Intergenic
1038880554 8:31606194-31606216 CTCAGAAGACAGGAAAATGTGGG - Intergenic
1039082434 8:33746076-33746098 CTCAGAAGACAGTAAGATGTGGG - Intergenic
1039107498 8:34004973-34004995 TTCAGAAGACAGGAATATGTGGG - Intergenic
1039298318 8:36181981-36182003 CTCAGAAGACAGGGAGATGTGGG - Intergenic
1040397845 8:47016521-47016543 CTAGGAACAAAGAAAGATGGTGG - Intergenic
1040644914 8:49387282-49387304 CTCAGAAGACAGGAAGATGTGGG + Intergenic
1040741249 8:50579050-50579072 CTCAGAAGACAGAAAGTTGTGGG + Intronic
1040813317 8:51481116-51481138 CTCAGAAGACAGGCAGATGTGGG + Intronic
1040915409 8:52563550-52563572 CTCAAAGTACAGAAACATGGAGG - Intronic
1041434282 8:57820393-57820415 CTCAGAACACAGGAAGATGTAGG - Intergenic
1041562249 8:59232188-59232210 TTCAGAAAACAGAAAAATTGTGG - Intergenic
1041823747 8:62068230-62068252 CTCAGAAGGCAGGAAGATGTGGG + Intergenic
1041851990 8:62402949-62402971 CTCAGAAGACAGGAAGATGTGGG + Intronic
1041940377 8:63381124-63381146 ATCAGAAGTCAGGAAGATGTGGG + Intergenic
1042052908 8:64731260-64731282 TTCAGAAGACAGAAAGTTGTGGG + Intronic
1042058079 8:64787561-64787583 CTTTGAAGACAGGAAGATGTGGG - Intronic
1042072423 8:64950348-64950370 AGAAGAAGACAGAAAGATGAGGG - Intergenic
1042080698 8:65047713-65047735 CTCAGAAGACAGGAAAATGTGGG - Intergenic
1042407630 8:68423517-68423539 CTCAGAAGATAGGAAGATGTGGG - Intronic
1042622146 8:70718116-70718138 CTCAGAAAACTGGAAGATGTGGG - Intronic
1042738743 8:72018848-72018870 GACAGAAGACAGGAAGATGTGGG - Intronic
1042989339 8:74621192-74621214 CTCAGATGACAGGAAGATGTGGG - Intronic
1043085460 8:75826500-75826522 AGAAGAAGACAGAAAGATGAGGG + Intergenic
1043204858 8:77425481-77425503 AGGAGAAGACAGAAAGATGCAGG + Intergenic
1043266371 8:78271698-78271720 CTCAGAAGACAGGAAGGTGAGGG - Intergenic
1043297568 8:78684064-78684086 CTCAGAAGACAGAAAAATGTGGG - Intronic
1043345731 8:79296074-79296096 CTCAGAAGACAGGAAGATGTGGG + Intergenic
1043721729 8:83553353-83553375 CTCAGAAGACAAGAAGATGTGGG - Intergenic
1043811903 8:84752019-84752041 AACAGAAGACAGGAAGATGAGGG + Intronic
1043956424 8:86365317-86365339 CTAAAAATACAGAAAGATGGAGG + Intronic
1044017248 8:87059235-87059257 CTCAGAAGACAGGAAGCTGTGGG - Intronic
1044073058 8:87785929-87785951 CTCAGAAGACAGGAAAATGTGGG - Intergenic
1044205697 8:89490082-89490104 CTCAGAAGTCAGAAAGATATGGG + Intergenic
1044295039 8:90518034-90518056 ATCAGAAGACAGGAAGATGAGGG + Intergenic
1044395623 8:91707666-91707688 CTCAGAAGACAGGAAGATGTGGG + Intergenic
1044945507 8:97385338-97385360 GGAAGAAGACAGAAAGATGAGGG - Intergenic
1045021128 8:98045361-98045383 CTCCTAAGGCAGGAAGATGGTGG - Exonic
1045050596 8:98320741-98320763 CTCAGAAGATAGGAAAATGTGGG - Intergenic
1045264368 8:100606653-100606675 CTCAGGAGAGAGAGAGATGGTGG - Intronic
1045617988 8:103940008-103940030 CTCAGAAGACAGGAAAATGTAGG - Intronic
1045888624 8:107128071-107128093 CTCAAAAGACAGGAAGATATGGG - Intergenic
1045894899 8:107203078-107203100 CTCAGAAGACAGAAAAATGTGGG - Intergenic
1045922493 8:107547710-107547732 CTCAGAAGACAGGAAGATGTAGG - Intergenic
1045957815 8:107929529-107929551 CTAAGAAGAGAGAGAGAGGGAGG + Intronic
1045993803 8:108339978-108340000 AAAAGAAGACAGAAAGATGTGGG - Intronic
1046107343 8:109682286-109682308 CTCAGAAGACAGGAAGATGTGGG + Intronic
1046146742 8:110171185-110171207 CTCAGAAGACAGGAAGACGTAGG + Intergenic
1046175643 8:110571813-110571835 CTCAGAAGACAGGAAAATGGGGG - Intergenic
1046226428 8:111286228-111286250 GTCAGAAGACAGGCAGATGTGGG - Intergenic
1046309364 8:112414672-112414694 CTCAGAAGACAGGGAGATGTGGG + Intronic
1046311338 8:112441363-112441385 CTCAGAATACAGAAAGATGTGGG - Intronic
1046358278 8:113116696-113116718 CTCAGAAAACAGGAAGATGTTGG + Intronic
1046365661 8:113227722-113227744 CTCAGAAAACATAATTATGGTGG - Intronic
1046367203 8:113250387-113250409 CTCTCAAGAAAGAGAGATGGAGG + Intronic
1046452083 8:114406399-114406421 CTCAGAAGACAGGAAGATGTGGG - Intergenic
1046533148 8:115473004-115473026 CTCAGAAGACAGGAAGATGTGGG - Intronic
1046547341 8:115668570-115668592 CTCGGCAGCCCGAAAGATGGTGG + Exonic
1046607500 8:116388099-116388121 CTCAGAAGACAGGAAGATGTGGG + Intergenic
1046741230 8:117831163-117831185 CACAGAAGTCAGAAAGATCAAGG + Intronic
1046786566 8:118272872-118272894 CTCAGGAGACAGGCAGATGTGGG - Intronic
1046831381 8:118750582-118750604 CTCAGAAGACAGGAAGATGTGGG + Intergenic
1046878277 8:119279441-119279463 CTCAGAAGAAAGGAAAATGAGGG - Intergenic
1046928892 8:119823761-119823783 CTCAGAAGACAGGAAAATGCGGG + Intronic
1046966877 8:120177287-120177309 GTCAGAAGACACAAAAGTGGTGG + Intronic
1047115876 8:121841504-121841526 CTCAGAAGACAGAAAGAGGGGGG + Intergenic
1047170346 8:122486539-122486561 CTTAGAAGAGAGCAAGCTGGAGG - Intergenic
1047490519 8:125370555-125370577 CTCAGAAGACAGGAAAATGTAGG - Intergenic
1047656131 8:126979520-126979542 CTGAGAAGAGAGGAAGAAGGAGG - Intergenic
1047924408 8:129668907-129668929 CTCAGAAGACAGGAAGATGTGGG + Intergenic
1048096539 8:131301345-131301367 AGAAGAAGACAGAAAGATGAGGG - Intergenic
1048189350 8:132273984-132274006 CTCAGAAGACAGGAAAATGTGGG - Intronic
1048217610 8:132510774-132510796 TTCAGAAGACAGGAAGATGTGGG - Intergenic
1048248256 8:132833213-132833235 GTCAGAAGAAAGAAAAAGGGAGG - Intronic
1048479134 8:134771629-134771651 CTCAGAAGACAGGAAAATGTGGG - Intergenic
1048556258 8:135479931-135479953 CTCAGAACATATAAAAATGGAGG + Intronic
1048726238 8:137388132-137388154 CTCAGAAGACAAGAAGATGCCGG - Intergenic
1048729288 8:137419517-137419539 CTCACAAGACAGGAAGATGTGGG - Intergenic
1048870851 8:138796610-138796632 CTCAGCAGAAAGAGAGAAGGTGG - Intronic
1049903249 9:190222-190244 CTCAGAAGACAGGAATATGTGGG - Intergenic
1050086462 9:1971558-1971580 CTCAGAAGACAAGAAGATGTGGG + Intergenic
1050125083 9:2348330-2348352 CTCAGAGGACAGGAAGATGAAGG + Intergenic
1050662756 9:7901259-7901281 ATTAGAAGAAAAAAAGATGGGGG - Intergenic
1050781720 9:9344639-9344661 TTCAGAATACAGAAACATTGTGG - Intronic
1050811155 9:9749388-9749410 CTCAGGAGACAGACAAATGGAGG - Intronic
1050816769 9:9823226-9823248 CCCAGAAGCCAGGCAGATGGAGG - Intronic
1050890266 9:10816623-10816645 CTCAGAACTAAGAAAGATGATGG + Intergenic
1051190782 9:14509747-14509769 GTCAGAAGACAGAGAGCTGAAGG + Intergenic
1051569094 9:18535407-18535429 CTCAGAAGACAGGAAGATGTGGG - Intronic
1051718968 9:20015678-20015700 ATGAGAAGACAGAAAGTGGGTGG - Intergenic
1051744109 9:20278671-20278693 CTCCGAAGACAGGACGATGTGGG - Intergenic
1051810174 9:21039641-21039663 CATAGAAGACAGAAAAGTGGGGG + Intergenic
1052054056 9:23883390-23883412 CTCAGAAGACAGGAAGATGTAGG - Intergenic
1052176077 9:25464340-25464362 CTCAGATGACAGGAAGATGTGGG - Intergenic
1052179464 9:25506367-25506389 AGAAGAAGACAGAAAGATGAGGG - Intergenic
1052187879 9:25620785-25620807 CTCAGAAAATAGGAAGATGTGGG - Intergenic
1052208398 9:25870942-25870964 CTCAGAAGACAGGAAGATGTGGG - Intergenic
1052294469 9:26881790-26881812 CCCAGAAGACAGGAAAATGTGGG + Intronic
1052351870 9:27466418-27466440 TTCAGAAGACAGGAAAATGTGGG - Intronic
1052392175 9:27893056-27893078 CTCAGCAGTCAGAAAGAGTGGGG + Intergenic
1052464688 9:28815460-28815482 ATCAGAAGCCAGAAAGATTTAGG - Intergenic
1052522124 9:29562119-29562141 CTCAGAAGACAGGGAGATGTGGG + Intergenic
1052526776 9:29628959-29628981 CTCAGAAGACAGAAAGATGTGGG + Intergenic
1052592239 9:30513469-30513491 CTCAGAAGACATGAAGATGAGGG + Intergenic
1052666148 9:31497531-31497553 CTCAGAAGAGAAGAAGATAGGGG - Intergenic
1052946924 9:34176105-34176127 GAAAGAAGACAGAAAGAGGGAGG + Intergenic
1052969520 9:34368735-34368757 ATCAGAAGACAGGAAAATGTGGG - Exonic
1053194109 9:36101901-36101923 CTCAGACAACAGAAAGTTAGGGG + Intronic
1053264360 9:36699790-36699812 AGAAGAAGACAGGAAGATGGGGG - Intergenic
1053313248 9:37032659-37032681 CTCAGAGGGCACAGAGATGGGGG + Intronic
1053371237 9:37563482-37563504 CTCAGAAGACAAGAAGATGTGGG + Intronic
1053570509 9:39300501-39300523 AACAGAAGAGAGAAAGAAGGAGG + Intergenic
1053746259 9:41200505-41200527 CTCAGAAGACAGGAATATGTGGG - Intergenic
1054092129 9:60859518-60859540 AACAGAAGAGAGAAAGAAGGAGG + Intergenic
1054113542 9:61135111-61135133 AACAGAAGAGAGAAAGAAGGAGG + Intergenic
1054481007 9:65664712-65664734 CTCAGAAGACAGGAATATGTGGG + Intergenic
1054682086 9:68230775-68230797 CTCAGAAGACAGGAATATGTGGG + Intergenic
1054868414 9:70026269-70026291 CCCAGAAGATAGGAAGATGTGGG - Intergenic
1055170660 9:73254272-73254294 CTCAGAAGACAGGAAGATGAAGG + Intergenic
1055174518 9:73300459-73300481 CTCAGAAGACAGAAAAATGTGGG - Intergenic
1055225584 9:73990648-73990670 CTCAGAAGATAGGAAAATGTAGG - Intergenic
1055264027 9:74475176-74475198 CTCAGAAGACAGGAAAATGTGGG + Intergenic
1055342004 9:75293761-75293783 CTTAGAAGACAGAAAAATGTGGG - Intergenic
1055413239 9:76053762-76053784 CTCAGAAGACAGGAAAAAGTGGG - Intronic
1055587218 9:77767766-77767788 CTGAGAGGACATAAAGGTGGGGG - Intronic
1055697324 9:78900114-78900136 CTCAGCATACAGAAAGCTTGGGG - Intergenic
1055774541 9:79753285-79753307 CTCAAAAGACAGGAAGATGTGGG - Intergenic
1055810931 9:80146880-80146902 TTCAGAAGGCAGAAGGAAGGGGG + Intergenic
1055858943 9:80725171-80725193 CTTAGAAGACAAGAAGATGTGGG - Intergenic
1055885865 9:81062698-81062720 CTCAGAAGAGAGGAAGATGTGGG + Intergenic
1056064281 9:82917027-82917049 CTCAGAAGACAGGAAAATGTGGG - Intergenic
1056086954 9:83160222-83160244 CTCAGAAGACAGAAAAATGGGGG + Intergenic
1056092125 9:83215825-83215847 CTCAGAAGACAGGAAGATATGGG + Intergenic
1056148850 9:83764612-83764634 TTCAGAAGACAGGAAAATGTGGG + Intronic
1056325425 9:85474588-85474610 CTCAGAAGACAGGAAGATGTGGG + Intergenic
1056979097 9:91291353-91291375 CCTAGAAGATAGAAAGATAGTGG - Intronic
1057239406 9:93395213-93395235 CTCAGAAGACAGGAAGATGAAGG - Intergenic
1057285441 9:93749806-93749828 CTCAGAAGACAGAAATATGTGGG - Intergenic
1057300361 9:93875300-93875322 CTCAGAAGATAGGAAGGTGAGGG - Intergenic
1057325819 9:94062365-94062387 GTCAGAAGACTGGAAGATGAGGG - Intronic
1057400788 9:94721188-94721210 CTCAAAAGTCATAAAGCTGGAGG - Intergenic
1057749322 9:97779003-97779025 CTCAGAAGACAGGAAGATGTGGG + Intergenic
1058065744 9:100546025-100546047 CTCAGAAGTCAGGAAAATGTGGG - Intronic
1058288667 9:103210701-103210723 CGAAGAAGACAGGAAGATGTGGG - Intergenic
1058292316 9:103257601-103257623 CACAGAAAACAGGAAGATGTGGG - Intergenic
1058307828 9:103464798-103464820 CTCAGAAGACAGGAAGATGTGGG - Intergenic
1058582246 9:106470957-106470979 CTCAGAAGACAGGAAGATGTAGG + Intergenic
1058635241 9:107032096-107032118 CTCAGAAGACAGGAAAATGTGGG + Intergenic
1058635250 9:107032150-107032172 CTCAGAAGACAGGAAGATGTGGG + Intergenic
1059069594 9:111121191-111121213 CTCAGAAAGCAGGAAGATGTGGG - Intergenic
1059186975 9:112283276-112283298 CTCAGAAGACAGGAAGATGTGGG + Intronic
1059570180 9:115425897-115425919 CTCAGAAGACAGGAAGATGTGGG - Intergenic
1059601330 9:115782658-115782680 CTCAGAAGATGGGAAGATGTGGG + Intergenic
1059617959 9:115971464-115971486 CTCAGAAAACATAATCATGGTGG + Intergenic
1059843406 9:118243702-118243724 CTCAGAAGACAGGAAGATGTGGG - Intergenic
1060382686 9:123191417-123191439 CCGAGAGGACAGAAAGGTGGGGG + Intronic
1060605309 9:124908880-124908902 CTCAGAAGCCAAAATGATGATGG + Intronic
1061394546 9:130336932-130336954 CTCAGCAGAAAGCAAGGTGGGGG + Intronic
1062617083 9:137402612-137402634 CTCAGAAGACAAGAAGATGTGGG - Intronic
1202782389 9_KI270718v1_random:11278-11300 CTCAGAAGACAGGAATATGTGGG - Intergenic
1203452069 Un_GL000219v1:126939-126961 CTAAGAAGACAGCAAGAGAGGGG + Intergenic
1203370465 Un_KI270442v1:298878-298900 TTCAGAAGACAGAAAAATGAGGG - Intergenic
1186086923 X:6000770-6000792 CTCAGAAGACAGGGAGATGTGGG - Intronic
1186117085 X:6316033-6316055 CTCAGAAAACTGAATGAGGGGGG - Intergenic
1186488670 X:9953931-9953953 CTTAGAAGACAGGAAAATGAGGG - Intergenic
1186954824 X:14670284-14670306 CTCAGAAGACAGGAAAATATAGG - Intronic
1187097442 X:16163042-16163064 CTCAGAAGGCAGGAAGATGTGGG - Intergenic
1187133690 X:16526741-16526763 CTCAGAAGACAGGAAGATGTGGG - Intergenic
1187190680 X:17032016-17032038 CTCAGGAACCAGATAGATGGTGG + Intronic
1187598324 X:20799408-20799430 CTCAGAAGAAAGGAAGATGTGGG + Intergenic
1187667493 X:21629272-21629294 CTCAGAAGACAGGAAAATGTGGG - Intronic
1188105720 X:26144896-26144918 CTCAGAAGACAGGAAGGTGAGGG - Intergenic
1188173973 X:26965028-26965050 CTTAGAAGAGAGTAAAATGGTGG + Intergenic
1188221589 X:27547298-27547320 AGAAGAAGACAGAAAGATGCAGG - Intergenic
1188449473 X:30294296-30294318 CTCAGAAGATAGGAAAATGTGGG + Intergenic
1188457048 X:30379155-30379177 CTCAGAAGACAGAAAGATGTGGG + Intergenic
1188595978 X:31900700-31900722 CTCAGAAGAAAGGAAAATGTGGG + Intronic
1188624231 X:32264559-32264581 GTCAGAAGACAGGAAGATGTGGG + Intronic
1188657525 X:32716659-32716681 CTCAGAAGACAGGAAGATGAGGG + Intronic
1188660342 X:32751217-32751239 CTCAGAAGACAGGAAAATGTGGG + Intronic
1188662449 X:32776258-32776280 AGAAGAAGACAGAAAGATGAGGG - Intronic
1188774044 X:34190392-34190414 CTCAGAAGAAAGGAAGATGTGGG - Intergenic
1188781715 X:34294283-34294305 AGAAGAAGACAGAAAGATGTGGG + Intergenic
1188804593 X:34571201-34571223 CTCAGAAGACAGGAAAATGTGGG - Intergenic
1188857103 X:35209887-35209909 CTCAGAAGACAGGAAAATATGGG - Intergenic
1188873224 X:35399221-35399243 CTCAGAAGACAGGAAGATTTGGG - Intergenic
1188926433 X:36050316-36050338 CTCAGAAGACAGGAAGTTGTAGG + Intronic
1188947607 X:36326435-36326457 CTTAGAAGACAAGAAGATGTGGG + Intronic
1188985474 X:36764929-36764951 CTCAGCAGAAACAAAGGTGGAGG - Intergenic
1189051077 X:37646368-37646390 TTGAGAAGACAGAAACTTGGAGG - Intronic
1189169650 X:38896896-38896918 CTCAGAAGAGCCAAAGATGTGGG - Intergenic
1189603005 X:42647678-42647700 CTCAGAAGACAGGAAGATGTGGG + Intergenic
1189656719 X:43252164-43252186 CTCAGAAGACAGGAAGATGAGGG - Intergenic
1189788625 X:44582651-44582673 CACAGAAGACAGGAAGATGTGGG + Intergenic
1189815684 X:44822371-44822393 CTCAGAAGACAGGAAGATGTGGG + Intergenic
1189977705 X:46478961-46478983 CTCAGAAGACAGGAAGATGTGGG + Intronic
1190514201 X:51206312-51206334 CTCAGAAGATAGGAAAATGTGGG + Intergenic
1190531910 X:51386868-51386890 TTCAGAAGACAGGAAGATGTAGG - Intergenic
1190950524 X:55139021-55139043 GAGAGAAGACAGAAAGATGTGGG + Intronic
1190974437 X:55385859-55385881 CTCAGAAGACAGGAAGATGTGGG + Intergenic
1191188497 X:57639500-57639522 CTCAGAAGACTGAAAGATTTGGG + Intergenic
1191211161 X:57886218-57886240 AGAAGAAGACAGAAAGATGAGGG - Intergenic
1191211544 X:57890134-57890156 CTCAGAAGACAGAAAGATGTGGG - Intergenic
1191688106 X:63913358-63913380 CTCAGAAGACAGGAAGGTGTGGG + Intergenic
1191689676 X:63926920-63926942 AGAAGAAGACAGAAAGATGTGGG + Intergenic
1191722567 X:64246582-64246604 CTAAGAAAACAGAAAGAAGTAGG - Intergenic
1192008440 X:67241984-67242006 CTCAAAAGACAGAAAAGTGTAGG + Intergenic
1192103613 X:68291664-68291686 TTCAGAACACAGAAGGATGTGGG - Intronic
1192228026 X:69242704-69242726 ATCAACAGACACAAAGATGGGGG - Intergenic
1192245413 X:69367792-69367814 CTGAGAAAACAGACAGAAGGGGG - Intergenic
1192334876 X:70210132-70210154 CTCAGAAGACAGGAAGATGTGGG + Intergenic
1192676664 X:73203649-73203671 AGAAGAAGACAGAAAGATGTGGG - Intergenic
1192742348 X:73905443-73905465 CTCAGTAAACAGAAAGAAGCGGG + Intergenic
1193008045 X:76643280-76643302 CTCAGAAGACAGAAAGATGTGGG + Intergenic
1193025234 X:76839703-76839725 CTCAGAAGACAGGAAGATGTGGG - Intergenic
1193027161 X:76856722-76856744 CTCAGAAGACAGGAAGGTGTGGG - Intergenic
1193029206 X:76879831-76879853 CTCAAAAGACTGGAAGATGTGGG - Intergenic
1193043223 X:77025342-77025364 CTCAGAAGACAGGAAGATGTGGG - Intergenic
1193066297 X:77264095-77264117 CAAAGAAGACAGGAAGATGTGGG + Intergenic
1193198881 X:78665057-78665079 CTCAGAAGACAGGAAGATTTGGG + Intergenic
1193250292 X:79282547-79282569 CTCAGAAGATAGGAAGATATGGG - Intergenic
1193256402 X:79354215-79354237 CTCAGAAGATAGGAAGATGTGGG + Intergenic
1193501172 X:82276549-82276571 AGGAGAAGACAGAAAGATGTGGG - Intergenic
1193506366 X:82349194-82349216 CTCAGAAGACAGGAAGATGTGGG - Intergenic
1193519691 X:82513112-82513134 CTCAGAAGACAGAAAAATGTGGG - Intergenic
1193541933 X:82782711-82782733 CTCAGAAGACAGAGAGATGTGGG - Intergenic
1193678307 X:84484055-84484077 CTCAGAAGACAGAAAGATGTAGG - Intronic
1193682594 X:84540778-84540800 CTCAGAAGACAGGAAGATGTGGG + Intergenic
1193686146 X:84579402-84579424 CTCAGAAGACAGGAAGATGTGGG + Intergenic
1193724912 X:85026869-85026891 CTCAGAAAATAGGAAGATGAGGG - Intronic
1193814325 X:86086548-86086570 CTCAGAAGACAGGAAAGTGCGGG + Intergenic
1193814333 X:86086602-86086624 CTCCAAAGACAGGAAGATGTGGG + Intergenic
1193816292 X:86108166-86108188 CTCAGAAGCCAGAAAGATGTGGG - Intergenic
1193840782 X:86405566-86405588 CTCAGAAAACAGGAAGATGTGGG - Intronic
1193890881 X:87045105-87045127 CTCAGAAGACAAGAAGATATGGG + Intergenic
1193905088 X:87232573-87232595 CTCAGAAAATGGAAAGATGAGGG - Intergenic
1193919777 X:87410786-87410808 CTCAGAAAACAGAAAGATGAGGG - Intergenic
1194014272 X:88599929-88599951 CTCAGAAGATAGGAAGATGTGGG - Intergenic
1194049725 X:89053920-89053942 CTCAGAAGACAGGAAGAAGTGGG - Intergenic
1194054770 X:89117913-89117935 CTCAGAAGACAGAAAGATGTGGG - Intergenic
1194082991 X:89490772-89490794 TTCAGAAGACAAGAAGATGTGGG - Intergenic
1194084267 X:89506432-89506454 CTTAGAAGACAGAAAGATGTGGG - Intergenic
1194092944 X:89600837-89600859 CTCAGAAGACAGGACGATGTGGG - Intergenic
1194185230 X:90766808-90766830 CTCAGAAGAGAGAAAAATGTGGG - Intergenic
1194219723 X:91175940-91175962 ATCAGAAGACAGGAAGATGTGGG + Intergenic
1194235912 X:91382855-91382877 CTCAGAAGAAATGAAGATGAGGG + Intergenic
1194254059 X:91614397-91614419 CTCAGAAGGCAGAAAGATGTGGG - Intergenic
1194264444 X:91737832-91737854 CTCAGAAGACGGGAAAATGTGGG + Intergenic
1194332386 X:92599765-92599787 CTCAGAAGACAGGAAGATGTGGG + Intronic
1194352787 X:92840950-92840972 AGAAGAAGACAGAAAGATGTGGG - Intergenic
1194471775 X:94305661-94305683 CTCAGAAGACAGGAACATGAGGG - Intergenic
1194506971 X:94745226-94745248 CTCAGAAGACCGGAAGATGTGGG + Intergenic
1194548615 X:95269574-95269596 CTCAGAAGACAGGAAGATGTGGG - Intergenic
1194566328 X:95493675-95493697 CTCAGAAGACAGGGAAATGTGGG + Intergenic
1194573151 X:95577173-95577195 CTCAGAAAATAAAAAGATGGAGG - Intergenic
1194817966 X:98468346-98468368 CTCAGTAGACAAAAAGATGAAGG - Intergenic
1194843515 X:98775334-98775356 AGAAGAAGACAGAAAAATGGGGG + Intergenic
1194850127 X:98859214-98859236 CTCAGAAGACAGAAAGATGTGGG + Intergenic
1194860436 X:98991978-98992000 TTCAGAAGATAGAAAGATATGGG - Intergenic
1194881269 X:99254491-99254513 AGAAGAAGACAGAAAGATGAGGG - Intergenic
1195514693 X:105760394-105760416 TTCAGAAGAGAGAAAGAAAGAGG + Intronic
1195608452 X:106835928-106835950 AGAAGAAGACAGAAAGATGTGGG - Intronic
1195650491 X:107278369-107278391 TTCAGAAGACAGAAAGATGAGGG + Intergenic
1195685139 X:107578491-107578513 CTCAGAAGTCAGGAAGGTGGTGG - Intronic
1195838747 X:109149372-109149394 CTCAGAGGACAGGAAGATGTAGG + Intergenic
1196022114 X:111001273-111001295 CACAGATGACAGAAACATGAAGG + Intronic
1196367027 X:114934825-114934847 ATCAGAAGACAAGAAGATGAAGG - Intergenic
1196512920 X:116533212-116533234 ATCAGAAGAGAGAAAGATGTGGG - Intergenic
1196543721 X:116938372-116938394 CTCAGAAGACAGGAAGATGTGGG - Intergenic
1196554816 X:117074115-117074137 CTCAGAAGACAGGAAGATGTGGG - Intergenic
1196558736 X:117121786-117121808 CTCAGAAGACAGGAAAATTTGGG - Intergenic
1196565128 X:117196186-117196208 CTCAGAAGACAGGAAGATGTGGG + Intergenic
1196605742 X:117655272-117655294 CTCAGAAGACAGGAAGATGTGGG - Intergenic
1196881162 X:120199266-120199288 TCCAGTAGACAGAAAGAGGGGGG - Intergenic
1196930509 X:120676814-120676836 CTCAGAAGACAGGAAGATGTGGG - Intergenic
1197057006 X:122133991-122134013 CTCAGAAGACAGGAAGATGTGGG + Intergenic
1197058835 X:122153173-122153195 CTCAGAAGTCAGGAAGATGTGGG + Intergenic
1197061400 X:122185465-122185487 CTCAGCAGACAGAAAGATGTGGG - Intergenic
1197100270 X:122645062-122645084 TGCACATGACAGAAAGATGGTGG - Intergenic
1197103938 X:122690614-122690636 CTCAGAAAATAGAAATATAGAGG + Intergenic
1197128165 X:122972280-122972302 CTCAGAAGACAGGAATATGTTGG + Intergenic
1197426543 X:126304344-126304366 CTCAGAAAACAGGAAGATATGGG + Intergenic
1197451961 X:126629965-126629987 CTCAGATGACAGAAAGATGTGGG - Intergenic
1197451967 X:126630018-126630040 CTCAGAAGAGAGGAAAATGTGGG - Intergenic
1197561328 X:128025419-128025441 CAAAGAAGACAGAAAAATGTGGG - Intergenic
1197583306 X:128311604-128311626 CTCAGAAGACAGGAAGATGTGGG - Intergenic
1197594537 X:128450236-128450258 CTCAGAAAACAGGAAGATGTGGG - Intergenic
1197600479 X:128521059-128521081 CTCAGAATAGAGAGAGAGGGAGG + Intergenic
1197740470 X:129888623-129888645 CTCAGGAAACAGAATCATGGTGG - Intergenic
1198304750 X:135369327-135369349 CTCAGAAGACAGGGAGATGAGGG - Intergenic
1198453488 X:136792115-136792137 CTGTGAAGACAGACAGATTGTGG - Intergenic
1198568909 X:137934516-137934538 CTCAGAAGACAGGAAAATGTGGG + Intergenic
1198872724 X:141193203-141193225 CTCAGAAGACAGGAAGATGTGGG + Intergenic
1198880399 X:141274546-141274568 CTCAGAAGACAGGAATATGTGGG - Intergenic
1198888282 X:141362938-141362960 CTCAGAAGACAGGAAAATGTGGG - Intergenic
1198941814 X:141964691-141964713 TTCGGAAGACAGGAAGATGTGGG - Intergenic
1198948471 X:142041632-142041654 ATCAGAAGACAGGAAAATGAGGG - Intergenic
1198966810 X:142236458-142236480 CTCAGAAGACAGGAAGATGTGGG + Intergenic
1199002950 X:142662232-142662254 CTCAGAAGACAGGAAGATGTAGG + Intergenic
1199027985 X:142961876-142961898 CTCAGAAGACAGGAAGAAACAGG - Intergenic
1199041546 X:143120313-143120335 AGAAGAAGACAGAAAGATGTGGG - Intergenic
1199062676 X:143377196-143377218 CTCAGAAGACAGGAAGATGTGGG - Intergenic
1199083616 X:143605175-143605197 CTTGGAAGACAGGAAGATGTGGG + Intergenic
1199117489 X:144009460-144009482 CTCAGTAGATAGAAAGATGTGGG - Intergenic
1199155125 X:144537557-144537579 CTCAGAAGACAGAAAGATGTGGG - Intergenic
1199185563 X:144911344-144911366 CTCAGAAGACAGGAAGATGTGGG - Intergenic
1199191959 X:144981179-144981201 CTCAGAAGACAGGAAGATGTGGG + Intergenic
1199203945 X:145125243-145125265 CTTAGAAGACAGGAAGATATGGG - Intergenic
1199228582 X:145408949-145408971 CTATGAAGACAGGAAGATGTGGG + Intergenic
1199240871 X:145546000-145546022 CTCAGAAGACAGGAAAATGTGGG - Intergenic
1199258995 X:145748902-145748924 CACAGAAGACAAGAAGATGTGGG - Intergenic
1199269440 X:145865460-145865482 CTGGGAAGAGAGAAAGAGGGAGG + Intergenic
1199278007 X:145969228-145969250 CTCAGAAGAAAGGAAAATGTGGG + Intergenic
1199289412 X:146089569-146089591 GTAAGAAGACAGGAAGATGAGGG + Intergenic
1199301815 X:146221847-146221869 CTCAGAAGTCAGAAAGATGTGGG - Intergenic
1199306103 X:146269202-146269224 CTCAGAAGACAAAAGGATGTGGG + Intergenic
1199330386 X:146551764-146551786 AAAAGAAGACAGAAAGATGAGGG - Intergenic
1199337893 X:146641505-146641527 CTCAGAAGACAGGAAGATGTGGG + Intergenic
1199357076 X:146875099-146875121 CTCAGAAGACAGAAAGATGTGGG + Intergenic
1199423545 X:147675462-147675484 CTCAGAAGACAGGAAGATGAAGG + Intergenic
1199580686 X:149357259-149357281 TTCAGAAGACAGGAAGATGTGGG + Intergenic
1199619324 X:149685372-149685394 CTCAGAAGTCAGGAAAATGTGGG + Intergenic
1199619329 X:149685426-149685448 CTCAGGAGACAGGAAGATGTAGG + Intergenic
1199639147 X:149842879-149842901 CTCAGAAGAAGAAAAGATGAGGG - Intergenic
1199909505 X:152270916-152270938 CTGAGAAGACAGGAACATGTGGG + Intronic
1199928152 X:152491194-152491216 CTCAGAAGACAGGAAGATGTGGG + Intergenic
1199929874 X:152507220-152507242 CTCAGAAGACAGGAAGATGTGGG - Intergenic
1200386232 X:155893632-155893654 CTGAGAACACAGCAAGAAGGTGG - Intronic
1200435643 Y:3146646-3146668 TTCAGAAGACAGGAAGATGTGGG - Intergenic
1200436906 Y:3162319-3162341 CTTAGAAGACAGAAAGATGTGGG - Intergenic
1200445582 Y:3256940-3256962 CTCAGAAGACAGGACGATGTGGG - Intergenic
1200531853 Y:4348895-4348917 CTCAGAATAGAGAAAAATGTGGG - Intergenic
1200556234 Y:4639704-4639726 ATCAGAAGACAGGAAGATGTGGG + Intergenic
1200572847 Y:4853974-4853996 CTCAGAAGGCAGAAAGATGTGGG - Intergenic
1200641092 Y:5718816-5718838 CTCAGAAGACAGGAAGATGTGGG + Intronic
1200661091 Y:5957692-5957714 AGAAGAAGACAGAAAGATGTGGG - Intergenic
1201067845 Y:10116204-10116226 TTCAGAAGACAGAAAAATGATGG + Intergenic
1201300177 Y:12498450-12498472 AGCAGAAGAAAGAAAGATGGAGG - Intergenic