ID: 1087571331

View in Genome Browser
Species Human (GRCh38)
Location 11:99930353-99930375
Sequence ACATCCAGGCATACACAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 174}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087571331_1087571335 6 Left 1087571331 11:99930353-99930375 CCTTACTGTGTATGCCTGGATGT 0: 1
1: 0
2: 0
3: 7
4: 174
Right 1087571335 11:99930382-99930404 TCAATTCCTAGGATCTTACTGGG 0: 1
1: 0
2: 3
3: 18
4: 167
1087571331_1087571334 5 Left 1087571331 11:99930353-99930375 CCTTACTGTGTATGCCTGGATGT 0: 1
1: 0
2: 0
3: 7
4: 174
Right 1087571334 11:99930381-99930403 TTCAATTCCTAGGATCTTACTGG 0: 1
1: 0
2: 0
3: 11
4: 128
1087571331_1087571337 30 Left 1087571331 11:99930353-99930375 CCTTACTGTGTATGCCTGGATGT 0: 1
1: 0
2: 0
3: 7
4: 174
Right 1087571337 11:99930406-99930428 GTTTGTTGCCCAAAAGCTCAAGG 0: 1
1: 0
2: 2
3: 14
4: 119
1087571331_1087571333 -5 Left 1087571331 11:99930353-99930375 CCTTACTGTGTATGCCTGGATGT 0: 1
1: 0
2: 0
3: 7
4: 174
Right 1087571333 11:99930371-99930393 GATGTGTTTGTTCAATTCCTAGG 0: 1
1: 0
2: 1
3: 106
4: 435

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087571331 Original CRISPR ACATCCAGGCATACACAGTA AGG (reversed) Intronic
900593537 1:3470227-3470249 ACACCCATGCATACACACCAGGG - Intronic
900593644 1:3470785-3470807 ACACCCATGCATACACACCAGGG - Intronic
905014102 1:34765294-34765316 ACATCCAGGCATCCAGAAAAAGG + Intronic
908601323 1:65743492-65743514 ATACCCAGGCAAACAGAGTATGG - Intergenic
910713368 1:90204427-90204449 ACACCCATACAGACACAGTAAGG + Intergenic
914811120 1:151028976-151028998 ACATACAGGCAGACTCTGTAAGG - Intronic
916430361 1:164722093-164722115 ACAGCCAGGCATAGACAGACAGG - Intronic
916714583 1:167438532-167438554 ACATGCAGGAACACACAGGAAGG + Intronic
919333076 1:196195791-196195813 ACATACACACATACACAGAACGG - Intergenic
923031203 1:230250237-230250259 ACATCCAGGCAGGGACAGTGGGG + Intronic
923540745 1:234886333-234886355 ACATCCAAGAAGACACAGGAAGG - Intergenic
1066196423 10:33104678-33104700 ACATACATGCATGCACAGTTCGG - Intergenic
1067955592 10:50787706-50787728 ACACCCAGGCAAACACGGTCTGG - Intronic
1069813027 10:71176370-71176392 ACAGCCAGGAAGACACACTATGG + Intergenic
1069832236 10:71288457-71288479 ACATGCATGCATACACACCATGG - Intronic
1072433273 10:95392635-95392657 GCATAGAGGCATAAACAGTAAGG - Intronic
1072872392 10:99133583-99133605 ATACCCAGGCAAACACAGTCAGG + Intronic
1073168602 10:101481498-101481520 AGATCCTGGCTTACAAAGTATGG - Intronic
1074751270 10:116589611-116589633 ACTTCCAGGCATCCCCAGGATGG - Intergenic
1075596809 10:123737800-123737822 ATATCAAGCCATACAAAGTAGGG - Intronic
1075615439 10:123887648-123887670 ACATCCTGCAATACACAGGAAGG + Intronic
1075652727 10:124139846-124139868 CCACCCAGGGATATACAGTAGGG + Intergenic
1076623298 10:131806694-131806716 ACATATTGGCATCCACAGTAAGG - Intergenic
1078008259 11:7548731-7548753 ACCTCCAAGGATACACAGTCCGG - Intronic
1078420844 11:11211324-11211346 ACATGCAGGCACCCGCAGTATGG - Intergenic
1078814017 11:14801429-14801451 ACATCCAGGCAAACAGGGTCTGG - Intronic
1079869366 11:25777783-25777805 ACTTCCAGGCTTACCCAGTTGGG - Intergenic
1081220819 11:40459028-40459050 ACATACATGCATACACATGAGGG + Intronic
1083094216 11:60233180-60233202 ACATCCAGCCTTACACAGCCTGG + Intronic
1083099561 11:60288691-60288713 ACATCCAGCCTTACACAGCCTGG - Intronic
1084524181 11:69685733-69685755 AGGTCCAGGCACACACAGTAGGG + Intergenic
1085621328 11:78040050-78040072 CCATCCAGGCACACAGAGTGTGG + Intronic
1085837255 11:79970406-79970428 TCATCCACGGATAGACAGTAGGG + Intergenic
1087571318 11:99930237-99930259 ATATTCAGGCATATGCAGTAAGG - Intronic
1087571331 11:99930353-99930375 ACATCCAGGCATACACAGTAAGG - Intronic
1089247440 11:117132509-117132531 ACATCCACACAAACACAGAAAGG + Intergenic
1089356933 11:117860115-117860137 ACAGCCAGGCAGACAGAGCAGGG - Intronic
1089507889 11:118976623-118976645 ACATCCAGGAGCAGACAGTAAGG + Intronic
1093827026 12:23705493-23705515 ACACACACACATACACAGTAAGG + Intronic
1095073900 12:37893262-37893284 ATACCCAGGCATACAAAGTCTGG + Intergenic
1096162710 12:49393372-49393394 ACATTAAGGCATACAAAATAGGG + Intronic
1098697154 12:73573259-73573281 ATATCCAGGCAAACACGGTCTGG + Intergenic
1098855405 12:75647083-75647105 ACATCCATGGATTCACAATATGG + Intergenic
1099855912 12:88166390-88166412 ACAACCAAGCATTCACAGGAAGG - Exonic
1101336685 12:103802918-103802940 CCATCCAGGCATTCAGAGGAGGG + Intronic
1102441620 12:112967992-112968014 GCTCCCAGGCATACACAGTCAGG - Exonic
1103933292 12:124461878-124461900 ACATCCATGCATACACACGTGGG - Intronic
1104819381 12:131665998-131666020 ACACACAGGCAGACACAGTCAGG - Intergenic
1105236243 13:18555968-18555990 TAATCCAGGCATACAAAGTCAGG - Intergenic
1105354757 13:19649640-19649662 ACATCCAGCTATAGACAGTCTGG + Intronic
1110011993 13:70348134-70348156 AGATCCAGGCATATATAGTAGGG - Intergenic
1112249282 13:97764419-97764441 ACATCCCTGAATACACAATAGGG + Intergenic
1115278904 14:31639349-31639371 ATATCCAGGCAAACAGAGTCTGG - Intronic
1115527675 14:34297936-34297958 ATGTCCAGGCATGCACAGAAAGG + Intronic
1116224640 14:42133940-42133962 TCATCCATGAATGCACAGTAAGG + Intergenic
1118864536 14:69692665-69692687 AGTCCCAGGCATACACAGCAGGG - Intronic
1119453426 14:74732903-74732925 ACATCTAGGAATATACATTATGG + Intronic
1123814840 15:23966560-23966582 ACCTCCAGGGATACACAATCTGG - Intergenic
1124233955 15:27970764-27970786 ACATCCCAGCATGCACAGTATGG + Intronic
1124233982 15:27970921-27970943 ACGTCCCAGCATGCACAGTACGG + Intronic
1126844018 15:52742570-52742592 ACATCCAGCCTAAAACAGTAAGG - Intergenic
1128145639 15:65331099-65331121 ACATCAAGGCCTACACACCAAGG - Exonic
1128921872 15:71618304-71618326 ACTTCCAGGTATACACTTTAGGG + Intronic
1129944054 15:79524013-79524035 ACATTTAGGCATACAGAGTGTGG - Intergenic
1131232205 15:90667417-90667439 ACATGCATCCATACAGAGTATGG - Intergenic
1134632683 16:15768240-15768262 ACCACCAGGGATACACAGGATGG + Intronic
1135160780 16:20094223-20094245 ACACCCTGAAATACACAGTAGGG + Intergenic
1135752093 16:25066195-25066217 ACAGCCAGGCAGACACTGTTTGG + Intergenic
1136159967 16:28413608-28413630 CCATCCTGCCATGCACAGTATGG - Intergenic
1136203121 16:28701684-28701706 CCATCCTGCCATGCACAGTATGG + Intronic
1142309560 16:89304616-89304638 ACATACAGGCACACACATGAGGG + Intronic
1142309567 16:89304680-89304702 ACACACAGGCATACACACTTGGG + Intronic
1143583777 17:7841437-7841459 ACATGAAGGCAAACACAGAAGGG + Intronic
1150555700 17:66252341-66252363 TCATCCAAGCATACATATTAGGG + Intronic
1151206675 17:72513095-72513117 ACCTCCAGGTAGGCACAGTAGGG - Intergenic
1151274278 17:73022255-73022277 ACTTGCAGGCATCCACAGAATGG + Intronic
1151325779 17:73379171-73379193 ACATCCAGGGGTACAAGGTAGGG - Exonic
1203167441 17_GL000205v2_random:110755-110777 GCCTCCAAGCATACACAGTGGGG + Intergenic
1153402445 18:4695523-4695545 ACATCCAGGCAAACAGGGTCTGG + Intergenic
1154513295 18:15134030-15134052 TAATCCAGGCATACAAAGTCAGG + Intergenic
1155294715 18:24374549-24374571 ACATCAAAGCAGACTCAGTAAGG + Intronic
1158536210 18:58310284-58310306 CCATTCAGTTATACACAGTAAGG - Intronic
1158865173 18:61631713-61631735 ACATCCAGGCAAATACATTGAGG - Intergenic
1164416448 19:28049984-28050006 ACACCCAGGCTTGCACAATAAGG + Intergenic
1166156284 19:40913532-40913554 ATATCCAGGCAAACAGAGTCTGG + Intergenic
925357992 2:3256039-3256061 ACAGCCAGTCTTGCACAGTAAGG - Intronic
930216920 2:48707190-48707212 ATATCCAGGCAAACAGAGTCCGG - Intronic
932188498 2:69718886-69718908 ACACACATGCATACACAGCATGG + Intronic
938381752 2:130840155-130840177 ACACACAGGCATACACACTTGGG + Intronic
938513543 2:131978641-131978663 TAATCCAGGCATACAAAGTCAGG + Intergenic
939780070 2:146435146-146435168 ACATCCAGGGACACAAAGTGTGG + Intergenic
939866051 2:147473628-147473650 AGATGCAGGCATATATAGTAAGG - Intergenic
940492866 2:154387364-154387386 ACATACAGACACAAACAGTATGG + Intronic
941354198 2:164468553-164468575 ACACACAGACATACACAGGAGGG + Intergenic
942754394 2:179322326-179322348 ACCTCCAGTAATTCACAGTATGG - Intergenic
945143214 2:206709479-206709501 ACATACAAGCAAACACGGTATGG + Intronic
945906801 2:215603322-215603344 ACATCCAGGCACACACATCTTGG + Intergenic
946611281 2:221460744-221460766 ATAGGCAGGCACACACAGTAGGG - Intronic
1169756182 20:9045683-9045705 ACATCAAGGCAAACAGACTAAGG - Intergenic
1172056212 20:32155846-32155868 ACGTCCAGGCTTACAGAGGAGGG + Intronic
1172357912 20:34292493-34292515 CCTTCCAGGCATACACTGGAGGG + Exonic
1172372857 20:34408784-34408806 ACTTCCAAGCTTACACTGTAAGG - Exonic
1172777915 20:37417895-37417917 ACAGTCAGACACACACAGTAGGG - Intergenic
1174130520 20:48340755-48340777 AGATCCAGGCCTGCACAGGACGG + Intergenic
1176780239 21:13184253-13184275 TAATCCAGGCATACAAAGTCAGG - Intergenic
1177641575 21:23850276-23850298 ACACACAGGCACACACATTAAGG - Intergenic
1177977904 21:27873275-27873297 TAATCCAGGCATACAAAGTCAGG - Intergenic
1181064206 22:20298106-20298128 ACACACAGACATACACAGTCGGG - Intergenic
1183189296 22:36311478-36311500 ACATCCTAGCATGCACAGGAGGG + Intronic
1183702108 22:39456856-39456878 CCGTCCACGCATACACAGAACGG + Intergenic
1184398026 22:44256416-44256438 ACATGAAGGCACACACTGTAGGG - Intronic
951372673 3:21870262-21870284 ACATCCAGGCATTCAAGGCAGGG + Intronic
951833712 3:26958970-26958992 ATATCCAGGCAAACAGAGTCTGG - Intergenic
953219748 3:40959138-40959160 ACATCCAGGCAAACAGGGTCTGG - Intergenic
955093676 3:55776065-55776087 ATATGCAGGCCTTCACAGTAGGG - Intronic
955383555 3:58460685-58460707 ACATACTAACATACACAGTATGG - Intergenic
955635765 3:61027902-61027924 ACATGCAAGCATGCACATTAGGG + Intronic
956591171 3:70916423-70916445 ACATCCAAGGAAACACTGTAAGG + Intergenic
957811501 3:85228614-85228636 ATACCCAGGCAAACACAGTGTGG - Intronic
960054735 3:113269081-113269103 GCCTCCAGGCACACACAGGAAGG + Intronic
962208044 3:133451579-133451601 ACTTCCTGGTATATACAGTAGGG + Intronic
962357443 3:134706884-134706906 ACATGCAGAGATACACAGAAGGG - Intronic
969671804 4:8593810-8593832 AAATCCAGGCATCAACAGGACGG - Intronic
972255784 4:37354139-37354161 ACACCCAGGCAAACAGAGTCTGG - Intronic
975078751 4:70248597-70248619 ACATGCAGACACACACAGAATGG - Intronic
976263770 4:83171180-83171202 ATGTCCAGGCATGCCCAGTAAGG - Intergenic
976682246 4:87769944-87769966 ATACCCAGGCAAACACAGTCTGG + Intergenic
977638821 4:99331695-99331717 ACATACATACATACAAAGTAGGG + Intergenic
978788972 4:112641058-112641080 AGATCCAGTCAACCACAGTAAGG + Intronic
980513403 4:133823032-133823054 ACATCCAGGCAAACAGGGTCTGG - Intergenic
980693575 4:136328155-136328177 ACATACAGGGATCCTCAGTAAGG - Intergenic
981209600 4:142087085-142087107 ACATCCTGTAATGCACAGTATGG - Intronic
981479949 4:145228373-145228395 ACACCCAGGCAAACAGAGTCTGG - Intergenic
981511453 4:145562957-145562979 ACAGCCAAGCATACACATAAGGG + Intergenic
984018328 4:174453006-174453028 ACATCCAGACACATACAGTTTGG + Intergenic
986359366 5:6961342-6961364 ACATACAGACATACACAGCATGG + Intergenic
986648055 5:9937771-9937793 ATATCCAGGCAAACAGAGTCTGG + Intergenic
988367377 5:30318054-30318076 TTGTCCAGGCATGCACAGTAAGG - Intergenic
988367386 5:30318112-30318134 ATACCCAGGCATGCAAAGTAAGG - Intergenic
988541856 5:32117427-32117449 GCATCCAGGCAAAAACAGCAAGG + Intergenic
992291273 5:75282537-75282559 GCATCCAGGGGCACACAGTATGG - Intergenic
992348077 5:75901352-75901374 ATACCCAGGCAAACACAGTCTGG - Intergenic
994405888 5:99344883-99344905 ATACCCAGGCAAACACAGTCTGG - Intergenic
995028591 5:107452856-107452878 ACAGACATGCATACACAGAAAGG + Intronic
995356935 5:111248980-111249002 ACATCCATGCAAACAGATTAAGG - Intronic
999241333 5:150129575-150129597 ACATTCTGGCAAACACAATATGG - Intronic
1000444610 5:161304467-161304489 ACAGCAAGGCCTACACAGTGTGG - Intronic
1000860329 5:166449824-166449846 ACACCCAGGCAAACACGGTCTGG - Intergenic
1003231426 6:4257198-4257220 GTATCCAGGCATAGAGAGTAAGG + Intergenic
1003400536 6:5786909-5786931 ACATCCCAGCTTACACCGTAAGG + Intergenic
1003748174 6:9025235-9025257 AGTTCCAGGCTTCCACAGTATGG - Intergenic
1004323929 6:14656229-14656251 ACATTCAGGAAGACACAGGATGG + Intergenic
1005392852 6:25350772-25350794 ACATCCAGGGAGAGCCAGTAGGG - Intronic
1007213385 6:40216461-40216483 ACATCAAGGCATACACAAAAGGG + Intergenic
1008294468 6:49758156-49758178 ACATCCAGGTACACTCATTAGGG - Intergenic
1013606532 6:111754314-111754336 AACTCCCGGCATGCACAGTAGGG + Intronic
1015697795 6:136001074-136001096 ATATCCAGGCAAACAGAGTCTGG + Intronic
1017471904 6:154746490-154746512 AATTCCAGTCAAACACAGTAGGG + Intronic
1017892946 6:158654400-158654422 GCATCCAGACAAACACAGTTTGG - Intronic
1019560489 7:1653839-1653861 ACATGCAGGCACACACACAAGGG + Intergenic
1023996114 7:45159874-45159896 ACACACAGGCACACACACTATGG - Intronic
1029341072 7:99945203-99945225 AAATCCAGGCATGAACAGGAAGG - Intergenic
1029850481 7:103456800-103456822 ATACCCAGGCAAACACAGTCTGG - Intergenic
1032920768 7:136543994-136544016 AAATCCAGTCTTTCACAGTATGG + Intergenic
1038752709 8:30312162-30312184 ACAGCCAGGCAAACAGAGTGGGG - Intergenic
1039215967 8:35271951-35271973 ATATCATGGCAAACACAGTATGG + Intronic
1040099075 8:43480919-43480941 ATATCCAGGCAAACAGAGTCTGG + Intergenic
1042099797 8:65262644-65262666 ACATACATGCATACACACCATGG - Intergenic
1044776544 8:95694824-95694846 ACTTCCAAGCTAACACAGTAAGG + Intergenic
1047401789 8:124554341-124554363 ACATCCCAGAATACACAGCACGG - Intronic
1048161459 8:132025381-132025403 ATGTCCAGGCATGCACAGTAAGG + Intronic
1048538904 8:135324480-135324502 ACTTTCTGGCATACACAGTCTGG - Intergenic
1050352012 9:4749198-4749220 ACATCCAGGCAGAGAAAATAAGG + Intergenic
1054797334 9:69314552-69314574 ACATCCAGGCATTGACACCATGG + Intergenic
1188954499 X:36418159-36418181 ATATCCAGGCAAACAGAGTCTGG - Intergenic
1190138501 X:47819163-47819185 ATGTCCAGGCATGCACAGTAAGG + Intergenic
1190541589 X:51483060-51483082 ACATCCAGGCATAACAAGAAAGG - Intergenic
1196167398 X:112551034-112551056 AAATCCAGGCAAACAGAGTCTGG - Intergenic
1197304796 X:124828745-124828767 AGATACAGGCATATACAGGATGG - Intronic
1197959696 X:131990320-131990342 ATACCCAGGCAAACACAGTCTGG + Intergenic
1198712880 X:139524409-139524431 ACACCCAGGCAAACAGAGTCTGG + Intergenic
1199068983 X:143454245-143454267 ACATCTAGGCATAGATAATACGG - Intergenic