ID: 1087572090

View in Genome Browser
Species Human (GRCh38)
Location 11:99941776-99941798
Sequence TAAGTTGGAAACTAACAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 165}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087572090 Original CRISPR TAAGTTGGAAACTAACAGCA GGG Intronic
903488745 1:23711523-23711545 TAAGGTGGTGATTAACAGCATGG - Intergenic
905509313 1:38505992-38506014 GAAATTGGAAAATAACAACAAGG + Intergenic
906225443 1:44118218-44118240 TAAGATGGAAATTGACAGCAAGG + Intergenic
907849628 1:58243155-58243177 CAAGTTGGAAAGTGACAGGAAGG - Intronic
909505591 1:76386057-76386079 TAAGTTGGGAACTTCTAGCAAGG + Intronic
910002537 1:82357095-82357117 TTAGCTGGACACTATCAGCAGGG + Intergenic
910390613 1:86739347-86739369 TAAAATGGAAACTAAGAGTATGG + Intronic
911690426 1:100826804-100826826 TAAGATGAAAAGTAATAGCAAGG - Intergenic
915016581 1:152739700-152739722 TAAGTTGGAAATCAACAGAGAGG - Intronic
916976401 1:170084751-170084773 TAAGTTGGGAAAAGACAGCAGGG + Intronic
920757685 1:208750073-208750095 TAAGTTGGATCCTTACAGGAGGG - Intergenic
920908205 1:210190740-210190762 TCAGTTGGACACGATCAGCAGGG - Intergenic
921985856 1:221311115-221311137 TAACTTTCAAAATAACAGCAGGG - Intergenic
922419672 1:225451102-225451124 TGAGGTGGAATCCAACAGCACGG - Intergenic
924385978 1:243498254-243498276 TCAGTGGGATACTGACAGCACGG - Intronic
1063051703 10:2456677-2456699 TAAGTTGGAAAGAAACAGTTGGG - Intergenic
1063436827 10:6039111-6039133 AAAGTTTGAAACTAAAAGAATGG + Intronic
1065488713 10:26259643-26259665 TAAGAAGGAAACTCACAGAATGG - Intronic
1066437018 10:35404748-35404770 TTAGTTGGACACAATCAGCAGGG + Intronic
1073840529 10:107494179-107494201 TAAGGTGGCAACTTCCAGCATGG - Intergenic
1074936113 10:118182936-118182958 TAAATTGGAATCTTAAAGCATGG - Intergenic
1075076063 10:119351197-119351219 TAAGTTGGAAAAAGACAGGAGGG + Intronic
1078038994 11:7839919-7839941 TAAGTTGGAAACCACTTGCAGGG - Intergenic
1079560662 11:21814731-21814753 TGGGTTGGAACCTGACAGCAGGG + Intergenic
1079598376 11:22282125-22282147 TAAGTTGATAATTACCAGCATGG + Exonic
1079814677 11:25040511-25040533 TAGATTGGAATCTGACAGCATGG + Intronic
1080417583 11:32083309-32083331 TACACTGGAAACAAACAGCAGGG - Intronic
1081235657 11:40644208-40644230 TAGACTGGAAACTAATAGCATGG + Intronic
1087572090 11:99941776-99941798 TAAGTTGGAAACTAACAGCAGGG + Intronic
1088042949 11:105410715-105410737 TAAGTTGGTGACTAACCCCAAGG + Intergenic
1090318043 11:125814668-125814690 AAAGATGGAAAATAAAAGCATGG - Intergenic
1094234043 12:28142901-28142923 ACAGCTGGAAAATAACAGCAAGG + Intronic
1095378787 12:41564065-41564087 TCAGATGGAAACTTAAAGCAAGG - Intronic
1098718746 12:73867359-73867381 TAAGTGAAAAACTAACAGAATGG + Intergenic
1100765189 12:97856299-97856321 TGAGTTGAAAACAAAGAGCAGGG + Intergenic
1103408945 12:120696892-120696914 TAGGTTAGAAATTAACAGCAGGG + Exonic
1105580995 13:21695965-21695987 TATGTTTTAAAATAACAGCATGG + Intronic
1107798847 13:44084364-44084386 TAAGTTGGAAATTGGCAGCCTGG + Intergenic
1108393835 13:49973993-49974015 TAAGTTTAAAACTAAAAGTATGG - Intergenic
1108605603 13:52035111-52035133 TCAGTTGGAAACTAACACAATGG + Intronic
1108992031 13:56671573-56671595 TAAGTGGGAAAATAATAGGAAGG - Intergenic
1109123679 13:58489902-58489924 AAAGTTGCAAACACACAGCATGG - Intergenic
1111300651 13:86345587-86345609 TAAGGTAGAAAATAAAAGCAAGG - Intergenic
1111590116 13:90335399-90335421 TAAGCTTGAAACTAAGAGCTTGG + Intergenic
1111649379 13:91070364-91070386 GAAGTAGGTAAATAACAGCATGG - Intergenic
1112998751 13:105606620-105606642 TGAGTTGGAGACTAACCCCATGG + Intergenic
1115450357 14:33540722-33540744 TGAGCTGGAAACTAGAAGCAGGG + Intronic
1117957719 14:61135669-61135691 TTAGTTGGACACGATCAGCAGGG + Intergenic
1118946492 14:70392825-70392847 TCAGTTGGAAACCACCAGAAAGG + Intronic
1122667365 14:103340705-103340727 TAATTTGGAAAATAATAGAAAGG + Intronic
1122868276 14:104620289-104620311 GAAGTAGGAAAAAAACAGCAAGG + Intergenic
1128552836 15:68609353-68609375 TAAGATGGTCACTAACAGCCTGG - Intronic
1131000691 15:88937578-88937600 CAAGTTGGCAACCAACAGAAGGG + Intergenic
1131970200 15:97884472-97884494 TAACTTGAAAATTACCAGCATGG + Intergenic
1132370061 15:101290244-101290266 TATGTTAGAATCTCACAGCATGG - Intronic
1138252346 16:55510869-55510891 TATTTTGGAAAGAAACAGCATGG + Intronic
1138850408 16:60622313-60622335 TCAGTTAGAAACAAAGAGCAGGG + Intergenic
1143231510 17:5359480-5359502 TTATTTGTAAACTAACAGAATGG + Intronic
1146010877 17:29193489-29193511 TAAATAGGAAAATAACAACATGG - Intergenic
1148823545 17:50375701-50375723 TAGGCTGGAAGCTGACAGCATGG - Exonic
1149098905 17:52880359-52880381 TTAGGTGGAAACTAACAGAAGGG - Intronic
1155696483 18:28692672-28692694 TAATATGGAAAATAACAGTATGG - Intergenic
1157599409 18:48885013-48885035 GAAGTTAGGAAGTAACAGCAAGG + Intergenic
1160210515 18:76874374-76874396 TAGGTTAGAACCTAACTGCAAGG - Intronic
1162082226 19:8225045-8225067 AAATCTGGAAACTGACAGCATGG + Intronic
1165570821 19:36773212-36773234 TGAGTTCCAAACTAACAGCCAGG - Exonic
929004643 2:37383245-37383267 TCAGTTGGACACAATCAGCATGG + Intergenic
929027210 2:37616122-37616144 AAAGTGGGCAACCAACAGCAAGG - Intergenic
929902778 2:46020148-46020170 TAATTTGAAAACCAACAGCTTGG - Intronic
931010157 2:57902469-57902491 TAAGCTGGAAAATAAAAGGATGG - Intergenic
931464096 2:62471805-62471827 GAAGTTGTCAACAAACAGCAAGG - Intergenic
932705471 2:74021111-74021133 GAAGTAAGAAACCAACAGCAGGG - Intronic
935066597 2:99653661-99653683 TGAGTTGGAAGCTTAGAGCAAGG + Intronic
936260444 2:110955795-110955817 TAACTTGGAAACTTAAAGAAGGG - Intronic
938667562 2:133554355-133554377 TAAGATGGAAACTAAGATCCAGG - Intronic
939353772 2:141074283-141074305 TAAGTTGAAAACTAAAGCCAAGG - Intronic
939927771 2:148194810-148194832 TAAGTAGAAAACAAATAGCAAGG + Intronic
940107544 2:150116069-150116091 TCAGTTGGACACGATCAGCAGGG - Intergenic
940435823 2:153652678-153652700 TTATTTTCAAACTAACAGCAAGG - Intergenic
944179262 2:196869663-196869685 TAAGTTGGAAAATAGCATCATGG - Intronic
945219469 2:207469077-207469099 TCAGATGGAAACCAACAGAAGGG + Intergenic
945338752 2:208624963-208624985 TAAGTTGGATAATAACATCAAGG + Intronic
945885894 2:215375179-215375201 TAAGAAGGAAAATGACAGCATGG + Intronic
946316360 2:218916424-218916446 TAAGTTGGAAACTGAGATCATGG + Intergenic
948046694 2:234951451-234951473 AAAGTTACAAACTAACAACAGGG - Intergenic
948363386 2:237438231-237438253 TGAATGGGAAACTTACAGCAGGG + Intergenic
948915464 2:241032677-241032699 AAAGTTGGAAAATGACAGCTGGG - Intronic
1168928144 20:1599508-1599530 TAAGTAGGAAACTGGGAGCAGGG - Intronic
1170273175 20:14550797-14550819 TTAGGTGGAAACTGAAAGCAAGG + Intronic
1170325293 20:15150074-15150096 TCAGTTGGACACTATCGGCAGGG + Intronic
1170462242 20:16588189-16588211 TATGTGGGAAACTTGCAGCATGG + Intergenic
1178319317 21:31593082-31593104 TAGCTTGGAAAGTGACAGCAGGG - Intergenic
1179862777 21:44199449-44199471 CTAGGTGGAAACTAACAGAAAGG + Intergenic
1182589477 22:31367795-31367817 TCTTTTGGAAACAAACAGCAAGG + Intergenic
1182710832 22:32322256-32322278 TTAGGTGGAAACTTACAACAGGG + Intergenic
951289530 3:20858184-20858206 GAAGTTGGAATCTAAGAACATGG - Intergenic
955540568 3:59971938-59971960 TAACTTGGAAACTAACTGAATGG - Intronic
955903038 3:63777582-63777604 TAATTTTGAAAATGACAGCATGG - Intergenic
957936381 3:86949520-86949542 TAAGTTGCAAAAGAAAAGCAGGG + Intronic
960638259 3:119804853-119804875 TAACTTGGAAGCTAATAGAAAGG - Intronic
962159987 3:132989014-132989036 TTAGTTGATAAATAACAGCAAGG - Intergenic
962400621 3:135056095-135056117 TAACTTGGTAACTGACAGCCTGG - Intronic
962752602 3:138444873-138444895 TAAGTTTGAAAGTCACAGCCTGG - Intronic
964038084 3:152223071-152223093 TAAGTTGGAAACTTATAAGAGGG - Intergenic
964220752 3:154341769-154341791 AAACTTGGAAACAAACAACAAGG + Intronic
965387379 3:168060856-168060878 AAAGGTGGATAATAACAGCAGGG + Intronic
970084082 4:12325647-12325669 TAAGTTGGTTACCAACAGCTTGG + Intergenic
970087734 4:12367230-12367252 TTAGTTGGACACGATCAGCAGGG - Intergenic
971922356 4:32957751-32957773 AAAGCTGGAAAATATCAGCAGGG - Intergenic
973874247 4:55199746-55199768 TAAGTTGGCAACTAAAATTAAGG + Intergenic
975308316 4:72874297-72874319 TAATTTTCAAAGTAACAGCAAGG - Intergenic
975451483 4:74532008-74532030 TAAGTCCGAAATGAACAGCAGGG - Intergenic
976067766 4:81208792-81208814 TCATTTGGAAACAAACAGCCTGG + Intronic
976782178 4:88773323-88773345 TGAGTTGGATACTACCAGTATGG - Intronic
977225144 4:94385716-94385738 TTAGTTGGACACAATCAGCAGGG + Intergenic
978643930 4:110906388-110906410 TAAGTTGGAACCTCACTGCTGGG + Intergenic
981134359 4:141193058-141193080 TAAGAAGAAAACTAAAAGCAGGG - Intronic
982689862 4:158535875-158535897 TGAGTTGGAAAATAACACAAGGG - Intronic
984072917 4:175138839-175138861 TAAGCTGCAAAATAACAGCCTGG - Intergenic
986570397 5:9157947-9157969 TAAGTTAGTAACTAAAACCATGG - Intronic
987639537 5:20594971-20594993 TAAGTAGAAAACTTACAGCATGG - Intergenic
988586138 5:32509152-32509174 TAAATTGGAAACCAAAATCACGG + Intergenic
989124294 5:38036361-38036383 TAAAGTAGAAACAAACAGCAAGG - Intergenic
989819948 5:45784919-45784941 TAAGTTGGCAGCTAGCACCAGGG - Intergenic
992330908 5:75716826-75716848 TAACATGCAAACTAGCAGCAGGG + Intronic
992542775 5:77780821-77780843 CAAATAAGAAACTAACAGCATGG + Intronic
993920853 5:93799398-93799420 AAAGATGGAAACTGACAGAAAGG - Intronic
994683961 5:102925712-102925734 CAAGTTTGAAACTAACAGGGAGG + Intronic
995124975 5:108570720-108570742 TTAGTTGGACACGATCAGCAGGG + Intergenic
996574794 5:124968859-124968881 TTAGTTGGACACGATCAGCAGGG + Intergenic
997133125 5:131297025-131297047 TAAGTTGTAAAATAAAAGTATGG + Intronic
1000296644 5:159917856-159917878 TAAGTTGGGGACTAGCAGCAGGG + Intronic
1003604195 6:7543963-7543985 TAAGTTGGAAAAACAGAGCACGG - Intronic
1004507804 6:16261239-16261261 TTAATTGGACACTATCAGCAGGG + Intronic
1004679694 6:17881146-17881168 TAAGTTGCAAACTAAGAGGAAGG - Intronic
1007500148 6:42290652-42290674 TAAGTGGCAATCTCACAGCAAGG + Intronic
1007609618 6:43141174-43141196 TAATTTGGCAACTCACATCAAGG - Intronic
1008344609 6:50411065-50411087 TAAGGTGGAAAATAAGAGCTTGG + Intergenic
1010808980 6:80276924-80276946 TAATTTGGAAATTAACTGGAAGG + Intronic
1011413269 6:87088332-87088354 TATGTTGGGAGCTAAAAGCAGGG - Intronic
1012252530 6:96994900-96994922 TGAGTTTGAATCTAGCAGCAGGG + Intronic
1015031261 6:128598579-128598601 CCAGTTGGAAACTCTCAGCATGG - Intergenic
1015797786 6:137030422-137030444 TAAGCTGAAAAGCAACAGCAAGG + Intronic
1015801187 6:137063572-137063594 TTAGTTGGACACGATCAGCAGGG + Intergenic
1015949210 6:138534607-138534629 TAAGTTAGAAATAAACAGCAGGG - Intronic
1017100173 6:150842306-150842328 TAAAATAGAAACTAACAGCATGG - Exonic
1017345495 6:153375323-153375345 TATGCAGGAAACAAACAGCAAGG + Intergenic
1017524345 6:155229645-155229667 TAAGTGTGAAACTCACACCAAGG - Intronic
1020756813 7:12212996-12213018 TAAGCAGGAAAATACCAGCAGGG + Intronic
1021088586 7:16453298-16453320 TAACTTATAAAATAACAGCATGG + Intergenic
1021182282 7:17520539-17520561 GAAGTTCCAAACTAGCAGCATGG - Intergenic
1021539985 7:21746810-21746832 TCAGTTGGAATCTAAAACCATGG + Intronic
1028682850 7:93557539-93557561 TAATATGTCAACTAACAGCATGG - Intronic
1029500403 7:100925620-100925642 TCAGTTGGAAACGATCAGCAGGG - Intergenic
1031320057 7:120313640-120313662 TAATTTGGAAACTACCAACAAGG - Intronic
1031587262 7:123547174-123547196 GAAGTTGGAAATCAACATCAGGG - Intronic
1032950206 7:136900415-136900437 TGCGTTGAAAACTAACAGAATGG + Intronic
1035071181 7:156146165-156146187 TAAGTTGGAGAGGAGCAGCAAGG + Intergenic
1038676353 8:29626022-29626044 TAATTTTGAAAATAAGAGCAAGG - Intergenic
1043820382 8:84856113-84856135 AATGTTTGAAAATAACAGCATGG + Intronic
1044220866 8:89668356-89668378 AAAGTTGAAAACAAACAGGATGG + Intergenic
1044693529 8:94901006-94901028 TAAGATGAAAAATAAGAGCAGGG + Intronic
1047856571 8:128917876-128917898 TTAGTTGGACACGATCAGCAGGG - Intergenic
1050171180 9:2818773-2818795 AAAGTTGGAAAATGACAGCAAGG + Intronic
1051474650 9:17492128-17492150 TAAATTGAAAAAAAACAGCAAGG - Intronic
1051610024 9:18952221-18952243 TAAGTTGGAAAACACCAGCATGG - Intronic
1059523448 9:114966044-114966066 TAATTTGTAAACTAAAAGGAGGG + Intergenic
1060089007 9:120726705-120726727 GAAGTTGGAAAGAAACAGAAAGG + Intergenic
1060354170 9:122888592-122888614 TAAGTTAAAAAATAAAAGCAAGG - Intronic
1060616577 9:125021346-125021368 CAAGTAGGAAACAAATAGCAAGG - Intronic
1060737685 9:126076874-126076896 TTAGTTGGACACTATCGGCAGGG + Intergenic
1186454806 X:9702766-9702788 TAACTTGGCAAATAACAGAATGG + Intronic
1186476174 X:9859454-9859476 TAAGCTGGTAACTGTCAGCAGGG + Intronic
1188308775 X:28590644-28590666 ATAGTTGGAAACCAACAGCCTGG - Intronic
1190170364 X:48107562-48107584 AAAGTTAGAAACTGACAGGAAGG + Intergenic
1190194561 X:48305976-48305998 AAAGTTAGAAACTGACAGGAAGG + Intergenic
1190661065 X:52654581-52654603 AAAGTTAGAAACTGACAGGAAGG + Intronic
1193272592 X:79546259-79546281 TAAGATGGAAATTAAGAACAAGG - Intergenic
1195058268 X:101167994-101168016 TTATGTGGAGACTAACAGCATGG + Intergenic
1195473655 X:105260592-105260614 TTGGTTGGAAAATACCAGCAGGG + Intronic
1197116680 X:122842077-122842099 TGAGTTGGAAACTGGGAGCAGGG - Intergenic
1199369446 X:147029457-147029479 CAAATTGGAAACCAACAGAAAGG - Intergenic
1199851019 X:151725029-151725051 TGAGTTGCAAACAAACAGCACGG + Intergenic
1200793602 Y:7320635-7320657 TATGTTGCAAACTAATAGGAGGG + Intergenic