ID: 1087573118

View in Genome Browser
Species Human (GRCh38)
Location 11:99955821-99955843
Sequence GCCCGTACTCCTGGCACTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279351
Summary {0: 1, 1: 10, 2: 1306, 3: 22800, 4: 255234}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087573118 Original CRISPR GCCCGTACTCCTGGCACTTT AGG (reversed) Intronic
Too many off-targets to display for this crispr