ID: 1087573338

View in Genome Browser
Species Human (GRCh38)
Location 11:99959213-99959235
Sequence CATGATCATCAATTTCAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 183}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087573330_1087573338 5 Left 1087573330 11:99959185-99959207 CCTGAAATGTTTACACCCACCAG 0: 1
1: 0
2: 0
3: 7
4: 119
Right 1087573338 11:99959213-99959235 CATGATCATCAATTTCAAGTGGG 0: 1
1: 0
2: 1
3: 22
4: 183
1087573334_1087573338 -10 Left 1087573334 11:99959200-99959222 CCCACCAGGGGTTCATGATCATC 0: 1
1: 0
2: 0
3: 1
4: 76
Right 1087573338 11:99959213-99959235 CATGATCATCAATTTCAAGTGGG 0: 1
1: 0
2: 1
3: 22
4: 183
1087573329_1087573338 25 Left 1087573329 11:99959165-99959187 CCTTGAGATTCTGAAAGCTACCT 0: 1
1: 0
2: 5
3: 20
4: 225
Right 1087573338 11:99959213-99959235 CATGATCATCAATTTCAAGTGGG 0: 1
1: 0
2: 1
3: 22
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087573338 Original CRISPR CATGATCATCAATTTCAAGT GGG Intronic
903406146 1:23098035-23098057 CATTACCAGGAATTTCAAGTGGG - Intronic
908707346 1:66973232-66973254 CATGTTAATCAACTTCTAGTTGG + Intronic
909989025 1:82198932-82198954 CATGAGCATCACTTTCATGGAGG + Intergenic
910179562 1:84466794-84466816 AATTATCATCATTTTCCAGTGGG - Intergenic
912504663 1:110148065-110148087 CATGGCCACCAACTTCAAGTGGG - Intergenic
913346952 1:117818859-117818881 CATGTACATCAAGTTCAAATGGG + Intergenic
915655730 1:157358589-157358611 AATGTTCATCAACATCAAGTGGG + Intergenic
916473377 1:165145212-165145234 CATACTCATCAAATTCACGTTGG - Intergenic
919092133 1:192988738-192988760 CATGATCACGAATCTCAAGTAGG - Intergenic
919899275 1:202032036-202032058 ATTGATCATGAATTTCATGTGGG + Intergenic
921536996 1:216363360-216363382 CATCATCATCATTTTAAAGTTGG + Intronic
922459407 1:225803384-225803406 CATGATCATCAGCATCAAGGAGG + Intergenic
923185977 1:231573748-231573770 CATGACCATGAATTTCTTGTGGG - Intronic
923510204 1:234644659-234644681 CATGCTCTCCAATTTGAAGTGGG + Intergenic
1063633614 10:7758824-7758846 CATGTTCCTCAATGCCAAGTAGG + Intronic
1068528650 10:58159952-58159974 AATTATAATCAATTTCAAGTTGG - Intergenic
1068637070 10:59359822-59359844 ACTGATCATCAATATCAACTGGG - Intronic
1069277720 10:66613211-66613233 CATGGCCATCAAACTCAAGTGGG - Intronic
1070348130 10:75565387-75565409 CAAGAGCAACAATTTCAGGTAGG - Intronic
1072350122 10:94549194-94549216 CATGTTTATTAATCTCAAGTAGG - Intronic
1072838448 10:98742896-98742918 CATTATTATGAATTTCAAGATGG + Intronic
1075615353 10:123886890-123886912 CAGGGTCATCAATTTGAAGATGG + Intronic
1077977615 11:7264295-7264317 CATGATCGCCAACTTCAAGCAGG - Intronic
1078787373 11:14508122-14508144 AATGATCATTAACTTCAAGTAGG + Intronic
1079482007 11:20891050-20891072 CATGATCATCAGCTTCACGAAGG + Intronic
1079560402 11:21813190-21813212 CATGCACATCAAGTTCAAATGGG - Intergenic
1081169892 11:39854314-39854336 GATGATCATTTATTTCATGTTGG - Intergenic
1081381308 11:42419031-42419053 CATGCTCATTAATATCATGTTGG + Intergenic
1081754363 11:45534154-45534176 AATGATCTTTAATTTCAATTTGG + Intergenic
1085065105 11:73488105-73488127 CATGATCACTATTTTCATGTGGG + Intronic
1086077710 11:82872274-82872296 CATGACTTTCAATTTAAAGTAGG - Intronic
1087487859 11:98780769-98780791 CATTATAATAAATTTCATGTAGG - Intergenic
1087573338 11:99959213-99959235 CATGATCATCAATTTCAAGTGGG + Intronic
1088739882 11:112758496-112758518 CATCATCATCATTTCCAATTGGG - Intergenic
1091612881 12:2026140-2026162 AATGATCAACAATTTGAAGAAGG + Intronic
1092837587 12:12505515-12505537 CATGACCACCATTTACAAGTTGG + Intronic
1093202569 12:16207598-16207620 CATGATCACCAACATCAACTGGG + Intronic
1095144866 12:38714102-38714124 CAGAATCATAAATTTCAATTTGG - Intronic
1095426069 12:42075864-42075886 CATGGCCATGAATTTAAAGTAGG + Intergenic
1095722958 12:45421073-45421095 CATGATCATAGCTTTCACGTCGG + Exonic
1096066937 12:48748539-48748561 CATGATCACCAAACTCAAGCGGG + Intergenic
1097533010 12:60829405-60829427 CATGATCAGTAACTTCAATTGGG + Intergenic
1100131604 12:91501006-91501028 AATGATCATAAACTTCTAGTAGG + Intergenic
1100168121 12:91941183-91941205 CATCATCATTATTTTCAATTTGG - Intergenic
1100396310 12:94189057-94189079 CAGGACCATCAACCTCAAGTGGG - Intronic
1102424878 12:112835774-112835796 CATGATCATTAAATTTAAGGAGG - Intronic
1107204321 13:37763541-37763563 CATGACCACTAATTTCAAGTGGG - Intronic
1107782795 13:43922704-43922726 CATGATCTTCATGTTCATGTAGG + Intergenic
1108088047 13:46816771-46816793 GATGATCAATAATTTCTAGTTGG + Intergenic
1108488120 13:50948879-50948901 TATGATTATCAATTTGAAGCAGG - Intronic
1109843617 13:67953505-67953527 AATGATGATGAATTTCAACTTGG + Intergenic
1110011882 13:70346257-70346279 AATCATTATGAATTTCAAGTAGG + Intergenic
1110107617 13:71697386-71697408 CTTTATCATCATTATCAAGTTGG - Intronic
1110383748 13:74884063-74884085 CAAGATCATAAATATCAAGAGGG - Intergenic
1110442267 13:75538782-75538804 CATGATCACCAAATTCAAGGCGG - Intronic
1110642915 13:77847091-77847113 CAAGATCAGCAATTTCATATAGG + Intergenic
1110856996 13:80307865-80307887 CATGAATATTAAGTTCAAGTTGG - Intergenic
1111147819 13:84207463-84207485 TATGATCAGGAATTTAAAGTGGG + Intergenic
1111770944 13:92594782-92594804 CATAATATTCAATTTCAGGTTGG - Intronic
1112622763 13:101068462-101068484 TATGATCATTAATTTCAAAAGGG - Intronic
1112736479 13:102425965-102425987 CATTATCATCACCATCAAGTAGG - Intergenic
1112917386 13:104568392-104568414 CATCAACATCAATTTAAAGCAGG + Intergenic
1115074990 14:29377934-29377956 CTTGATTATAAATTTCATGTTGG - Intergenic
1116266614 14:42699069-42699091 CATGATCCCCAAGTTCCAGTGGG + Intergenic
1117189499 14:53276484-53276506 CATGCACATCAAGTTCAAATGGG + Intergenic
1119011023 14:70989001-70989023 CATGATTATTAATTTGGAGTGGG - Intronic
1121157187 14:91697104-91697126 CATGATCATGAATCTTAAGTGGG - Intronic
1122611711 14:102988445-102988467 TATGAGCATCAATATCAACTTGG - Intronic
1125050850 15:35296676-35296698 TATGATGATAAATTTCAAGCAGG + Intronic
1127398595 15:58563574-58563596 GATCATGATCAAGTTCAAGTGGG + Exonic
1127850189 15:62905232-62905254 CTTCAACATCAGTTTCAAGTTGG + Intergenic
1137350675 16:47711668-47711690 CATGATCACCAATTTCATCCTGG + Intergenic
1138943389 16:61817546-61817568 CATTTTCATGAACTTCAAGTAGG + Exonic
1141192896 16:81837425-81837447 CATGAACATCTATTTCTAGCTGG + Intronic
1141874171 16:86810124-86810146 CCTGGTCATCATCTTCAAGTCGG + Intergenic
1150361477 17:64538687-64538709 CATGATGATGGGTTTCAAGTGGG + Intronic
1150449118 17:65251130-65251152 CTTGATCATCAATTTTCGGTGGG + Intergenic
1151223173 17:72628732-72628754 CCTGATCATCTATTTCAATATGG - Intergenic
1155343791 18:24838773-24838795 CATGGTCATCTCTTTCCAGTTGG + Intergenic
1156621773 18:38860388-38860410 CATGAACATTCTTTTCAAGTGGG + Intergenic
1158480987 18:57821686-57821708 CTTGTTCATCAATTGCAATTTGG + Intergenic
1159263795 18:66052149-66052171 CATGCTCATCAATTACAAAATGG + Intergenic
1159703195 18:71655453-71655475 CATGATCAACAACTCCAAGGAGG + Intergenic
1166113050 19:40634827-40634849 CATCATCATCAATAGCTAGTAGG + Intergenic
929371650 2:41231886-41231908 CATGCTCCTCAATGACAAGTGGG - Intergenic
930094481 2:47556531-47556553 CAGGGTCACCAATTTAAAGTTGG + Intronic
932030234 2:68176472-68176494 CATACTCAGCAATTTCCAGTTGG - Intronic
935688457 2:105708633-105708655 CTTGATTATAAATTTTAAGTGGG + Intergenic
937962514 2:127471448-127471470 CATGAGCAGCAATTCCAAGCTGG - Intronic
939112764 2:138028178-138028200 CATGACCACTAATCTCAAGTGGG + Intergenic
940425731 2:153529696-153529718 CATCATCATCACGATCAAGTGGG + Intergenic
942468645 2:176235803-176235825 CATTATTATGAATTTCAAGATGG + Intergenic
944978575 2:205088190-205088212 CATGATCCTCAGTTTCCATTAGG - Intronic
945558347 2:211306834-211306856 CATGATCAGTAATTCCAAATAGG + Intergenic
947600352 2:231444666-231444688 GATGATCATCATGATCAAGTAGG - Intergenic
1170929219 20:20753779-20753801 CATGATTATGGACTTCAAGTGGG + Intergenic
1174056125 20:47799765-47799787 CAACATCATCAATTGCAGGTAGG - Intergenic
1176961774 21:15166884-15166906 AATGATTATCATTTTAAAGTAGG + Intergenic
1177183154 21:17765471-17765493 CATGATTAAGAATTTCAAGATGG + Intergenic
1177651646 21:23966862-23966884 CATGTACATCAAGTTCAAATGGG + Intergenic
1179629529 21:42667929-42667951 CATCATCATCATTTCCAAGTGGG - Intronic
1184707936 22:46228214-46228236 GATGATTATGAATTTCAAGAAGG - Intronic
949780754 3:7685137-7685159 CATGACGATCCTTTTCAAGTTGG + Intronic
949910782 3:8905696-8905718 CATGATCATAATTCTCAAATGGG + Intronic
950956125 3:17055122-17055144 CATCATCATTACTTTCAAGGAGG + Intronic
954171214 3:48804021-48804043 CATGATTATTAACTTCTAGTAGG - Intronic
957729437 3:84114108-84114130 CATGATCATGGAATTGAAGTAGG + Intergenic
957853201 3:85838333-85838355 CATCATGACCAATTTCAAGTTGG + Intronic
959000809 3:100962067-100962089 CATGGTCACTAATCTCAAGTGGG + Intronic
960503265 3:118463068-118463090 CGTGTTCATCAATTTCAAGCAGG - Intergenic
962818617 3:139024752-139024774 CATGATCACCAACCTCCAGTGGG + Intronic
965797919 3:172460455-172460477 CATGATCATTAACTTCAAGTGGG - Intergenic
966002374 3:174966006-174966028 TATGATCATGAATCTCAAATGGG - Intronic
972020457 4:34307060-34307082 CATGATTATCACTTTCAGTTTGG + Intergenic
973633840 4:52843874-52843896 CCTGACCACCAATCTCAAGTCGG + Intergenic
974286002 4:59868056-59868078 CATGACTATCAACCTCAAGTGGG - Intergenic
974773919 4:66455021-66455043 CATGATAAAAACTTTCAAGTTGG + Intergenic
974814124 4:66983424-66983446 CATGATCATCAAATTCACCAAGG + Intergenic
975676781 4:76835234-76835256 CTTCATCTTCAATGTCAAGTTGG - Intergenic
975762652 4:77634010-77634032 CATGTACATCAGGTTCAAGTGGG + Intergenic
976356006 4:84118338-84118360 CATGATCATCAGATTCAACAAGG - Intergenic
976811734 4:89106731-89106753 CATGCACATCAAGTTCAAATGGG - Intronic
977807500 4:101319545-101319567 CTAAATCATCAATTTCAAATGGG + Intronic
978076566 4:104538542-104538564 AATGATCACTAAGTTCAAGTGGG - Intergenic
978687433 4:111462983-111463005 AATGATCATCAATTAAAAGCCGG + Intergenic
981555520 4:145989332-145989354 CAAGAATATTAATTTCAAGTGGG + Intergenic
982094550 4:151909936-151909958 AATGATTATGAATTTCAAGATGG - Intergenic
983674573 4:170277867-170277889 CATGATCACTAATCTCAAGTGGG + Intergenic
984058162 4:174954762-174954784 GATGATCATCCATCTCAGGTAGG + Intronic
984316764 4:178139591-178139613 CATGCTCATCCATTTCAAATGGG - Intergenic
985197625 4:187449158-187449180 CATGACCATTAACCTCAAGTTGG + Intergenic
985202505 4:187498315-187498337 CACGACCATCAGTTTCAGGTGGG + Intergenic
986179611 5:5381674-5381696 CATTAATATCAATTTAAAGTTGG + Intergenic
986525899 5:8674580-8674602 CATGATCACTAATGTCACGTGGG - Intergenic
986606313 5:9526937-9526959 CATTAACATCAATTTTCAGTTGG - Intronic
987623390 5:20366169-20366191 GAAGATCATCAATTTCATTTTGG - Intronic
991155613 5:63431391-63431413 CAAGCTCATCACTTACAAGTTGG - Intergenic
991772336 5:70051704-70051726 CATGACCACGAATCTCAAGTAGG - Intronic
991851629 5:70927122-70927144 CATGACCACGAATCTCAAGTAGG - Intronic
992125369 5:73634243-73634265 GATGTTTATCAATTTCAAGTAGG + Intronic
993844237 5:92920416-92920438 AAAAATCATTAATTTCAAGTGGG + Intergenic
994589889 5:101759647-101759669 CATGCACATCAAGTTCAAATGGG + Intergenic
994640963 5:102409511-102409533 AATAAGCATCAATTTCAAATGGG - Intronic
995441435 5:112196775-112196797 CATGTTCATTAACTTCAAGTGGG + Intronic
999067973 5:148712073-148712095 CTTGATAATCAATTTTGAGTTGG + Intergenic
1000491081 5:161914417-161914439 CATGATCATTAAATCTAAGTTGG - Intergenic
1004375892 6:15090349-15090371 CTTGATGAGCAATTTCAAGTGGG + Intergenic
1004999035 6:21222446-21222468 CAGGATCAACAAATTGAAGTTGG - Intronic
1005627099 6:27672986-27673008 CATGACAATGAATGTCAAGTAGG + Intergenic
1006867214 6:37218470-37218492 AAAGATTATCAATTTCGAGTGGG - Exonic
1009957275 6:70471075-70471097 CATGACCGTTAATTTCAAGTGGG - Intronic
1010879291 6:81148800-81148822 GATGATCAACAAATTCATGTTGG + Intergenic
1011849282 6:91605231-91605253 CAGGATCATCAATATCATATAGG + Intergenic
1013396718 6:109748165-109748187 CATGATCACCAACTTGAAATTGG - Intronic
1013565399 6:111354679-111354701 CTTGTTCTTCAATTTCTAGTGGG + Intronic
1015003480 6:128249238-128249260 CAGGGTTATCAATTTCAATTGGG - Intronic
1018215771 6:161526179-161526201 CATGTTCAGCAACTTCATGTTGG - Intronic
1021801735 7:24314085-24314107 CATGATCATCAATTTATTCTAGG + Intergenic
1023197597 7:37658337-37658359 GATGATCCTGAATTTCAAGTGGG + Intergenic
1023387604 7:39675927-39675949 AATCATTATAAATTTCAAGTAGG - Intronic
1023997820 7:45172833-45172855 CATGATGATCAGTTTAAACTTGG + Intronic
1024591085 7:50884217-50884239 CATAAGCATCATTTTCTAGTGGG + Intergenic
1025236872 7:57240389-57240411 CAACATCATCAATTGCAGGTAGG + Intergenic
1027379791 7:77594885-77594907 AATGTTCAAAAATTTCAAGTTGG - Intronic
1027885311 7:83897111-83897133 CATGAATATAAATTTCAAATTGG + Intergenic
1028059570 7:86294513-86294535 GATGATCACAAGTTTCAAGTGGG - Intergenic
1029206630 7:98873144-98873166 CATCAGCATCAATTTCAGGGTGG - Intergenic
1030482159 7:110118680-110118702 AATGATCAGCCATTTCAAATGGG + Intergenic
1033261013 7:139844078-139844100 CTTGCTCTTCAATTTCAAATGGG - Intronic
1033929768 7:146507346-146507368 CATGCACATCAAGTTCAAATGGG + Intronic
1035930363 8:3773705-3773727 CCTCATCATCAATTTGAAGGTGG - Intronic
1037215521 8:16446594-16446616 CATGACAATTAATTTCAAGGGGG + Intronic
1039181498 8:34871834-34871856 CATAATCATCAACTTCAAATGGG + Intergenic
1040744232 8:50620370-50620392 CATGACCCTGAATTTCAGGTAGG - Intronic
1042769585 8:72365234-72365256 CATGACCATGAACTTCAAGTGGG + Intergenic
1043504004 8:80885257-80885279 AATTATCATGAATTTCAAGACGG + Intergenic
1043637029 8:82398340-82398362 CAGGAGCATCAATTTCAAAATGG + Intergenic
1044298391 8:90555068-90555090 CAAGAGCAACAATTTCAAATTGG - Intergenic
1044825726 8:96195119-96195141 TATGATCATGCATCTCAAGTGGG - Intergenic
1044825728 8:96195132-96195154 CATGATCATAAATTTAAACAAGG + Intergenic
1044958404 8:97505383-97505405 CATGGCCATTAACTTCAAGTGGG - Intergenic
1046072070 8:109267916-109267938 CAGGATCATAAATTTCTATTTGG - Intronic
1046347068 8:112944026-112944048 CATTATCATCAATCTCAAAAGGG + Intronic
1047334875 8:123925889-123925911 AATGATTATGAATTTCAAGATGG + Intronic
1048384121 8:133895333-133895355 TTTGAACATCACTTTCAAGTGGG + Intergenic
1051146365 9:14031866-14031888 CTTGATGATCAACTGCAAGTGGG - Intergenic
1054907366 9:70422566-70422588 TATGATCATACATCTCAAGTGGG + Intergenic
1055069836 9:72154948-72154970 CTAGATCATCAGTTTCAAGAGGG - Intronic
1055443134 9:76356002-76356024 CTTGATCAGCATTTTCAATTGGG + Intronic
1055708774 9:79036581-79036603 GATGAACATCAAGGTCAAGTTGG - Intergenic
1056643812 9:88392796-88392818 CATCATCATCAATATCAACTGGG - Intronic
1060541093 9:124430803-124430825 CAAAATGATCAGTTTCAAGTGGG - Intergenic
1187156850 X:16728224-16728246 CATGTTCATTAATATCAAGCAGG - Intronic
1187619876 X:21040323-21040345 CATGGTCATAAATTTAAAATGGG - Intergenic
1189552238 X:42105018-42105040 CATTATCAGCAATTTTATGTGGG - Intergenic
1192019402 X:67369324-67369346 CATGCTCATCAATGACAGGTTGG + Intergenic
1192441639 X:71179014-71179036 CATATTCTTCAATTTCATGTGGG + Intergenic
1193021746 X:76799625-76799647 CATGTACATCAAATTCAAATGGG - Intergenic
1193681899 X:84531682-84531704 CTTGTTCATCTATTTCAAGATGG - Intergenic
1195768325 X:108320264-108320286 CATGACCACCAAATTCAAGTGGG - Intronic
1195861674 X:109389770-109389792 CATCATCATCATTATCAAATAGG + Intronic
1199056428 X:143300956-143300978 CATGATCAACAAGTACAACTGGG + Intergenic
1199253627 X:145693696-145693718 CATGATTATGAACTTCAAGTGGG - Intergenic
1200711887 Y:6492111-6492133 CAAGATCATCAATTTTTAGAGGG - Intergenic
1200901015 Y:8432144-8432166 TATGATTATCAATTGGAAGTTGG - Intergenic
1200907383 Y:8498044-8498066 CTTGAACATCATTTTCCAGTAGG - Intergenic
1201022049 Y:9669862-9669884 CAAGATCATCAATTTTTAGAGGG + Intergenic