ID: 1087575402

View in Genome Browser
Species Human (GRCh38)
Location 11:99983790-99983812
Sequence ATATTGGCCTGGGGGTTCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 111}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087575402 Original CRISPR ATATTGGCCTGGGGGTTCAA AGG Intronic
901956123 1:12787199-12787221 ATCTTGGGCTGGGGGTGCATGGG + Intergenic
901979503 1:13023268-13023290 ATCTTGGGCTGGGGGTGCATGGG + Intronic
902002580 1:13205670-13205692 ATCTTGGGCTGGGGGTGCATGGG - Intergenic
902021814 1:13351434-13351456 ATCTTGGGCTGGGGGTGCATGGG - Intergenic
905034360 1:34907577-34907599 TCATTTCCCTGGGGGTTCAAAGG - Intronic
907131768 1:52103546-52103568 CAATAGGCCTGGGGGTTTAAAGG + Intergenic
908277877 1:62495103-62495125 ATATTGGTATGGGCCTTCAAAGG + Intronic
908774547 1:67627548-67627570 ATATTGGCCTGAGGTATGAATGG - Intergenic
909201150 1:72691867-72691889 ATTTTGTCCTGGGGGTTCTTTGG + Intergenic
911743316 1:101411197-101411219 ATATTGTCTTGGGAGTTCCAAGG + Intergenic
911776603 1:101821169-101821191 ATATTAGCCTTGGAGTTCAAGGG + Intronic
912324106 1:108741476-108741498 AAGTTGGCCTGGGGGTGAAAAGG + Intronic
913498277 1:119448082-119448104 AAATTGCCCTGGTGGTTCATAGG - Intergenic
915041378 1:152970755-152970777 ATCTTGGCCTAGCGGCTCAAAGG - Intronic
918676345 1:187290635-187290657 ATAGGGGCTTGGGGGTTCAATGG - Intergenic
919422773 1:197391308-197391330 AAATTAGCCTGTGGGATCAATGG - Intronic
919928933 1:202208765-202208787 AGATTGGCATGGGGGCGCAAAGG + Intronic
921081220 1:211739718-211739740 ATATTTGTCTGGGGAATCAAAGG + Intergenic
921188938 1:212693020-212693042 AGATTGGCCTGGGAGGTCCAGGG + Intronic
923415758 1:233758101-233758123 ATTTTGATCTGGGGCTTCAAAGG - Intergenic
1065910394 10:30298863-30298885 AGACTGGCTTGGGGATTCAATGG - Intergenic
1067228931 10:44393520-44393542 ATAATGGCCTGGGTGTGCAGGGG - Intergenic
1067247014 10:44555797-44555819 ACCTTGACCTTGGGGTTCAATGG + Intergenic
1067822424 10:49541610-49541632 ATATTGGTTTGGGGGTACACAGG - Intergenic
1068658527 10:59599505-59599527 ACATTGGCCTGTGGGTTCTTTGG - Intergenic
1068955140 10:62814826-62814848 TTTTTTGCCTGGGGGTTCCACGG + Intronic
1076462957 10:130658926-130658948 TGACTGGCCTGGGGGTTCAGGGG + Intergenic
1078288618 11:9983519-9983541 ATATTATCTTGGGAGTTCAAGGG + Intronic
1085532272 11:77198880-77198902 AGCTTGACCTGGGGGTTCAGGGG + Intronic
1087575402 11:99983790-99983812 ATATTGGCCTGGGGGTTCAAAGG + Intronic
1091644983 12:2266359-2266381 ATATTGACCTGGGGGTTGCAGGG + Intronic
1092449772 12:8591288-8591310 ATATTGGCCTGGGTGGTTATGGG - Intergenic
1094201314 12:27797397-27797419 ACACTGACCTGGTGGTTCAAAGG + Intronic
1095604414 12:44049991-44050013 TGATTAGCCTGGGGGATCAAGGG + Intronic
1099186971 12:79525568-79525590 CTATTGACCAGTGGGTTCAATGG - Intergenic
1105534165 13:21248516-21248538 AGATTGGCCTTGGGCTTCCAGGG + Intergenic
1107207288 13:37808128-37808150 ATAATGGCCTGTGCATTCAAAGG + Intronic
1111133992 13:84015244-84015266 TTATTAGCCAGGTGGTTCAATGG + Intergenic
1111699956 13:91674318-91674340 ATATTGCCTTGGGCCTTCAATGG - Intronic
1119140766 14:72265381-72265403 ACACAGGCCTGGGGGTTAAATGG + Intronic
1120050246 14:79857594-79857616 ATAGTGTCCTGGGGGATCAAAGG - Intronic
1122254845 14:100469107-100469129 ATGCTGGCCTGAGGGTTCAAGGG - Intronic
1122630224 14:103104252-103104274 ATCTTGGCCTGGGGGGAGAAGGG - Exonic
1129910413 15:79221701-79221723 ATAGTGGCCTGGAGGTTGGATGG - Intergenic
1134031446 16:10995573-10995595 CTATTTGCCAGGGGGTTGAAGGG + Intronic
1142476608 17:192874-192896 TCATTGTCCTGTGGGTTCAAGGG - Intergenic
1146841585 17:36160028-36160050 ATATTGTCCTGAGGATTAAATGG - Intergenic
1146853896 17:36247989-36248011 ATATTGTCCTGAGGATTAAATGG - Intronic
1146869803 17:36371881-36371903 ATATTGTCCTGAGGATTAAATGG - Intronic
1146877158 17:36422961-36422983 ATATTGTCCTGAGGATTAAATGG - Intronic
1147072682 17:37972505-37972527 ATATTGTCCTGAGGATTAAATGG - Intergenic
1147084204 17:38052043-38052065 ATATTGTCCTGAGGATTAAATGG - Intronic
1147100152 17:38176009-38176031 ATATTGTCCTGAGGATTAAATGG - Intergenic
1149857723 17:60097331-60097353 ATATTGTCCTGAGGATTAAATGG + Intergenic
1150083098 17:62259045-62259067 ATATTGTCCTGAGGATTAAATGG - Intergenic
1151649748 17:75459326-75459348 ATGGTGGTCTGGTGGTTCAAGGG - Intronic
1151908183 17:77063180-77063202 GGGTTGGCCTTGGGGTTCAATGG - Intergenic
1152235712 17:79137362-79137384 ACAATGGCCTGGGGGTTGGAGGG - Intronic
1152654055 17:81511919-81511941 CTGTTGGCCTTGGGGTTCAGGGG + Exonic
1153556048 18:6315099-6315121 AGAGTGGCCTGGGTGTTCACAGG + Intronic
1164029700 19:21392407-21392429 AAATTAACCTGGGAGTTCAAAGG - Intergenic
1166632610 19:44420440-44420462 TAATTGGCCTGGGAGTGCAACGG - Intronic
929923202 2:46188395-46188417 CTATAGGCCTTGGGGTTCCAGGG + Intergenic
935487023 2:103669927-103669949 AGATAGGTCTTGGGGTTCAAGGG + Intergenic
944099943 2:196013956-196013978 AAATTGGTCTGGTGGCTCAATGG - Intronic
1168874405 20:1160906-1160928 CTGTTGGCCTTGGGGTTCAGGGG - Intronic
1169916538 20:10689372-10689394 AGATTTTCATGGGGGTTCAAGGG - Intergenic
1171335990 20:24386000-24386022 ATACAGGCCTGGGGGCTCACAGG + Intergenic
1172062120 20:32193742-32193764 TTAGTGGCCTGGTTGTTCAAAGG - Exonic
1177968790 21:27761945-27761967 ATACAGGCCTGGGGATTCTAGGG - Intergenic
1181468007 22:23120668-23120690 GTATGGACCTGGGGGTTCAAGGG - Intronic
951098799 3:18662848-18662870 ATACTGGGCTGGGGCTACAAAGG - Intergenic
951908454 3:27725806-27725828 ATTTGGGTCTGGGGTTTCAAGGG - Intergenic
954840823 3:53509718-53509740 AGCTTTGCCTGGGGATTCAAAGG + Intronic
955202377 3:56862551-56862573 ACATTGGCATGGGGGTTCCCAGG - Intronic
955390539 3:58519394-58519416 AGAGTGCCTTGGGGGTTCAAAGG + Intronic
956029030 3:65016693-65016715 ATATTGCCCTGTGAATTCAAAGG + Intergenic
957818480 3:85336027-85336049 ATTTTGGGCAGGGGGTTCACAGG - Intronic
960326624 3:116304310-116304332 ATATTGGGCTTGGGTTTGAAGGG + Intronic
961108199 3:124260305-124260327 ATTTGGGCCTGGGAGCTCAAAGG - Intronic
968436120 4:590426-590448 ATTTTGGCCTGGAGGTGCAAGGG - Intergenic
975745831 4:77473143-77473165 CTACTGGCCTGGAGGTTGAATGG + Intergenic
976367513 4:84246917-84246939 TTAGTGGCCTGGTTGTTCAAAGG + Intergenic
980032488 4:127846236-127846258 CTACTGGCCTGGAGGTTAAATGG + Intergenic
981506175 4:145502319-145502341 ATTTGGGAATGGGGGTTCAATGG + Intronic
981538187 4:145822379-145822401 ATATTGGCCTCGGGTATCACAGG - Intronic
981938927 4:150261205-150261227 GTCTTGGCCAGGGGGTTCTAAGG + Intergenic
983824570 4:172242176-172242198 AAATTGGGCTGGGAGTTGAAGGG + Intronic
987188660 5:15451012-15451034 CTGTTGGCCTTGGGGTTCAGAGG - Intergenic
989359581 5:40585468-40585490 ATATTGGTCTAAGGGTTCTATGG + Intergenic
990249836 5:53902586-53902608 ATATTGGCCTTGTGGTACTATGG + Intronic
992074115 5:73175234-73175256 ATATTTGCTTTGGGCTTCAAAGG + Intergenic
993588372 5:89760925-89760947 ATATTGGCCTTCGGGTGCAGTGG - Intergenic
994316433 5:98339051-98339073 TGATTGGCCTTGGGGTTCAGGGG - Intergenic
999776312 5:154815337-154815359 AACTTGGCCTTGGGGTTCCAAGG - Exonic
1000473014 5:161670004-161670026 ATATTGGCATAGTGGTTAAAAGG + Intronic
1011754403 6:90484061-90484083 ATATCGGTCTGAGGATTCAAAGG - Intergenic
1011955165 6:93016851-93016873 CTATGGACCTGGAGGTTCAATGG + Intergenic
1012051360 6:94348836-94348858 ATATTGTCCTGGGAGTAGAATGG + Intergenic
1012206244 6:96464134-96464156 CTTTTGTCATGGGGGTTCAAGGG - Intergenic
1012628283 6:101431112-101431134 CTGTTGGCCTTGGGGTTCAGAGG + Intronic
1023864065 7:44230497-44230519 ACATTGGCCTGGGTGAGCAAGGG + Intronic
1024564322 7:50668954-50668976 TTATTGCCCTGCGGGTCCAATGG + Intronic
1026113083 7:67473912-67473934 ATAGGGGCATGGGGGTTGAAAGG - Intergenic
1026201891 7:68221594-68221616 ATAAAGGGCTGGGGGTTGAAGGG + Intergenic
1030643245 7:112029571-112029593 AAATTAGCATGGAGGTTCAAGGG - Intronic
1035058317 7:156051451-156051473 AGATTTTCCTGGGGGTTCAGGGG - Intergenic
1038450349 8:27635244-27635266 AGAATGGCCTGAGGGTTCATTGG + Intronic
1040823033 8:51585978-51586000 ATATAGGTCTGGGGCTTCCAGGG - Intronic
1042695541 8:71550407-71550429 ATTTTGGCTTGGTGGTGCAAAGG - Intronic
1044012943 8:87017131-87017153 AAATTGGTCTGGGGGTAAAACGG + Intronic
1048034927 8:130668633-130668655 TTCTTTGCCTCGGGGTTCAATGG - Intergenic
1048825044 8:138416140-138416162 ATTTTGTCCTGGGGGATCAAGGG - Intronic
1049138364 8:140927499-140927521 ATACTGGCCTGGGGGTCTGATGG + Intronic
1054724690 9:68638771-68638793 ACATTGGCCTGGTTCTTCAAGGG + Intergenic
1055136427 9:72834475-72834497 ATACTGACATGGGGGTTCAGCGG - Intronic
1061394085 9:130333785-130333807 CTATGGGCCTGGGGTTTCGAGGG - Intronic
1188569189 X:31561461-31561483 GTATTGGCCTGGGGATGGAAGGG - Intronic
1189600113 X:42615377-42615399 ATATTGTCTTGGGAGTTCTAGGG - Intergenic
1190720477 X:53143567-53143589 CTGTTGGCCTTGGGGTTCGAGGG + Intergenic