ID: 1087575559

View in Genome Browser
Species Human (GRCh38)
Location 11:99985129-99985151
Sequence ATGGGATGGCTTCCCTCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 2, 2: 3, 3: 25, 4: 202}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087575550_1087575559 27 Left 1087575550 11:99985079-99985101 CCCATAGAGTGCAGTGTATTATC 0: 1
1: 0
2: 0
3: 6
4: 90
Right 1087575559 11:99985129-99985151 ATGGGATGGCTTCCCTCTGCTGG 0: 1
1: 2
2: 3
3: 25
4: 202
1087575551_1087575559 26 Left 1087575551 11:99985080-99985102 CCATAGAGTGCAGTGTATTATCA 0: 1
1: 0
2: 1
3: 7
4: 92
Right 1087575559 11:99985129-99985151 ATGGGATGGCTTCCCTCTGCTGG 0: 1
1: 2
2: 3
3: 25
4: 202
1087575555_1087575559 -8 Left 1087575555 11:99985114-99985136 CCCTTGCCTCATCACATGGGATG 0: 1
1: 5
2: 11
3: 34
4: 188
Right 1087575559 11:99985129-99985151 ATGGGATGGCTTCCCTCTGCTGG 0: 1
1: 2
2: 3
3: 25
4: 202
1087575554_1087575559 -7 Left 1087575554 11:99985113-99985135 CCCCTTGCCTCATCACATGGGAT 0: 1
1: 3
2: 11
3: 38
4: 200
Right 1087575559 11:99985129-99985151 ATGGGATGGCTTCCCTCTGCTGG 0: 1
1: 2
2: 3
3: 25
4: 202
1087575556_1087575559 -9 Left 1087575556 11:99985115-99985137 CCTTGCCTCATCACATGGGATGG 0: 1
1: 2
2: 4
3: 27
4: 188
Right 1087575559 11:99985129-99985151 ATGGGATGGCTTCCCTCTGCTGG 0: 1
1: 2
2: 3
3: 25
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087575559 Original CRISPR ATGGGATGGCTTCCCTCTGC TGG Intronic
900479429 1:2890947-2890969 CTGGGCTGTCTTCCCTCTGTGGG + Intergenic
903672117 1:25042716-25042738 AGGGGGTGGCTTCTCTCTGCAGG + Intergenic
903767554 1:25744412-25744434 CTGGGATGGCTTCCCTGTTTGGG - Intronic
908640297 1:66215609-66215631 ATATGATGGCTTCTTTCTGCAGG + Intronic
908939132 1:69410544-69410566 ATGAGGTGGCTTCACTGTGCTGG + Intergenic
909453887 1:75829031-75829053 CTGTCATGGCTTCCCTTTGCTGG - Intronic
911367315 1:96954279-96954301 ATGGGCTGCATTCCCTCTGAAGG + Intergenic
912490028 1:110057688-110057710 AGGGGAAGTCTTTCCTCTGCTGG + Intronic
913112735 1:115671064-115671086 CTGGGATGGCTTCCCTCGCACGG + Intronic
914807408 1:151001749-151001771 ATGTGATCACTTCCTTCTGCGGG + Exonic
915197353 1:154199678-154199700 TTGGATAGGCTTCCCTCTGCTGG - Intronic
916165140 1:161959993-161960015 ATGGGATGCACTCCCTCAGCAGG - Exonic
920403819 1:205694070-205694092 CTGGGGGGGCTTCCCTCTGTGGG + Intergenic
922337249 1:224627784-224627806 AGGGAATGGCTTCTCTCTCCAGG + Intronic
924422137 1:243919383-243919405 ATGGGATGCCATCCCATTGCAGG + Intergenic
1065370763 10:24982746-24982768 ATGGGAATGTTTCCCTCTGAAGG + Exonic
1067120917 10:43471448-43471470 ATGGGGTGGCTGCCCTCCTCTGG + Intronic
1067435242 10:46272442-46272464 GAAGGATGGCTTCCCACTGCGGG + Intergenic
1067771288 10:49128205-49128227 GTGGGATGCATTCCTTCTGCTGG - Intergenic
1069211838 10:65771504-65771526 ATTGGATGGTCTGCCTCTGCAGG - Intergenic
1071693212 10:87844386-87844408 AGGGAGTGCCTTCCCTCTGCTGG - Intergenic
1075683601 10:124349216-124349238 GTGGGAAGCCTTCCCACTGCAGG - Intergenic
1076589086 10:131570865-131570887 CTGGCCTGGCTTCCCTCTTCAGG - Intergenic
1076869511 10:133186465-133186487 CTGGGACGGGTTCCCTGTGCAGG + Exonic
1077443951 11:2581539-2581561 ATGGCCTGGCTTCACCCTGCAGG + Intronic
1078054787 11:7999548-7999570 AAGGGCTAGTTTCCCTCTGCAGG - Exonic
1078080143 11:8198200-8198222 ATGGGATGTCTTCCCCATCCGGG + Intergenic
1078283808 11:9930841-9930863 CTGTCATGGCTTCCCTTTGCTGG - Intronic
1081268616 11:41057733-41057755 AGGGAATGGCTTCTCTCTGCAGG - Intronic
1081999028 11:47382857-47382879 ATGGGATATCTTCCTTCTCCTGG - Intergenic
1082189305 11:49223484-49223506 GTGGGATAGGTTCCCTCTGGGGG - Intergenic
1083106183 11:60360723-60360745 ATGGGGTGGCTGCCCTCCACTGG + Intronic
1084500787 11:69533982-69534004 ATGGGATGGGGTCCCCCTTCAGG - Intergenic
1084719532 11:70895410-70895432 ATGGGACTGCTCCCCGCTGCAGG + Intronic
1087575559 11:99985129-99985151 ATGGGATGGCTTCCCTCTGCTGG + Intronic
1088967468 11:114738151-114738173 ATGGGAAAGCTTGGCTCTGCTGG + Intergenic
1090271115 11:125387093-125387115 ATGGGAAAGCTGCCCTGTGCAGG + Intronic
1090811880 11:130251559-130251581 GTCTGATGGCTTCCCTCTGTAGG - Intronic
1092815621 12:12310186-12310208 ATGTCATGGCTTCCCTGTGCTGG + Intergenic
1094581433 12:31737345-31737367 ATGGGGTAGCTCCGCTCTGCAGG - Intergenic
1096919858 12:55072282-55072304 GTGGGGTGGCTGCCCTCTGCTGG + Intergenic
1097130842 12:56809849-56809871 AGTGGGTGGCTCCCCTCTGCAGG + Intergenic
1099534043 12:83823873-83823895 GTGGGGTGGCTGCCCTCTGCTGG + Intergenic
1103129230 12:118452500-118452522 ATGGGATGTAATCCCTCTTCAGG - Intergenic
1104880964 12:132069806-132069828 CTGGGAAGGCTCCTCTCTGCCGG + Intronic
1105036031 12:132921864-132921886 ATGGGGGTGCTGCCCTCTGCTGG + Exonic
1107171006 13:37341882-37341904 AGTGGATAGCTTCTCTCTGCAGG - Intergenic
1107188021 13:37546952-37546974 GTGGGATGGCTGCACTGTGCTGG + Intergenic
1108497737 13:51041934-51041956 ATGTGATGGCATCTCACTGCTGG + Intergenic
1113817535 13:113184750-113184772 CTGGAACGGCTTCCCACTGCAGG - Intronic
1113955366 13:114097684-114097706 ACAGAATGGCTCCCCTCTGCAGG + Intronic
1115243295 14:31270367-31270389 ATTGGGAGGCTGCCCTCTGCTGG - Intergenic
1119858429 14:77918612-77918634 GGGGGCTGGCTTCCCTCTTCTGG + Intronic
1120060505 14:79977324-79977346 GAAGGATGGATTCCCTCTGCAGG + Intergenic
1121907920 14:97764412-97764434 ATTGGGTTGGTTCCCTCTGCAGG + Intergenic
1122084547 14:99290562-99290584 CCAGGAAGGCTTCCCTCTGCAGG + Intergenic
1124439193 15:29674789-29674811 AGGGGCGGGCTTCCCCCTGCCGG + Intergenic
1124925151 15:34063553-34063575 TTGGGATGGCTTCCCAGTGGTGG - Exonic
1125238845 15:37550078-37550100 AGAGGGTGGCTACCCTCTGCAGG + Intergenic
1128344880 15:66847572-66847594 AGGGGATGGCTCCCCACTCCAGG - Intergenic
1128790668 15:70431559-70431581 AGGGGTTGGCTCCTCTCTGCAGG + Intergenic
1129225111 15:74164971-74164993 ATGGCATTCCTTCCCTCTGGAGG + Intergenic
1131102005 15:89699411-89699433 ATGGGATGCCTTTCTTCTTCTGG + Intronic
1133690531 16:8210226-8210248 AAGCGATGGCTTCCATCTCCTGG + Intergenic
1134782258 16:16908964-16908986 AGTGAATGGCTTCCCTCTTCAGG - Intergenic
1136922813 16:34345921-34345943 AGGGGATAGATGCCCTCTGCAGG - Intergenic
1136981760 16:35065885-35065907 AGGGGATAGATGCCCTCTGCAGG + Intergenic
1138174105 16:54880564-54880586 ATGGGGGGGCTTCCCACTCCTGG - Intergenic
1139345502 16:66300516-66300538 CTGGGCTGGCTTGGCTCTGCAGG - Intergenic
1139397478 16:66651795-66651817 ATGGGATGGCCTCCCTTGGGAGG - Intronic
1139776539 16:69320200-69320222 ATGAGGTGGATTCCCTCTGCGGG + Exonic
1141120125 16:81347393-81347415 ATGGACTGGCTTCCTTCTGCTGG + Intronic
1141632098 16:85293641-85293663 GCGGGACGGCTTCCTTCTGCTGG + Intergenic
1141844862 16:86601416-86601438 ATGGGTGGGCTTCCCTCTAGGGG + Intergenic
1142660978 17:1429166-1429188 TTGGCATGGTTTTCCTCTGCAGG - Intronic
1152575120 17:81136530-81136552 ATGGGATGGCGTCCTGCTGGGGG - Intronic
1152856574 17:82668108-82668130 AGTGGGTGGCTTCTCTCTGCAGG + Intronic
1155819878 18:30361993-30362015 ATGGGGTGGCTGCCCTCCACTGG - Intergenic
1156039437 18:32803857-32803879 ATGGACTGCCTTCCTTCTGCTGG - Intergenic
1157417179 18:47513557-47513579 TTGGAAAGGCTTACCTCTGCTGG + Intergenic
1158215495 18:55096734-55096756 AAGGGATGGCTTCAATTTGCAGG - Intergenic
1159945824 18:74444214-74444236 ATGGTATGGCTTCCTACTCCAGG - Intronic
1160433777 18:78830751-78830773 ATGAGAAGGATTCCCTGTGCAGG - Intergenic
1160970967 19:1767608-1767630 CGGGGACGGCTGCCCTCTGCTGG + Intronic
1161588307 19:5117399-5117421 ATGGGAGGGCGCCCTTCTGCTGG + Intronic
1161628154 19:5338817-5338839 GCGGGATGGCTTCCTTCTCCCGG + Intronic
1161770277 19:6227173-6227195 GTGGTGGGGCTTCCCTCTGCAGG + Intronic
1164246784 19:23437142-23437164 TTACGATGGCATCCCTCTGCTGG - Intergenic
1165048544 19:33126051-33126073 GTGGGAGTGCTTCCCTCTGGTGG - Intronic
925452572 2:3982454-3982476 CTGGAATGGATGCCCTCTGCAGG + Intergenic
926156364 2:10456250-10456272 GCGGGCTGGCTTCCCTCTGAGGG - Intergenic
926796765 2:16625890-16625912 CTGGGATGGATTCACTCAGCTGG + Intronic
928008050 2:27581517-27581539 CTGCGATGGCTTCTCTCTGAGGG - Exonic
928008053 2:27581541-27581563 CTGCGATGGCTTCTCTCTGAGGG - Exonic
928008084 2:27581757-27581779 CTGTGATGGCTTCTCTCTGAGGG - Exonic
928158211 2:28895227-28895249 CTGGGGCGGCTTCCTTCTGCCGG + Intronic
931790948 2:65663710-65663732 ATGTGGGGGCTTCTCTCTGCTGG + Intergenic
934657661 2:96124426-96124448 ATGGGATGGCTTCATTGTCCTGG - Intronic
936381957 2:111994158-111994180 GCGGGATGGCTTCCCTCAGAAGG + Intronic
936537057 2:113320665-113320687 AGGGGATTGCTTCCACCTGCGGG + Intergenic
937928062 2:127183022-127183044 ATGGGTGTGCTTGCCTCTGCCGG + Intergenic
938795858 2:134718283-134718305 CTGGGAGAACTTCCCTCTGCGGG - Intronic
939801943 2:146721192-146721214 ATGGGGTGGCCACCCACTGCTGG - Intergenic
939928367 2:148201549-148201571 ATGGGATGGCTGCCCTCTGCTGG + Intronic
944131703 2:196354075-196354097 ATGGGGTGGCTGCCCTCCACTGG - Intronic
944586706 2:201179216-201179238 AAAGGGTGGCTTCTCTCTGCTGG - Intergenic
945004217 2:205386336-205386358 ATGGGTTGGCTCCCCTGTGTGGG - Intronic
947625423 2:231615379-231615401 AAGGCATGGCTGCCTTCTGCCGG - Intergenic
948626106 2:239269082-239269104 CTTGGATGGCTTCCATCTGCTGG - Intronic
1170705689 20:18742880-18742902 AAGGGCTGGCTTCTCCCTGCTGG - Intronic
1170753120 20:19170276-19170298 ATGGGCTGGCTTTTCTCTCCAGG + Intergenic
1170898324 20:20436593-20436615 GTGAGATGGCTTCCCTGGGCTGG - Intronic
1172202570 20:33136890-33136912 ATGGGATGGCTTACCTGTTTGGG - Intergenic
1173004061 20:39126274-39126296 ATGGGAAGACATCCCTCTGCTGG - Intergenic
1173646682 20:44637680-44637702 CTGGGTTGGGTTTCCTCTGCAGG - Intronic
1173841787 20:46162136-46162158 AAGGGCTGGCTTCCCACTGGAGG + Intergenic
1174705526 20:52651937-52651959 AGGGAATGACTTCCCTCTTCTGG - Intergenic
1175216244 20:57392905-57392927 GGGGGATGGCTGCCCTGTGCCGG - Intronic
1175987576 20:62771576-62771598 TTGGGATTGCTGCCCTCTGGGGG + Intergenic
1176019193 20:62953888-62953910 AGGGGAGGGCTGCCCTCAGCGGG + Intronic
1176067636 20:63206907-63206929 ATGGGACAGCTTCCCTCACCAGG - Intronic
1177968491 21:27759269-27759291 ATGGGGCAGCTGCCCTCTGCTGG - Intergenic
1181477229 22:23176224-23176246 ATGAGCTGGCCTCCCTCTGTTGG + Intergenic
1181495835 22:23287044-23287066 ATGGGATTCTTGCCCTCTGCAGG + Intronic
1182457580 22:30461713-30461735 ATGGGCTTGCTTCCGTCTCCTGG + Intronic
1182475344 22:30573991-30574013 AAGGGATGGATCCCCTCTGCTGG - Intronic
1182623976 22:31632646-31632668 ATGGGATGTCTTCCCATGGCAGG - Intronic
1183752298 22:39728483-39728505 TTGGGAGGGCTGCCCTTTGCTGG - Intergenic
1184372847 22:44093540-44093562 TGGGGCTGCCTTCCCTCTGCCGG - Intronic
1184493367 22:44823400-44823422 GCAGGAGGGCTTCCCTCTGCTGG - Intronic
1184656823 22:45946104-45946126 AGGTGAGGGCTTCCCTCTGCAGG - Intronic
1184765420 22:46569636-46569658 CTGTGATGGCTTCTCGCTGCTGG + Intergenic
1184927931 22:47657212-47657234 AAGGGAAGGCCCCCCTCTGCCGG - Intergenic
1185032111 22:48449616-48449638 ATCCCAGGGCTTCCCTCTGCTGG - Intergenic
1185307372 22:50127516-50127538 CTGGGATGGCTTCCAGCTCCGGG - Intronic
949351385 3:3127427-3127449 ATGGAATGGTTTTTCTCTGCAGG + Intronic
950020694 3:9785543-9785565 ATGGGAAGGCTTCCCACGGTAGG - Intronic
950869030 3:16213011-16213033 ATGGGATGGGATCCCTCACCTGG + Intronic
951322299 3:21260111-21260133 ATGTGATGGCTTCCTGCTGGAGG - Intergenic
958838248 3:99171750-99171772 ATGGGTTGGCTACACTGTGCAGG - Intergenic
959693505 3:109224550-109224572 GGAGGATGGCTGCCCTCTGCTGG + Intergenic
962119760 3:132549279-132549301 ATGGGGTGGCTGCCCTCCACCGG - Intergenic
963454240 3:145523063-145523085 AGAGGATGGCTCCTCTCTGCAGG + Intergenic
964439352 3:156689900-156689922 AGCAGATGGCTTACCTCTGCTGG - Intronic
964590675 3:158360091-158360113 AGTGGATGTCTTCCCTCTGCAGG + Intronic
965039676 3:163490406-163490428 GTGGGTTGGCTGCCCTCTGCTGG + Intergenic
965813382 3:172614147-172614169 AGTGGGTGGCTTCTCTCTGCAGG + Intergenic
967734983 3:192942406-192942428 CTTGGATGGCTTCCCTTTACTGG - Intergenic
968561648 4:1286331-1286353 ATGGGGTGGCTGCCCTCTGCTGG + Intergenic
969129439 4:4980781-4980803 ATTGCAAGGCTACCCTCTGCAGG - Intergenic
969343723 4:6558359-6558381 ATGGGTGGCCTTCCCACTGCAGG - Intronic
969568056 4:7991905-7991927 CTGGGATGGCATCCCTAAGCAGG - Intronic
972065609 4:34939500-34939522 TTGGGGTGGCTGCCTTCTGCAGG + Intergenic
972076980 4:35101894-35101916 AGGGGCTGGCTTCCCTCAGCAGG - Intergenic
975420672 4:74160057-74160079 ATGGAATCTCTTCTCTCTGCTGG - Intronic
975830365 4:78362578-78362600 CTGGGGTGGTTTCCCTCCGCTGG + Intronic
976111742 4:81682696-81682718 ATGGAATTGCTTTTCTCTGCAGG + Intronic
976529335 4:86134050-86134072 ATGGGTTGGCTTCCTTGTGAAGG - Intronic
976970514 4:91096382-91096404 AGGGGCTGGCTTCCCTCGGCAGG + Intronic
979042285 4:115813423-115813445 ATTTGATGGCTTCCCTTTGTGGG - Intergenic
980988552 4:139718587-139718609 CTGGGACGGCTTCCCTCTGCTGG - Exonic
988570821 5:32363959-32363981 ATGTGATGTCTTCACGCTGCTGG + Exonic
989319777 5:40121162-40121184 ATAGGGTGGCTGCCCTCTGCAGG - Intergenic
989694556 5:44184120-44184142 AAGGGATGGATTGCCACTGCAGG - Intergenic
990322367 5:54642461-54642483 ATGGGATGTCATCTCTCAGCTGG + Intergenic
990654626 5:57941510-57941532 TAGGGAAGGCTTCCCTCTGGAGG + Intergenic
993937941 5:94026269-94026291 ATGGGGTGGCTGCCCTCTGCTGG + Intronic
995655125 5:114417746-114417768 AGGAGATGAGTTCCCTCTGCAGG + Intronic
995968603 5:117940104-117940126 AGGAGATGGCTGCCTTCTGCTGG + Intergenic
999212330 5:149900809-149900831 ATGGAATCCCTTCCCTCTGAAGG + Intronic
999797807 5:155004531-155004553 GTGGAATGGCTGCCCTCTGCTGG + Intergenic
1001454766 5:171852275-171852297 ATGGGATGGTTTCCCTTAGGAGG - Intergenic
1001887757 5:175310942-175310964 ATGGGTTGGATTCCTTTTGCCGG - Intergenic
1005351597 6:24941217-24941239 AAGGAATGGATTCCCTCAGCGGG - Intronic
1007173723 6:39882472-39882494 ATGGGAAGCTTTACCTCTGCAGG + Intronic
1009453582 6:63829309-63829331 CTGTCATGGCTTCCCTTTGCTGG - Intronic
1010261103 6:73817870-73817892 AAGGGATGGCTTCTCCCTACTGG + Intronic
1011832173 6:91387344-91387366 AGGGGATGGATTGCCTCTGCAGG + Intergenic
1013039316 6:106417965-106417987 ATGGAGTGGCTACTCTCTGCCGG + Intergenic
1013236014 6:108198514-108198536 AGGGGTTGGCTCCTCTCTGCAGG + Intergenic
1014507466 6:122277572-122277594 ATGTGATGGCTTCATTCTGAAGG - Intergenic
1015229232 6:130894953-130894975 ATGTCTTGGCTTACCTCTGCCGG + Exonic
1015977462 6:138805518-138805540 ATGGGTTGGCTGGCCTCAGCTGG + Intronic
1018291142 6:162293538-162293560 ATGGGACAGCTGCCCTCTCCAGG - Intronic
1020567986 7:9822201-9822223 AGAGGGTGGCTTCTCTCTGCTGG + Intergenic
1021509295 7:21417819-21417841 ATGGGTTGGCTTCCCTCCAAAGG - Intergenic
1022727232 7:32992257-32992279 AGGGGGTGGGTTTCCTCTGCGGG - Intronic
1022789744 7:33675021-33675043 AAGGGAGCCCTTCCCTCTGCTGG - Intergenic
1024590850 7:50881695-50881717 ATGGGAGGCATTCACTCTGCTGG - Intergenic
1028496129 7:91463279-91463301 GTGGGATGGCTTCCCACCTCTGG - Intergenic
1028502923 7:91538930-91538952 ATGGGATGGATTCCTTATGCAGG - Intergenic
1029382267 7:100221817-100221839 TTGACCTGGCTTCCCTCTGCTGG + Intronic
1033269454 7:139917484-139917506 ATGGGATGCCTGTCCCCTGCAGG + Intronic
1034252567 7:149704013-149704035 ATGGAAGGCCTGCCCTCTGCTGG + Intergenic
1034259934 7:149748700-149748722 TTGGGCTGGGTTCCCTCTCCTGG + Intergenic
1037930727 8:22878568-22878590 TGGGGAGGGCTTCCCTCTCCGGG + Intronic
1039066551 8:33613525-33613547 ATGGAATGCCTTCCTTCTGGAGG + Intergenic
1039413617 8:37375598-37375620 AGGAGATGGCTTCCATATGCTGG - Intergenic
1044219114 8:89649229-89649251 AAGGGAGGGCTTCCCACTGTGGG + Intergenic
1046331080 8:112715779-112715801 ATGTGATGGATTACATCTGCCGG - Intronic
1049149835 8:141027367-141027389 ATGGTATTGCTTCACTCTGGGGG - Intergenic
1050237571 9:3597840-3597862 ATGGGGTGGCTTCCCTCTGCTGG - Intergenic
1051986098 9:23089286-23089308 ATGGGGTGGCTGCCCTCCACTGG + Intergenic
1051996098 9:23219784-23219806 ATGGGGTGGCTGCCCTCCACTGG + Intergenic
1052284685 9:26771504-26771526 AGTGGATGGCTTGCCACTGCAGG + Intergenic
1053128225 9:35599801-35599823 AGTGGGTGGCTTCTCTCTGCAGG - Intergenic
1054931510 9:70640138-70640160 ATTAGCAGGCTTCCCTCTGCAGG - Intronic
1056790791 9:89624112-89624134 TGGTGATGACTTCCCTCTGCGGG + Intergenic
1059398334 9:114052942-114052964 AGGGGTTGGCTTGCCTCTGCAGG + Exonic
1060215020 9:121733708-121733730 CTGGGAAGGCTTCCCTCAGGTGG + Intronic
1061404205 9:130384663-130384685 AGGGGCTGGCTTCCCCCGGCAGG + Intronic
1062304310 9:135894334-135894356 CTCGGATGGCTTCCCTCAGTGGG - Intronic
1186124915 X:6402699-6402721 ATGGGGTGGCTCCCCCATGCTGG - Intergenic
1186426539 X:9467229-9467251 TGGAGATGGCCTCCCTCTGCAGG - Intronic
1189360224 X:40344182-40344204 AGAGGATAGCTTCTCTCTGCTGG - Intergenic
1189676700 X:43468040-43468062 ATGGGGCGGCTGCCCTCTACCGG + Intergenic
1190131383 X:47751873-47751895 GTGGGGTGGCTGCCCTCTGCTGG + Intergenic
1190487426 X:50941827-50941849 ATGGGGCAGCTGCCCTCTGCTGG + Intergenic
1192691838 X:73373046-73373068 GTGGGATGGCTGCCCTGTGCAGG + Intergenic
1194520098 X:94908593-94908615 ATGGGATGGCTGTGCTGTGCTGG - Intergenic
1194520177 X:94909134-94909156 GTGGGATGGCTGCACTGTGCTGG - Intergenic
1195070521 X:101274624-101274646 ATAGGATGGCATCCCATTGCAGG - Intronic
1196234400 X:113261885-113261907 GTGGGATGGCTGCACTGTGCTGG + Intergenic
1196589677 X:117471915-117471937 ATGAGAAGCATTCCCTCTGCTGG - Intergenic
1197365614 X:125562033-125562055 ATGGGGTGGCTGCACTGTGCTGG - Intergenic
1198223204 X:134621923-134621945 GTGGGCTGGCTTCCATCTCCAGG - Intronic
1198394426 X:136207770-136207792 ATCCAATTGCTTCCCTCTGCAGG + Exonic
1198969569 X:142266556-142266578 AGGGGCTGGCTTCCCTTGGCAGG - Intergenic
1199187963 X:144939196-144939218 ATAGGATAGCTCCTCTCTGCTGG + Intergenic
1199855492 X:151755906-151755928 ATGAGCTGGCTCCCCTCTGCTGG + Intergenic
1200141047 X:153903146-153903168 AGGAGATGGCTTCCCTCAACTGG - Intronic
1201270206 Y:12246848-12246870 AGGTGTTGGCTTCCCTCTGCGGG - Intergenic
1201680985 Y:16643414-16643436 AGGGGATGGCTTTCCTCTTCAGG + Intergenic