ID: 1087576524

View in Genome Browser
Species Human (GRCh38)
Location 11:99996793-99996815
Sequence CAGGAGAGAGAGAGGGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5902
Summary {0: 2, 1: 18, 2: 123, 3: 819, 4: 4940}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087576524 Original CRISPR CAGGAGAGAGAGAGGGAGCA TGG Intronic
Too many off-targets to display for this crispr