ID: 1087577196

View in Genome Browser
Species Human (GRCh38)
Location 11:100004131-100004153
Sequence CAAGCACATGGTGCTCTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 115}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087577193_1087577196 9 Left 1087577193 11:100004099-100004121 CCACAGCTCACTTGAGCTGCTTC 0: 1
1: 0
2: 1
3: 32
4: 247
Right 1087577196 11:100004131-100004153 CAAGCACATGGTGCTCTTGTGGG 0: 1
1: 0
2: 0
3: 8
4: 115
1087577190_1087577196 29 Left 1087577190 11:100004079-100004101 CCTGAGCATCCGCGTGGCTCCCA 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1087577196 11:100004131-100004153 CAAGCACATGGTGCTCTTGTGGG 0: 1
1: 0
2: 0
3: 8
4: 115
1087577191_1087577196 20 Left 1087577191 11:100004088-100004110 CCGCGTGGCTCCCACAGCTCACT 0: 1
1: 0
2: 2
3: 21
4: 236
Right 1087577196 11:100004131-100004153 CAAGCACATGGTGCTCTTGTGGG 0: 1
1: 0
2: 0
3: 8
4: 115
1087577192_1087577196 10 Left 1087577192 11:100004098-100004120 CCCACAGCTCACTTGAGCTGCTT 0: 1
1: 0
2: 3
3: 15
4: 159
Right 1087577196 11:100004131-100004153 CAAGCACATGGTGCTCTTGTGGG 0: 1
1: 0
2: 0
3: 8
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087577196 Original CRISPR CAAGCACATGGTGCTCTTGT GGG Intronic
901436867 1:9251784-9251806 CAAGCACACTGTGCTCTCCTTGG + Intronic
901931899 1:12601277-12601299 CAAGGAAATGGTGCTCTATTTGG - Intronic
905872943 1:41415441-41415463 CCAGCACCAGGTGCCCTTGTGGG + Intergenic
906000950 1:42424490-42424512 CAAGCAAATGGAGATCATGTAGG - Intergenic
910480377 1:87652349-87652371 ACTGCACCTGGTGCTCTTGTAGG - Intergenic
912578248 1:110695410-110695432 CAAGACCATCGGGCTCTTGTTGG + Intergenic
919804648 1:201374078-201374100 CATACACATGGTGCAATTGTGGG + Intronic
1065416772 10:25496668-25496690 TACCCACATGCTGCTCTTGTAGG - Intronic
1070898374 10:80005651-80005673 GAAGCACATGGTGACCATGTGGG - Intergenic
1074050444 10:109876722-109876744 CAAGCACAGTGTTCTTTTGTTGG + Intronic
1075030864 10:119023851-119023873 CAAGCACCTGGTGCTGATGGTGG + Intergenic
1076016452 10:127031333-127031355 CAAGACCATGCTGCTCTTCTTGG + Intronic
1076810748 10:132885255-132885277 CAAGCACATGGTCATCGTGAAGG - Exonic
1078431421 11:11291348-11291370 CATGCCCAAGGTGCTCATGTTGG - Intronic
1087577196 11:100004131-100004153 CAAGCACATGGTGCTCTTGTGGG + Intronic
1089069328 11:115687256-115687278 CTAGGACATGGTTCTCTAGTAGG + Intergenic
1089097673 11:115932794-115932816 CAATCACATGGTGGACTCGTTGG + Intergenic
1093927185 12:24920730-24920752 GAAGGACGGGGTGCTCTTGTGGG - Intronic
1099088816 12:78279552-78279574 CAAGCACCTGGTGCACTGGAGGG + Intergenic
1115709084 14:36030204-36030226 GAACCACATGATGCTTTTGTTGG + Intergenic
1117677447 14:58169151-58169173 CTAGCACGTGGTGCTGGTGTTGG - Intronic
1125976232 15:43954356-43954378 CTATCACATGGTGCCTTTGTGGG - Intronic
1127841617 15:62836435-62836457 CCATCACATGGTGCTACTGTAGG + Intronic
1129583001 15:76831772-76831794 CAAGCACCTGCTGCACTTGAGGG - Intronic
1131381770 15:91970182-91970204 CAAGCACATGTAGCACATGTAGG + Intronic
1135892838 16:26372966-26372988 CAAGCTCCTGCTGCTCTTCTTGG + Intergenic
1139927264 16:70496517-70496539 GCAGCACAAGGTGCTCTTTTAGG + Intronic
1141734293 16:85841929-85841951 AATGCACAGAGTGCTCTTGTGGG + Intergenic
1142033985 16:87852476-87852498 GAAGCACACGGTGCTATTTTGGG - Intronic
1144228378 17:13174091-13174113 CTAGCAGATGGTGCTGTTTTGGG - Intergenic
1147684127 17:42276687-42276709 CAAGCACATGCTGCTTTGTTTGG + Intronic
1149869860 17:60171598-60171620 CAAGCACACAGTGCTCCAGTAGG - Intergenic
1151254235 17:72863261-72863283 CAAGAACATGTTCCTCTTCTTGG + Intronic
1152629175 17:81402094-81402116 CAAGCGCAGGGTGCTCTAGAGGG + Intronic
1157889492 18:51401939-51401961 CAAGCATATTGGGCTATTGTAGG - Intergenic
1158706912 18:59800899-59800921 CATGCACCTGGTGCTCTGGGTGG + Intergenic
1160191895 18:76721651-76721673 CAATGACTTGGGGCTCTTGTGGG - Intergenic
1164012383 19:21214924-21214946 CAAGGACATGGTGACCTTCTTGG - Intergenic
1165824988 19:38700683-38700705 CAAGCTCATGCTGCTCCTGGAGG + Exonic
1166930502 19:46298688-46298710 CAAGGACATGGTAATCTGGTAGG - Intronic
925120859 2:1416946-1416968 TAAGCACATGGTGCTCCGGGGGG + Intronic
925430003 2:3783281-3783303 CATGCACAGGATGCTCTTGGAGG - Intronic
931414948 2:62072317-62072339 CAATCAAATGGTGCTGTTCTAGG + Intronic
932198453 2:69804605-69804627 CCTGCCGATGGTGCTCTTGTAGG - Exonic
932885872 2:75548755-75548777 CAAGAACAGGGTGCTCTAGGAGG - Intronic
937238247 2:120443322-120443344 CAACCTCATGGTGCTCTTTGAGG + Intergenic
937641016 2:124211549-124211571 CAACCACATTATGATCTTGTAGG + Intronic
942234559 2:173891355-173891377 CAAGTGCATGGTGCTCTTTGGGG - Intergenic
943541920 2:189226486-189226508 CAATCACATGGTGCTCTGTCAGG - Intergenic
944609019 2:201381065-201381087 CAAGCTCATGGTGCTACTGAAGG + Exonic
946844427 2:223846822-223846844 CAAGCTCATGGTGATCTCATTGG - Intergenic
948005759 2:234606321-234606343 CAAGCGCCAGGTGCTCTTGTAGG - Intergenic
1170753989 20:19181188-19181210 CAAGCACAATGTACTCTGGTTGG + Intergenic
1175120669 20:56713878-56713900 TAAGCACATTGTGATCTTGCTGG - Intergenic
1175328986 20:58149704-58149726 ATAGCACATGGTGCTTTTCTTGG - Intergenic
1176704360 21:10100995-10101017 CAGGCACATGGTGTTGTTGGTGG + Intergenic
1179124267 21:38577556-38577578 CAGGCTCCTGGTGCTCTCGTGGG + Intronic
1179826007 21:43966903-43966925 CAAGCAGGTGGGCCTCTTGTCGG - Intronic
1181033830 22:20160602-20160624 CAATCACCTGGTGCTGTTGGGGG - Intergenic
1181509525 22:23382801-23382823 CAATCACCTGGTGCTGTTGGGGG + Intergenic
1182941319 22:34280276-34280298 CCAGCACATGGTGCTCTCCTGGG - Intergenic
1184924202 22:47625952-47625974 CAGGAAGATGGTGCTCTGGTGGG - Intergenic
1185425884 22:50770108-50770130 CGAGCACATGGTGCTGTTTGTGG + Intronic
951835819 3:26982502-26982524 CTAGCATGTGGTGCTCTTGAGGG - Intergenic
955050456 3:55405660-55405682 CTACCACATGGTGCCGTTGTTGG - Intergenic
957005353 3:74939247-74939269 CAAGCACATAGTGCTGTTGATGG - Intergenic
959403970 3:105938151-105938173 CAAGCATATGGTCCTCTTCAAGG - Intergenic
961097329 3:124168871-124168893 CAAGCACATGGCACTATTCTGGG + Intronic
962205134 3:133428202-133428224 CAAGCCTAGGGTTCTCTTGTGGG + Intronic
962572868 3:136728532-136728554 CCACCACATGGGGCTATTGTAGG + Intronic
962698673 3:137975764-137975786 CAAGGACATGGAGTTCTTGTAGG - Intergenic
963777067 3:149450496-149450518 CAAGCACATGGTACTATTCCTGG + Intergenic
965576963 3:170227309-170227331 CAGGCACATGATGCTGTCGTAGG + Intronic
972676029 4:41260218-41260240 AAACCAGCTGGTGCTCTTGTTGG + Intronic
975941257 4:79649476-79649498 TAACCTCATGGTGCTCATGTGGG + Intergenic
977889102 4:102287065-102287087 CAAGTTCATAGTGCTATTGTAGG + Intronic
980376572 4:131957329-131957351 CAGGCACATGGTGCTGTTGGTGG + Intergenic
982443941 4:155468486-155468508 AAATCACTTGGTGCTATTGTGGG + Intergenic
985371091 4:189285485-189285507 CAAACACATGATGCCCATGTTGG + Intergenic
993710990 5:91224932-91224954 CAAGCACAAGGTGATAGTGTGGG + Intergenic
998631031 5:143898874-143898896 CAAGAACATAGTGCTTTTGTTGG - Intergenic
1002100722 5:176856280-176856302 CTGGCACATGCTGCTCTTGTAGG - Intronic
1002296347 5:178233153-178233175 CAAGCCCATGGTGATCTCCTTGG - Intergenic
1002359044 5:178655481-178655503 CGCACACATGCTGCTCTTGTCGG - Intergenic
1007942174 6:45791825-45791847 CAACCACATTGTTCTCTAGTAGG + Intergenic
1010399383 6:75430831-75430853 CCAGCAGATGGTACTCCTGTTGG + Intronic
1012866106 6:104619995-104620017 CAAATACATTGTGCTCGTGTTGG - Intergenic
1015903099 6:138087679-138087701 CCAGCCCAGGGTGCTCTTGGTGG + Intergenic
1017130788 6:151106790-151106812 TTAGGACATGGTGCTCTCGTAGG - Intergenic
1017236518 6:152122343-152122365 CAAGATCAAGGTCCTCTTGTTGG + Exonic
1017342654 6:153343821-153343843 AAATTACAAGGTGCTCTTGTGGG - Intergenic
1017822409 6:158059254-158059276 CAGGCACATGGTGCTTCTGAAGG + Exonic
1018792610 6:167160987-167161009 CAGGCAGAAGGTGGTCTTGTGGG - Intronic
1019066219 6:169300980-169301002 CAATCACATTTTTCTCTTGTTGG + Intergenic
1019179492 6:170177494-170177516 CACGGACATGGTCCTCTTGAAGG + Intergenic
1020494219 7:8827331-8827353 CAAGGACATGAAACTCTTGTGGG + Intergenic
1020961591 7:14811057-14811079 CAAGCTCATGGTGCTCTGCTTGG - Intronic
1023488742 7:40714554-40714576 CAAGCACATGGTTTTCATTTGGG - Intronic
1024958019 7:54946405-54946427 CAGTCACATGCTGCTCTTTTGGG + Intergenic
1037394653 8:18429197-18429219 CAAGTCCATGGTGCTCTGTTTGG - Intergenic
1044109947 8:88260083-88260105 CAAGCCCATGGTGATATTATTGG + Intronic
1047454115 8:124993516-124993538 CAAGCAGATGTTGCTCTGGAGGG - Intergenic
1048214890 8:132484996-132485018 CAAGCAAAGAGTGCTCTTTTTGG - Intergenic
1049097736 8:140558755-140558777 CCACCACGTGGTACTCTTGTAGG - Intronic
1050921581 9:11208884-11208906 CAAGTACTTGCTGCTGTTGTTGG + Intergenic
1051630493 9:19136192-19136214 GGAGCACATGGAGCTCTTGGGGG - Intronic
1053641621 9:40088011-40088033 CAGGCACATGGTGTTGTTGGTGG + Intergenic
1053764514 9:41377453-41377475 CAGGCACATGGTGTTGTTGGTGG - Intergenic
1054322509 9:63685400-63685422 CAGGCACATGGTGTTGTTGGTGG + Intergenic
1054543130 9:66288630-66288652 CAGGCACATGGTGTTGTTGGTGG - Intergenic
1054828626 9:69598685-69598707 CAAGAACCTTGTCCTCTTGTAGG - Intronic
1055134638 9:72814050-72814072 CAAGCACATAGAGCTCCTGAGGG - Intronic
1056622837 9:88228602-88228624 CTACCTCATGGTGCCCTTGTGGG - Intergenic
1061698892 9:132400022-132400044 AAAGCACAAGGTGAGCTTGTGGG - Exonic
1062036813 9:134386117-134386139 CAAGCAAGTGGTGCTCATGCTGG - Intronic
1062287521 9:135779622-135779644 CATGGACAGGGTGCTCTTGATGG + Intronic
1062313381 9:135952197-135952219 CAAGCCCAGGGTGCTCTTCCTGG + Intronic
1202789397 9_KI270719v1_random:71097-71119 CAGGCACATGGTGTTGTTGGTGG + Intergenic
1191258112 X:58288582-58288604 CCAGCACATGGTGCTCGAGAAGG - Intergenic
1192578573 X:72262088-72262110 GAAGCACGAGGTGCTCTTGGAGG - Intronic
1194312354 X:92327484-92327506 AAAGCACATGGGGGTCTTGCAGG - Intronic
1197520069 X:127486394-127486416 CAAGCACATGCTCCCCTTCTGGG + Intergenic
1197851544 X:130866536-130866558 AAAGCACATGATGCTTATGTTGG + Intronic
1200620622 Y:5441615-5441637 AAAGCACATGGGGGTCTTGCAGG - Intronic