ID: 1087583989

View in Genome Browser
Species Human (GRCh38)
Location 11:100094734-100094756
Sequence CAGGGAAAGAAGAAGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2476
Summary {0: 1, 1: 0, 2: 30, 3: 284, 4: 2161}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087583983_1087583989 4 Left 1087583983 11:100094707-100094729 CCAGGAGGAAAAAAGGAAAGAGA 0: 1
1: 1
2: 23
3: 138
4: 1294
Right 1087583989 11:100094734-100094756 CAGGGAAAGAAGAAGGAGGGAGG 0: 1
1: 0
2: 30
3: 284
4: 2161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087583989 Original CRISPR CAGGGAAAGAAGAAGGAGGG AGG Intronic
Too many off-targets to display for this crispr