ID: 1087584238

View in Genome Browser
Species Human (GRCh38)
Location 11:100098008-100098030
Sequence CAGAATTACCAAGATGAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 507
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 483}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087584237_1087584238 -4 Left 1087584237 11:100097989-100098011 CCTTCATTTGTTTCGTTGTCAGA 0: 1
1: 0
2: 1
3: 11
4: 165
Right 1087584238 11:100098008-100098030 CAGAATTACCAAGATGAGCTAGG 0: 1
1: 0
2: 0
3: 23
4: 483

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087584238 Original CRISPR CAGAATTACCAAGATGAGCT AGG Intronic
900070822 1:770458-770480 TAGAAATACAAAGATTAGCTAGG - Intergenic
901108467 1:6776236-6776258 TAGAATTACAAAAATTAGCTGGG + Intergenic
901415241 1:9111807-9111829 CAGAAATACAAAAATTAGCTGGG + Intronic
901785793 1:11623614-11623636 CAAAAATACAAAAATGAGCTGGG - Intergenic
901795119 1:11675430-11675452 CAGAAGAGCCAGGATGAGCTGGG + Intronic
901802425 1:11716027-11716049 CAGAAATACAAAAATTAGCTGGG - Intronic
902669348 1:17961822-17961844 CATGATCACCAAGATGAGGTTGG + Intergenic
903126135 1:21249180-21249202 CAAAATTACAAAAATTAGCTGGG + Intronic
903619289 1:24686177-24686199 CAGAAATACAAAAATTAGCTGGG - Intergenic
903809315 1:26026076-26026098 AAGAATTACAAACATTAGCTGGG + Intronic
904147518 1:28405485-28405507 CAAAAATACCAAAATTAGCTGGG - Intronic
904515835 1:31054164-31054186 AAAAAATACAAAGATGAGCTAGG + Intronic
905093735 1:35450869-35450891 GAGAATTTGCAAGATCAGCTAGG - Intronic
905426581 1:37890212-37890234 CAAAAATACAAAAATGAGCTGGG + Intronic
905659062 1:39706819-39706841 AAAAATTACAAAGATTAGCTTGG + Intronic
906325799 1:44844560-44844582 CAAAATTACAAAAATTAGCTAGG - Intergenic
908070419 1:60454392-60454414 CATATTGGCCAAGATGAGCTGGG + Intergenic
908394536 1:63713431-63713453 CAGAAGTGGCAAGATGAGGTTGG + Intergenic
908840457 1:68275119-68275141 AAGAAATACAAAGATTAGCTGGG + Intergenic
909456784 1:75858842-75858864 CAGAGGTACAAAGAGGAGCTGGG - Intronic
909553175 1:76922773-76922795 TAGAAATACAAAAATGAGCTGGG + Intronic
909678136 1:78260666-78260688 CAGAGGTACAAAGAAGAGCTGGG + Intergenic
910844239 1:91590114-91590136 CAGAAATACAAAAATTAGCTTGG - Intergenic
910854039 1:91676983-91677005 CAGAAATACAAAAATTAGCTGGG - Intergenic
910889362 1:92001173-92001195 TAGAATTACCAGGATTGGCTTGG + Intronic
911485224 1:98497212-98497234 AAGAATGACCAAGGAGAGCTTGG - Intergenic
911618648 1:100041761-100041783 CAAAATTACAAAAATGAGCTAGG + Intronic
912639100 1:111327433-111327455 CAGAAGTACAAAGAAGAGCTGGG - Intergenic
914457961 1:147854668-147854690 CAGTCTTAATAAGATGAGCTGGG - Intergenic
914706983 1:150178282-150178304 AAGAAATACAAAGATTAGCTGGG + Intergenic
915018428 1:152758233-152758255 CAGAGTTTACGAGATGAGCTAGG + Intronic
915919900 1:159968308-159968330 AAGAATTACAAAAATGAGATGGG - Intergenic
916439942 1:164814577-164814599 CAAAATTACAAAAATTAGCTGGG + Intronic
916690483 1:167185511-167185533 TAAAATTACCAAAATTAGCTGGG + Intergenic
916904381 1:169266027-169266049 CAGATGTACAAAGAAGAGCTAGG + Intronic
916977630 1:170098683-170098705 CAGCATTACCAGGTTGAGTTTGG - Intergenic
917558651 1:176120257-176120279 CAAAAATACAAAAATGAGCTGGG + Intronic
917866858 1:179204448-179204470 CAAAAATACTAAGATGAGCTGGG + Intronic
917874195 1:179270718-179270740 CAGAAATACGAAAATTAGCTGGG - Intergenic
918209382 1:182337544-182337566 CAGAAATACGAAAATTAGCTGGG + Intergenic
918285374 1:183049622-183049644 TAAAATTACAAAAATGAGCTGGG - Intronic
918306955 1:183255822-183255844 CAGAAATACAAAAATTAGCTGGG - Intronic
919453061 1:197793473-197793495 CAAAATTACAAAAATTAGCTTGG + Intergenic
919594483 1:199545269-199545291 CAGAATGAGCAAGAGGCGCTAGG + Intergenic
919956702 1:202424482-202424504 CAAAAATACAAAAATGAGCTGGG - Intronic
922295475 1:224246189-224246211 CAAAAATACAAAGATTAGCTGGG - Intronic
923183445 1:231546819-231546841 CATGATTTCCAAGATGAGCCAGG + Intronic
924497595 1:244605148-244605170 CAGAATTACTATGATGAGAACGG - Intronic
1063599815 10:7470206-7470228 CAGAATTGCCATCCTGAGCTGGG + Intergenic
1064065487 10:12177556-12177578 CAGCATTGCCAAGAGGAGGTTGG + Intronic
1064143633 10:12810433-12810455 TAGAAATACCAAAATTAGCTGGG - Intronic
1064764032 10:18652718-18652740 TAAAATTACAAAGATTAGCTGGG - Intronic
1065652067 10:27902862-27902884 CAGAGGTACAAAGAGGAGCTGGG + Intronic
1065679821 10:28217671-28217693 CTGAATTACTAAGATGAGGCAGG + Intronic
1065929704 10:30468909-30468931 CAAAATTACAAAAATTAGCTGGG - Intergenic
1065962285 10:30743498-30743520 GAGAAATACCAAGAGGAGTTTGG + Intergenic
1066078880 10:31909733-31909755 AAGAATTACAAAAATTAGCTGGG + Intronic
1066080049 10:31921601-31921623 CAAAAATACAAAAATGAGCTGGG + Intronic
1066199371 10:33130341-33130363 TAGAATTCCTAATATGAGCTGGG - Intergenic
1066710251 10:38225789-38225811 AAGACTTACCAAGATGCTCTGGG + Intergenic
1066979747 10:42401631-42401653 AAGACTTACCAAGATGCTCTGGG - Intergenic
1067331074 10:45319679-45319701 CAAAAATACCAAAATTAGCTGGG - Intergenic
1067984408 10:51125519-51125541 CAGAAATACAAAAATTAGCTGGG + Intronic
1068944899 10:62719942-62719964 CAGAATTTTAAAAATGAGCTGGG + Intergenic
1070196586 10:74162703-74162725 CAAAAATACAAAAATGAGCTGGG - Intronic
1070313563 10:75291285-75291307 TAAAATTAAAAAGATGAGCTAGG - Intergenic
1070913327 10:80136806-80136828 AAGAATTAGCTAGACGAGCTGGG - Intronic
1071883406 10:89923842-89923864 CAGAAAGAACAAGATGAGCCTGG - Intergenic
1072173165 10:92887558-92887580 CAAAAATACCAAAATTAGCTGGG - Intronic
1072186259 10:93041870-93041892 CAAAAATACCAAAATTAGCTGGG - Intronic
1072707939 10:97695586-97695608 CAAAATTATCAAGATCTGCTAGG + Intergenic
1072932921 10:99682867-99682889 CAGAATTGACCAGCTGAGCTGGG + Intronic
1073174503 10:101544891-101544913 CAAAAATACAAAGATTAGCTGGG + Intronic
1074885970 10:117693910-117693932 CAGAATTCCCAGGATGAGGTGGG - Intergenic
1075251339 10:120877456-120877478 CAGAAATACAAAAATTAGCTGGG + Intronic
1075576553 10:123582038-123582060 CAGAATAACCAAGACCAGCGTGG + Intergenic
1076759028 10:132590932-132590954 GAACATTACCAAGGTGAGCTTGG + Intronic
1076918245 10:133437070-133437092 TAAAATTACAAAAATGAGCTGGG - Intergenic
1077890326 11:6413611-6413633 AAGAATTACAAAAATTAGCTGGG - Intronic
1078323549 11:10358764-10358786 CAGAAGTATCAAGATGATATCGG + Intronic
1079233824 11:18673124-18673146 CAAAAATACAAAAATGAGCTGGG - Intergenic
1079948361 11:26770605-26770627 TAGAATTACCAGTATCAGCTGGG - Intergenic
1080257592 11:30308653-30308675 AAGAACTACCAACAAGAGCTTGG - Intergenic
1080844087 11:36011098-36011120 AAGAATTACTAAGAGGGGCTGGG - Intronic
1081745680 11:45470887-45470909 CAGAATTACCAAGACCAGCAGGG - Intergenic
1082665735 11:55973215-55973237 GAGAACTACAAAGATGACCTAGG - Intergenic
1082780038 11:57280230-57280252 CAGATGTACAAAGAAGAGCTTGG - Intergenic
1083373294 11:62198963-62198985 CAAAATTACAAAAATTAGCTGGG + Intergenic
1084777160 11:71384910-71384932 TAAAAATACCAAGATTAGCTGGG + Intergenic
1085957799 11:81421399-81421421 CAGTATTACAAAGAAAAGCTAGG - Intergenic
1086190115 11:84069170-84069192 CAGCATTACCAGGATCACCTAGG - Intronic
1087100775 11:94362313-94362335 CAGAGGTACAAAGAGGAGCTGGG + Intergenic
1087584238 11:100098008-100098030 CAGAATTACCAAGATGAGCTAGG + Intronic
1087913731 11:103783121-103783143 CACAATTCCCAAGAAGTGCTGGG - Intergenic
1087934467 11:104016495-104016517 CAGACTTACCAAGACTGGCTTGG + Intronic
1088053164 11:105543373-105543395 CTGAATTGCCAAAAGGAGCTTGG + Intergenic
1088462732 11:110099649-110099671 CACAATTACAAAAATCAGCTGGG + Intronic
1088634222 11:111803970-111803992 TAAAAATACCAAAATGAGCTGGG + Intronic
1089443726 11:118535188-118535210 TAGAATTCCCAAGAGGAGGTGGG - Exonic
1090687173 11:129135212-129135234 CAGAAGTACCAAGATAAGAAGGG + Intronic
1090869771 11:130733404-130733426 CAGATTTTCCAAGGTGAGTTTGG + Intergenic
1091499945 12:1006541-1006563 AAAAATTACAAAAATGAGCTGGG - Intronic
1091752029 12:3028789-3028811 CAAAAATACAAAAATGAGCTGGG - Intronic
1092493028 12:8963612-8963634 CAGAGGTACAAAGAGGAGCTGGG - Intronic
1092968797 12:13671824-13671846 CAGAATTACAGAGGTGAGCAAGG + Intronic
1093568350 12:20635415-20635437 CAAAATTACCAAAATTAGCCGGG + Intronic
1093650154 12:21634100-21634122 TAGAATTACAAAAATGAGCTGGG - Intergenic
1094187815 12:27663677-27663699 CAAAAATACAAAAATGAGCTGGG + Intronic
1094241997 12:28238956-28238978 CAAAAGTACAAAGATTAGCTGGG + Intronic
1094329909 12:29280083-29280105 CAGAAATACAAAAATTAGCTAGG - Intronic
1095494771 12:42772811-42772833 CAAAATTACAAAAATTAGCTGGG + Intergenic
1095515179 12:42997912-42997934 CAAAAATACAAAAATGAGCTGGG - Intergenic
1096376917 12:51120016-51120038 CAAAATTACAAAAATTAGCTGGG + Intronic
1096721033 12:53522261-53522283 AAGAAATACCTAGATGTGCTGGG + Intronic
1098182846 12:67866439-67866461 CAGAGGTACAAAGAGGAGCTGGG - Intergenic
1099897849 12:88671018-88671040 CAGAGTTACAAAGAGGAGTTGGG + Intergenic
1100151290 12:91741328-91741350 AAAAATGATCAAGATGAGCTGGG + Intergenic
1100194604 12:92230466-92230488 CTGATTTAAGAAGATGAGCTTGG + Intergenic
1100310406 12:93389738-93389760 TAAAAGTACCAAAATGAGCTGGG + Intronic
1100476348 12:94939150-94939172 CATAATGACCAGCATGAGCTGGG - Intronic
1100526546 12:95424873-95424895 CAGAAGTACAAAAATTAGCTGGG - Intergenic
1100716432 12:97311196-97311218 CAAAAGTACAAAGATTAGCTGGG + Intergenic
1100999510 12:100343774-100343796 TAAAATTACCAAAATTAGCTGGG - Intergenic
1101767659 12:107717309-107717331 CAAAAATACAAAAATGAGCTGGG + Intergenic
1103119222 12:118366927-118366949 TAAAATTACCAAAATTAGCTGGG + Intronic
1103367311 12:120392727-120392749 CAAAATTACAAAAATTAGCTGGG + Intergenic
1103691892 12:122781881-122781903 AAGAAATACAAAAATGAGCTGGG + Intronic
1104183521 12:126405762-126405784 CAAAAATACCAAAATTAGCTGGG - Intergenic
1104486059 12:129152036-129152058 CAAAATTACAAAAATTAGCTGGG - Intronic
1105396615 13:20042882-20042904 TAGAAATACAAAAATGAGCTGGG - Intronic
1106380524 13:29233658-29233680 CAGAATTAAAAAGCTGAGATTGG - Intronic
1107525454 13:41226848-41226870 CAGAAATGCCCGGATGAGCTAGG - Intronic
1107653015 13:42563500-42563522 CAAAATTACAAAAATTAGCTGGG + Intronic
1107927658 13:45278982-45279004 CAAAATTACAAAAATTAGCTGGG - Intronic
1108252982 13:48585196-48585218 CAAAATTACAAAAATTAGCTGGG - Intergenic
1109421140 13:62114663-62114685 CAAAAATACAAAGATTAGCTGGG - Intergenic
1110218890 13:73051991-73052013 TAGAAATAAAAAGATGAGCTGGG - Intergenic
1111932951 13:94530202-94530224 CAGAGGTACAAAGAGGAGCTGGG + Intergenic
1112646354 13:101337467-101337489 CAGAAATACAAAAATTAGCTGGG - Intronic
1112780171 13:102891849-102891871 CAAAATTACAAAAATTAGCTTGG - Intergenic
1114202853 14:20539092-20539114 TAAAATTACAAAGATTAGCTGGG - Intergenic
1114589522 14:23847770-23847792 CAGATGTACAAAGAAGAGCTGGG - Intergenic
1115071532 14:29328661-29328683 CAAAAATACCAAAATTAGCTGGG - Intergenic
1115552644 14:34518492-34518514 CAAAAATACCAAAATTAGCTGGG - Intronic
1115911591 14:38262834-38262856 CAGATATACAAAGAAGAGCTGGG + Intergenic
1115984490 14:39089793-39089815 CAAAAATACCAAAATTAGCTGGG + Intronic
1116535766 14:46027405-46027427 TAGAATTACCAAGATGCTGTAGG + Intergenic
1117586107 14:57207112-57207134 CAGTGTTACCAAGGTAAGCTGGG - Exonic
1117739321 14:58800016-58800038 TAGAATTACAAAAATTAGCTGGG - Intergenic
1118192910 14:63596372-63596394 CAAAAATACAAAAATGAGCTAGG - Intergenic
1118519303 14:66563778-66563800 CAGAATTAGCAAGATTAAGTTGG - Intronic
1119328055 14:73773859-73773881 CTGAAATACAAAAATGAGCTGGG + Intronic
1119524279 14:75309911-75309933 CAGAAATACAAAAATTAGCTGGG + Intergenic
1120168361 14:81224075-81224097 CAAAATTACAAAAATTAGCTGGG - Intergenic
1120399530 14:84011524-84011546 GAGAATTACCAAAATGGTCTTGG - Intergenic
1122229817 14:100300541-100300563 CAAAATTACAAAAATTAGCTGGG - Intronic
1122754213 14:103965049-103965071 CAGAAATACAAAAATTAGCTGGG + Intronic
1125687331 15:41571205-41571227 TAGATTTTCCAAGAAGAGCTGGG + Intronic
1125702269 15:41697575-41697597 CAAAATTACAAAAATTAGCTGGG - Intronic
1125992994 15:44128317-44128339 CAGAAATACAAAAATTAGCTGGG + Intronic
1126023268 15:44422624-44422646 CAAAAATACAAAAATGAGCTGGG - Intergenic
1126425170 15:48519779-48519801 AAGAATTAAAAAGATGAACTGGG + Intronic
1126485698 15:49178006-49178028 CAAAATTACAAAAATTAGCTGGG + Intronic
1127322640 15:57862760-57862782 GAGAATTTCCAAGACAAGCTGGG + Intergenic
1127494684 15:59498813-59498835 CAGAAATACAAAAATTAGCTGGG - Intronic
1128000727 15:64188963-64188985 TAAAATTACAAAAATGAGCTGGG + Intronic
1128634027 15:69291487-69291509 CAAAAATACCAAAATTAGCTGGG - Intergenic
1128741746 15:70088762-70088784 CAGAATTACCAATATGAGAAAGG + Intronic
1129104759 15:73298721-73298743 CAGAATTGCTAAGATAGGCTTGG - Intronic
1129262870 15:74378556-74378578 CAGAATTTCCAGGATCACCTGGG - Intergenic
1130161904 15:81409889-81409911 CACAATTACAAAAATTAGCTGGG + Intergenic
1130442243 15:83966592-83966614 CAGAGGTACAAAGAGGAGCTTGG + Intronic
1130609067 15:85344136-85344158 AAAAATTACAAAAATGAGCTGGG + Intergenic
1131589213 15:93730475-93730497 CAGAGGTACAAAGAGGAGCTGGG - Intergenic
1132311726 15:100862330-100862352 CTGAAGAACCAAGGTGAGCTGGG + Intergenic
1132489620 16:219226-219248 CAAAAATACAAAAATGAGCTGGG + Intronic
1133223953 16:4331578-4331600 CAGATTTGCCAAGACCAGCTCGG - Intronic
1134015834 16:10887654-10887676 CAAAAATACAAAAATGAGCTGGG - Intronic
1134394908 16:13853865-13853887 CAAAAATACAAAGATTAGCTGGG + Intergenic
1135521211 16:23179866-23179888 CAGAATTAGCAAGATTAGTGAGG + Intergenic
1135573720 16:23568656-23568678 TAAAATTACAAAGATTAGCTGGG + Intronic
1135605552 16:23821291-23821313 CGGAATTACCATGATTAGCTTGG + Intergenic
1136112294 16:28071444-28071466 CAAAAATACAAAGATTAGCTAGG - Intergenic
1136419892 16:30125255-30125277 CAAAAATACAAAAATGAGCTGGG + Intergenic
1136985167 16:35096393-35096415 AAAAATTACCAAAATTAGCTGGG + Intergenic
1137243243 16:46677694-46677716 AAAAATTACCAAAATTAGCTGGG - Intronic
1138094305 16:54200069-54200091 CAGAAAGATGAAGATGAGCTGGG - Intergenic
1139405009 16:66711261-66711283 CAAAAATACAAAGATTAGCTGGG - Intergenic
1139892652 16:70263795-70263817 CAGAAATACAAAAATTAGCTAGG - Intronic
1140291113 16:73658461-73658483 CAGAAATACAAAAATTAGCTGGG - Intergenic
1140328326 16:74027801-74027823 TAAAATTACAAAGATGAGCTGGG - Intergenic
1141383550 16:83598202-83598224 CAAAATTACAAAAATTAGCTGGG + Intronic
1141573909 16:84951971-84951993 TAGAAATACAAAGATTAGCTGGG + Intergenic
1142467951 17:146754-146776 GAGAAATACCAAGACCAGCTTGG - Intergenic
1143676713 17:8438674-8438696 CAAAAATACAAAAATGAGCTGGG - Intronic
1143949599 17:10622100-10622122 CAAAATTACAAAAATTAGCTGGG + Intergenic
1145896857 17:28463704-28463726 TAAAATTACAAAAATGAGCTGGG - Intronic
1146290630 17:31604389-31604411 CAAAACTACCAAGAAGAGCCAGG - Intergenic
1146336298 17:31974060-31974082 CAAAAATACAAAAATGAGCTAGG + Intronic
1146850401 17:36216603-36216625 CAAAAGTACCAAAATTAGCTGGG + Intronic
1147490154 17:40858634-40858656 CAAAATTACAAAAATTAGCTGGG + Intergenic
1149339357 17:55669993-55670015 CAGAATTTCCAAGCAGAGATAGG + Intergenic
1149505405 17:57189936-57189958 CAAAAATACAAAAATGAGCTGGG - Intergenic
1150168877 17:62970779-62970801 CAGAATCACCAATGTTAGCTGGG + Intergenic
1150176313 17:63060458-63060480 CAGAAATACAAAAATTAGCTGGG + Intronic
1150389641 17:64782883-64782905 CAGAAATACAAAAATTAGCTGGG - Intergenic
1150810133 17:68349720-68349742 CAAAAATACAAAGATTAGCTGGG + Intronic
1150895446 17:69204965-69204987 CAAAATTACCAAAATTAGCTGGG + Intronic
1152076260 17:78161681-78161703 TAAAATTACAAAGATTAGCTGGG + Intronic
1152398029 17:80047004-80047026 CAGAAATACAAAAATTAGCTGGG - Intronic
1152485758 17:80591537-80591559 TAAAATTACAAAAATGAGCTGGG - Intronic
1152526195 17:80889555-80889577 CAGCTTTTGCAAGATGAGCTTGG - Intronic
1152637070 17:81434602-81434624 CAGAAGGACCAAGATCACCTGGG - Intronic
1152983107 18:297459-297481 CCTAATTACCAAGAGGAGCTAGG + Intergenic
1154230021 18:12547779-12547801 TAAAATTACAAAAATGAGCTGGG + Intronic
1154981222 18:21504092-21504114 CAAAAATACCAAAATTAGCTGGG - Intronic
1155002962 18:21704494-21704516 CAGCATTGCCAAGGTGAGCCGGG - Exonic
1157698062 18:49739453-49739475 CAGACTCAGCAAGATGATCTAGG - Intergenic
1157844410 18:50989561-50989583 TAAAATTACAAAGATTAGCTAGG + Intronic
1160478338 18:79214985-79215007 CAGAAATACAAAAATTAGCTGGG + Intronic
1161367652 19:3890102-3890124 TAAAAATACAAAGATGAGCTGGG - Intronic
1161817865 19:6510879-6510901 CAGAATCTCCAAGATGACCATGG - Intergenic
1161865630 19:6830217-6830239 CAAAACTACAAAGATTAGCTGGG - Intronic
1163254555 19:16147804-16147826 CAAAAATACAAAAATGAGCTGGG - Intronic
1164895312 19:31871960-31871982 CAGAATGACCAGGATCAGTTGGG + Intergenic
1166385724 19:42379583-42379605 CAAAATTACAAAAATTAGCTGGG - Intergenic
1166992403 19:46700470-46700492 CAGAAATACAAAAATTAGCTGGG + Intronic
1167167637 19:47810092-47810114 TAGAAATACAAAAATGAGCTGGG + Intronic
1167340832 19:48914917-48914939 CAAAAATACCAAAATTAGCTGGG + Intronic
1167351352 19:48976947-48976969 CAAAAATACAAAAATGAGCTGGG - Intronic
925638239 2:5962938-5962960 CAGAAATACAAAAATTAGCTGGG - Intergenic
927164756 2:20306766-20306788 CAAAATTACAAAAATTAGCTGGG - Intronic
927336801 2:21934244-21934266 GAGAATTAAGAATATGAGCTAGG + Intergenic
927687983 2:25185664-25185686 TAAAATTACAAAAATGAGCTGGG - Intergenic
927736501 2:25527360-25527382 CAAAATTACAAAAATTAGCTGGG + Intronic
928502580 2:31912350-31912372 AAGAATTACAAAAATTAGCTGGG + Intronic
929058070 2:37895758-37895780 TAGAATTACAAAAATTAGCTGGG + Intergenic
929256790 2:39819809-39819831 TAAAATTACCAAAATTAGCTGGG + Intergenic
930447956 2:51498749-51498771 CAGAGGTACAAAGAGGAGCTGGG - Intergenic
930737340 2:54793104-54793126 CAAAATTACAAAAATTAGCTGGG + Intronic
931182991 2:59922090-59922112 CAGAATTGAAGAGATGAGCTGGG + Intergenic
931270201 2:60694944-60694966 CAAAAATACCAAAATTAGCTGGG - Intergenic
935052378 2:99534745-99534767 CAAAATTAGCAAAATTAGCTAGG + Intergenic
935647882 2:105356228-105356250 TAGAAATACAAAAATGAGCTGGG + Intergenic
935846594 2:107172469-107172491 CAAAATTCACAAGATGAGCCTGG - Intergenic
935885333 2:107612468-107612490 TAGAATAACCAAGAACAGCTGGG - Intergenic
937080385 2:119136147-119136169 CTGAATGACCAAGCTGGGCTAGG + Intergenic
939041582 2:137195448-137195470 CAGAAAAAACAAGATGAGCTTGG + Intronic
939247250 2:139641713-139641735 CAGACATACAAAGAAGAGCTGGG - Intergenic
939963708 2:148590028-148590050 CAAAAATACCAAAATTAGCTGGG + Intergenic
940861249 2:158772542-158772564 CAGAATTAGAAAGCTGAGCCTGG + Intergenic
940924557 2:159349755-159349777 CAGAAGATCCAAGAGGAGCTGGG + Exonic
942148884 2:173055330-173055352 CAGAAATACAAAAATTAGCTGGG + Intergenic
942746962 2:179245219-179245241 AAAAATTAGCCAGATGAGCTGGG + Intronic
942969326 2:181938732-181938754 CAAAATTACAAAAATTAGCTGGG - Intergenic
943045789 2:182860704-182860726 CAGAAATACAAAAATTAGCTGGG + Intronic
943255127 2:185585044-185585066 CAGAATTGCCAAGGCCAGCTTGG + Intergenic
943949816 2:194119271-194119293 AACAATTACCAAAATTAGCTGGG + Intergenic
944086145 2:195850168-195850190 GAGAATAACCAAAATGAGCATGG + Intronic
944232191 2:197407442-197407464 TAGAAATACAAAGATGAGCCGGG + Intronic
944632492 2:201641905-201641927 CACAATTACCAAGGAGAGGTAGG + Intronic
945041012 2:205743902-205743924 CAGAAATACAAAAATTAGCTAGG - Intronic
945591630 2:211739622-211739644 CAAAATTACAAAAATTAGCTGGG - Intronic
946837948 2:223791091-223791113 CAGAGGTACAAAGAAGAGCTGGG + Intronic
947567296 2:231202481-231202503 CAGAAATACAAAAATTAGCTGGG - Intronic
947858225 2:233338870-233338892 AAGGATTACCAAGTAGAGCTTGG + Intronic
948472931 2:238197033-238197055 CAGAAATACAAAAATTAGCTAGG + Intronic
1169613975 20:7417709-7417731 CAGGATTTCCAAGATGGTCTGGG + Intergenic
1169990529 20:11498148-11498170 CAGAAATACCAACATGATTTGGG - Intergenic
1170488483 20:16845179-16845201 TTGAATTACCAAAATGACCTCGG + Intergenic
1170561256 20:17560461-17560483 CAGAAATGCCAAGATAAACTTGG - Intronic
1170736159 20:19015686-19015708 CAGCATTGAGAAGATGAGCTGGG + Intergenic
1170835440 20:19880086-19880108 CAAAATTACAAAAATTAGCTGGG + Intergenic
1171235450 20:23520744-23520766 CAGCAGTGCCAAGAGGAGCTGGG + Intergenic
1171302859 20:24078937-24078959 CAAAATTACAAAAATTAGCTGGG - Intergenic
1171426578 20:25052291-25052313 CAGCATTTCCAAGAAGAGTTGGG + Intronic
1172598126 20:36164462-36164484 CAGAATTTCCAAGAACACCTGGG + Intronic
1172820208 20:37725821-37725843 CAGAAATAAAAAAATGAGCTGGG + Intronic
1173064201 20:39694223-39694245 CAGAATTTCCTAAATTAGCTCGG + Intergenic
1173608193 20:44346979-44347001 CAAAAATACCAAAATTAGCTGGG + Intronic
1174009808 20:47440503-47440525 CAAAAATACCAAAATTAGCTGGG + Intergenic
1174337501 20:49873608-49873630 CAAAAATACAAAAATGAGCTGGG + Intronic
1174601876 20:51731556-51731578 TAGAATTACAAAAATTAGCTGGG + Intronic
1175011812 20:55745206-55745228 GAGAATTACCAACAGGAGGTGGG + Intergenic
1175793765 20:61758482-61758504 CAGAATTGCCACGAGGAGTTAGG + Intronic
1176289892 21:5038174-5038196 CTGAATTTCCATGATGAGCCGGG + Intronic
1177023190 21:15888527-15888549 CAGAATTACCATGAGCAGGTAGG - Intergenic
1177789362 21:25706340-25706362 TAAAAATACAAAGATGAGCTGGG - Intronic
1177986174 21:27978046-27978068 CAAAATTACAAATATTAGCTGGG - Intergenic
1178310596 21:31526860-31526882 TAAAAATACCAAAATGAGCTTGG - Intronic
1179216814 21:39374541-39374563 CAAAAATACAAAAATGAGCTGGG + Intergenic
1179867359 21:44225465-44225487 CTGAATTTCCATGATGAGCCGGG - Intronic
1181461278 22:23087303-23087325 CAAAATTAAAAAGATTAGCTGGG + Intronic
1181472118 22:23146801-23146823 CAGATTTACCTTGAGGAGCTGGG + Intronic
1181825152 22:25508997-25509019 AAGAATTACAAAAATTAGCTGGG - Intergenic
1183549917 22:38476199-38476221 TGGAATTACCATGATCAGCTAGG + Intronic
949706529 3:6824447-6824469 CAGAATCCCAAAGATGAGCTGGG + Intronic
950187275 3:10952852-10952874 CAGAACCTCCAAGATGAGCAGGG + Intergenic
950350334 3:12344019-12344041 CAAAAATACAAAAATGAGCTGGG - Intronic
950367115 3:12494963-12494985 CAAAAATACAAAAATGAGCTGGG + Intronic
951450287 3:22829894-22829916 CAGAAGTACAAAGAGGAGCTGGG + Intergenic
951524687 3:23642611-23642633 CAGAAATACAAAAATTAGCTGGG + Intergenic
952031146 3:29144160-29144182 CAGAACAACAAAGATTAGCTGGG - Intergenic
952405317 3:32999809-32999831 CAAAAATACAAAAATGAGCTGGG - Intronic
952587246 3:34907671-34907693 CAGAGGTACAAAGAGGAGCTGGG + Intergenic
953056300 3:39390099-39390121 CAAAATTACAAAAATTAGCTGGG - Intronic
953065976 3:39471573-39471595 CTGAAATACCAAGAGGAGTTTGG - Intronic
954236769 3:49263027-49263049 CAAAAATACCAAAATTAGCTGGG - Intergenic
954253398 3:49386034-49386056 CAGAATAACCAAAATAATCTTGG - Intronic
954301570 3:49703324-49703346 CAGAATTCCCAGGCTGTGCTAGG + Intronic
954567814 3:51613604-51613626 TAGAAATACAAAGATTAGCTGGG + Intronic
954657356 3:52203378-52203400 CAAAAATACAAAGATTAGCTGGG + Intronic
954943253 3:54394031-54394053 CAGAGTTACCACTATGAGGTAGG + Intronic
954991219 3:54842369-54842391 TGGAATTTTCAAGATGAGCTAGG + Intronic
955197934 3:56822690-56822712 TAGAATTACAAAAATTAGCTGGG + Intronic
955204917 3:56887255-56887277 CACAATTAGCAACATGTGCTGGG + Intronic
955688397 3:61566666-61566688 CAAAATTACAAAAATTAGCTAGG - Intronic
956602742 3:71039977-71039999 CAGAAATTCCAAAATGACCTTGG + Intronic
958656151 3:97006194-97006216 CAGAAATACAAAGAGGAGCTGGG - Intronic
958805658 3:98806952-98806974 GAGACTTAGCAAGATGAGTTAGG - Intronic
960197431 3:114786540-114786562 CAGAATTTCCAAGAGGAGTGGGG + Intronic
960335743 3:116415562-116415584 AAGAATTACCCAGATCATCTTGG + Intronic
960734748 3:120766441-120766463 CAGACTTAACAAGATAAACTGGG - Intronic
961205690 3:125079641-125079663 AAAAATTACAAAGATTAGCTGGG + Intergenic
961704129 3:128771128-128771150 CAGAAATACAAAAATTAGCTGGG - Intronic
961708709 3:128810107-128810129 AAAAATTACCAAAATTAGCTGGG - Intronic
961853220 3:129842303-129842325 CAAAACTACCAAAATTAGCTGGG + Intronic
961902884 3:130231470-130231492 CAGGGTTACCAAGGAGAGCTTGG + Intergenic
962206413 3:133438372-133438394 CAAAATTACAAAAATTAGCTGGG + Intronic
964171425 3:153775079-153775101 CAAAAATACAAAGATTAGCTGGG - Intergenic
965608314 3:170518711-170518733 GAGAATGACCAGGATGAACTTGG + Intronic
966388523 3:179427442-179427464 CAAAATTACAAAAATTAGCTGGG + Intronic
967668561 3:192204723-192204745 CAAAAATACAAAAATGAGCTGGG + Intronic
968053895 3:195676172-195676194 CAGAAATACAAAAATTAGCTGGG + Intergenic
968185932 3:196633698-196633720 CAAAACTGCAAAGATGAGCTGGG + Intergenic
968436081 4:590246-590268 CAGAAATACAAAAATTAGCTGGG - Intergenic
970055950 4:11972112-11972134 TAAAAATACAAAGATGAGCTGGG - Intergenic
971046956 4:22815557-22815579 CAAAATTACAAAAATTAGCTGGG - Intergenic
971466848 4:26972817-26972839 CAGAGGTACAAAGAGGAGCTGGG - Intronic
972394801 4:38649566-38649588 CAAAAATACAAAAATGAGCTGGG + Intergenic
972863567 4:43202232-43202254 CAGAATTTTAAAAATGAGCTAGG - Intergenic
973388833 4:49534987-49535009 CAAAATTACAAAAATTAGCTGGG + Intergenic
973694401 4:53476134-53476156 TAGAAATACAAAAATGAGCTGGG + Intronic
974520718 4:62977039-62977061 AAGAATTCCTAAGCTGAGCTGGG + Intergenic
975089582 4:70386110-70386132 CAAAATTACAAAAATTAGCTAGG + Intronic
975301881 4:72799732-72799754 CAGAGGTACAAAGAGGAGCTAGG + Intergenic
975885256 4:78957386-78957408 CAGAATTTCCCACATCAGCTTGG + Intergenic
976312776 4:83628766-83628788 CAGAAATACAAAAATTAGCTGGG + Intergenic
977203551 4:94145045-94145067 CAGAGGTACAAAGAGGAGCTGGG - Intergenic
977349971 4:95871068-95871090 CAGAATTACTAAGACTAGCTAGG - Intergenic
978152875 4:105457947-105457969 AAGAATACCCAAGATGAGCCTGG + Intronic
978922990 4:114208117-114208139 TAGAAATACAAAAATGAGCTGGG + Intergenic
979067758 4:116159328-116159350 CAGATTTACCAAGTTGAGATGGG + Intergenic
981330398 4:143501904-143501926 CAGAATTATTAAGATAAGTTGGG + Intergenic
981332130 4:143523185-143523207 CAAAAATACAAAAATGAGCTGGG - Intronic
982209839 4:153025301-153025323 CAAAATTACAAAAATTAGCTGGG + Intergenic
982471669 4:155798996-155799018 CAAAAATACAAAAATGAGCTGGG - Intronic
982698516 4:158631930-158631952 CAAAAATACAAAGATTAGCTGGG + Intronic
982728578 4:158931407-158931429 CAAAATTACAAAAATTAGCTGGG - Intronic
984122922 4:175768932-175768954 CAAAAATACCAAAATTAGCTGGG + Intronic
984193542 4:176632704-176632726 CAAAAATACAAAAATGAGCTGGG - Intergenic
984212015 4:176861495-176861517 CATAGTTAAAAAGATGAGCTGGG + Intergenic
984812543 4:183807627-183807649 CAGGATTAAGAAGCTGAGCTGGG - Intergenic
984971653 4:185196936-185196958 CAAAAATACAAAGATTAGCTGGG + Intronic
985395007 4:189533248-189533270 CAAAATTACAAAAATTAGCTGGG + Intergenic
986694994 5:10343838-10343860 CAAAATTACAAAAATTAGCTGGG + Intergenic
988317532 5:29649844-29649866 CATAATTACAAAAATTAGCTGGG + Intergenic
988925360 5:35984631-35984653 CAAAAATACAAAAATGAGCTGGG - Intronic
990064946 5:51700859-51700881 CAGAGGTACAAAGATGAGCTGGG - Intergenic
991097043 5:62750450-62750472 CAGAAATACAAAAATTAGCTGGG + Intergenic
991232138 5:64346528-64346550 TAGAAATACAAAGATTAGCTGGG - Intronic
992270239 5:75055572-75055594 CAAAAATACAAAAATGAGCTGGG - Intergenic
992424670 5:76644458-76644480 AAAAAATACCAAAATGAGCTGGG - Intronic
992692556 5:79255471-79255493 TACAAGTACCAAGATGATCTAGG - Intronic
995877273 5:116803543-116803565 CAGAAATACAAAAATTAGCTGGG - Intergenic
997166672 5:131667747-131667769 CAAAAATACAAAGATTAGCTGGG - Intronic
997597684 5:135117978-135118000 CAGAATTAGCAGAATTAGCTTGG - Intronic
998034932 5:138907180-138907202 CAGAAATACAAAAATTAGCTGGG - Intronic
998120537 5:139573003-139573025 AAGAATTATCAAGATGAGGCTGG + Intronic
998691243 5:144591021-144591043 CAGAGGTACAAAGAGGAGCTGGG - Intergenic
1000122757 5:158212966-158212988 CAGAATTCTGAAGTTGAGCTGGG - Intergenic
1001046431 5:168375733-168375755 TAAAATTACAAAAATGAGCTGGG - Intronic
1001078979 5:168652997-168653019 CAAAAATACAAAAATGAGCTGGG - Intergenic
1001813723 5:174650266-174650288 AAGAATTACAAAAATTAGCTGGG - Intergenic
1002361939 5:178679158-178679180 AAAAAATACCAAGATTAGCTGGG - Intergenic
1005513860 6:26536271-26536293 CAGAATCACCAAGCTGCCCTTGG + Intergenic
1005624421 6:27650056-27650078 CAAAATTACAAAAATTAGCTGGG - Intergenic
1005782745 6:29210076-29210098 CAAAACTACCCATATGAGCTGGG + Intergenic
1006219003 6:32472064-32472086 CAAAATTACAAAAATCAGCTGGG + Intergenic
1006231183 6:32588293-32588315 CAAAATTACAAAAATTAGCTGGG + Intronic
1006973383 6:38070823-38070845 CAGCATTACCAATATTAGGTGGG + Intronic
1007147208 6:39647870-39647892 CAAAAATACCAAAATTAGCTGGG - Intronic
1007539164 6:42625040-42625062 CAGAATGACCAAGGACAGCTTGG + Intronic
1007812149 6:44494067-44494089 CAGAATTGCCCCGAGGAGCTGGG + Intergenic
1009193225 6:60654537-60654559 CAGATGTACAAAGAGGAGCTGGG - Intergenic
1010993452 6:82505920-82505942 CAGAATTCCCAAGAAGATGTGGG - Intergenic
1011691438 6:89873021-89873043 CAAAATTACAAAAATTAGCTGGG + Intronic
1011912060 6:92452737-92452759 AAAAATTACCAAAATCAGCTGGG - Intergenic
1013005919 6:106073273-106073295 CAGAAATACAAAAATTAGCTGGG - Intergenic
1013576559 6:111489087-111489109 CAGAAATACAAAAATTAGCTGGG + Intergenic
1014559144 6:122869718-122869740 CAGAATTACCTAGGTGAGGGTGG + Intergenic
1014774749 6:125495411-125495433 CAGAACTACCAAGAAGAGTGGGG - Intergenic
1015846913 6:137530527-137530549 CAGAATTAGCAAGAGGAGAGTGG - Intergenic
1017104481 6:150874908-150874930 CAGAAATACAAAAATTAGCTGGG - Intronic
1017223922 6:151997960-151997982 AAGAAGTAACAAGAAGAGCTGGG - Intronic
1018370985 6:163168307-163168329 CAAAAATACAAAGATTAGCTGGG + Intronic
1018926643 6:168211383-168211405 CAAAATTACAAAAATTAGCTGGG - Intergenic
1019728849 7:2618894-2618916 CAAAAATACAAAAATGAGCTGGG + Intergenic
1019765501 7:2846811-2846833 TAGAAATACCAAAATGAGCCAGG + Intergenic
1020263335 7:6543955-6543977 AAAAATTACCAAAATGAGCCGGG - Intronic
1020496832 7:8864683-8864705 CAGAAAGACCAAGAAGAGATGGG - Intergenic
1021990495 7:26136889-26136911 CAAGATTGCCAAGATGAGTTAGG - Intergenic
1023801287 7:43837367-43837389 AAGAATTACAAAAATGACCTGGG - Intergenic
1023963340 7:44946478-44946500 TAAAAATACCAAGATTAGCTGGG - Intergenic
1024191565 7:47016798-47016820 TAGAATTACAAAAATTAGCTGGG + Intergenic
1025017831 7:55454363-55454385 CAGAGGTACAAAGAGGAGCTGGG + Intronic
1026219159 7:68377225-68377247 AAGAATTACAAAAATTAGCTGGG + Intergenic
1026830000 7:73604923-73604945 TAGAAGTACCAAAATTAGCTGGG - Intronic
1027697386 7:81428967-81428989 AAGAATTACCTAGAGGAGATAGG - Intergenic
1028644778 7:93083340-93083362 CAGATTTACAAAGAAGAGCTGGG + Intergenic
1028837071 7:95386546-95386568 CAGAGGTACAAAGAGGAGCTGGG + Intronic
1029041859 7:97584411-97584433 CAAAATTACAAAAATTAGCTGGG - Intergenic
1029206795 7:98874179-98874201 AAGAAATACCAAAATTAGCTGGG - Intergenic
1029292831 7:99515672-99515694 AAGAAATACCAAAATTAGCTGGG + Intronic
1030234568 7:107244087-107244109 AAAAATTACAAAGATTAGCTGGG + Intronic
1031096347 7:117425827-117425849 TAAAATTACCAAAATTAGCTGGG + Intronic
1031792925 7:126133220-126133242 CAGAAATACAAAAATTAGCTGGG + Intergenic
1032806078 7:135355655-135355677 TGGAATTACCAAGATGAGGGTGG - Intergenic
1033681480 7:143600149-143600171 CAGAATCACCACCATGAGATAGG + Intergenic
1033703412 7:143861664-143861686 CAGAATCACCACCATGAGATAGG - Intronic
1034577451 7:152012804-152012826 CAAAAATACAAAAATGAGCTGGG + Intronic
1037334225 8:17776516-17776538 CAAAAATACAAAAATGAGCTGGG + Intronic
1037344847 8:17887552-17887574 CAAAATAACCAAGATGGGCCGGG + Intronic
1038159663 8:25024460-25024482 CAAAATTACAAAAATTAGCTGGG - Intergenic
1038297286 8:26306010-26306032 CAGAATTACAAAAATTAGCTGGG + Intronic
1039177819 8:34829133-34829155 CAGAAGTACTGAGATGAGATGGG - Intergenic
1039542719 8:38384761-38384783 CAGTATTTGAAAGATGAGCTAGG - Intergenic
1039687362 8:39819062-39819084 CAGAATAACCAAAATAATCTTGG + Intronic
1040453252 8:47570061-47570083 TAGAATTAACAAGATGATCATGG + Intronic
1040730979 8:50446516-50446538 CAAAAATACCAAAATTAGCTGGG + Intronic
1041060832 8:54032876-54032898 CAAAAATACCAAAATTAGCTGGG + Intergenic
1041423453 8:57694796-57694818 CAGAATTGTCATGATCAGCTTGG + Intergenic
1041598054 8:59680657-59680679 CAAAAATACAAAAATGAGCTGGG + Intergenic
1041907388 8:63048829-63048851 CAGATGTACAAAGAAGAGCTGGG + Intronic
1042739898 8:72031415-72031437 CAGAAATACAAAAATTAGCTGGG + Intronic
1042982385 8:74544870-74544892 CAGACTTCCTAAGATGATCTTGG - Intergenic
1044002651 8:86903194-86903216 AAGAATTTCCAAGATGTGGTGGG - Intronic
1044240013 8:89877816-89877838 CAGAAATACAAAAATTAGCTGGG + Intergenic
1044447236 8:92293246-92293268 CAGAAATACAAAAATTAGCTTGG - Intergenic
1044474849 8:92613880-92613902 CAGACATACCCAGATGAGTTGGG - Intergenic
1045217267 8:100161042-100161064 CAGAAGTACCTAGAAGGGCTGGG + Intronic
1045239876 8:100390750-100390772 CAGAATGGCCAATATGATCTTGG + Intronic
1045460665 8:102422710-102422732 AAAAAATACCAAAATGAGCTGGG + Intergenic
1049486009 8:142862249-142862271 CAGATGTACAAAGAAGAGCTAGG - Intronic
1049806255 8:144541847-144541869 CAGAATGACCCAGAAGAGCTGGG - Intronic
1049993561 9:1012723-1012745 TAGAAATACCAAAATTAGCTGGG + Intergenic
1050000938 9:1076188-1076210 CAAAATTACAAAAATTAGCTGGG - Intergenic
1050384181 9:5067997-5068019 CAAAATTACAAAAATTAGCTGGG + Intronic
1050678375 9:8082033-8082055 CAGAGGTACAAAGAGGAGCTTGG - Intergenic
1050847347 9:10238744-10238766 CATAATTAACAAAATTAGCTTGG - Intronic
1051096635 9:13473867-13473889 CAGATGTACAAAGAAGAGCTGGG - Intergenic
1051446191 9:17141786-17141808 AAGAATAACCAAGATTGGCTGGG + Intronic
1055900754 9:81233225-81233247 CAGAAGAACCAAGAAGAGGTGGG - Intergenic
1057891604 9:98874165-98874187 GAGAATTACTCAGATGAGCTGGG + Intergenic
1058075172 9:100643591-100643613 CAGAATTACTGAGATCAGTTTGG + Intergenic
1058832611 9:108832566-108832588 CAGAAATACAAAAATTAGCTGGG - Intergenic
1058928156 9:109689358-109689380 CAGAAATACAAAAATTAGCTGGG - Intronic
1058933041 9:109740812-109740834 CAAAAATACCAAAATTAGCTGGG - Intronic
1058994605 9:110287488-110287510 AAAAAATACAAAGATGAGCTGGG - Intergenic
1060422023 9:123476022-123476044 CAGAAGTACAAAAATTAGCTGGG + Intronic
1062466832 9:136685315-136685337 CAGAATCTCCAAGCTGAGATGGG + Intronic
1186134512 X:6504988-6505010 TAAAAATACCAAAATGAGCTGGG - Intergenic
1186154657 X:6712619-6712641 CAGAATCCCCAAGATGAACATGG - Intergenic
1186331566 X:8540363-8540385 CAGAAATGCCACGATGCGCTTGG - Intronic
1186341472 X:8650555-8650577 TAGAAATACAAAAATGAGCTGGG + Intronic
1186886084 X:13915105-13915127 CAGAAATACAAAAATTAGCTGGG + Intronic
1187415799 X:19092435-19092457 CAGCTTTAGAAAGATGAGCTTGG + Intronic
1188951942 X:36387251-36387273 CAGAATTATCAACTTGAACTTGG - Intergenic
1189674901 X:43451834-43451856 AAAAATTACCAAGAAGAACTTGG + Intergenic
1189812248 X:44791379-44791401 CAAAAATACCAAAATTAGCTGGG + Intergenic
1189992042 X:46604591-46604613 CAGAAATACAAAAATGAGCCAGG - Intronic
1190096880 X:47488624-47488646 TAGAAATACAAAAATGAGCTGGG - Intergenic
1191246080 X:58229375-58229397 TAGAATTACCGAGGTCAGCTAGG - Intergenic
1192178062 X:68898334-68898356 CAGAGTTGACAAGATGACCTTGG + Intergenic
1192408928 X:70915234-70915256 CAAAAATACAAAAATGAGCTGGG - Intergenic
1192427666 X:71091699-71091721 CAGAATTAGCAAGATGGTCTTGG - Intergenic
1192794720 X:74417575-74417597 CAAAATTACAAAAATTAGCTGGG - Intergenic
1193842592 X:86425817-86425839 CAGTATTACTCAGATGGGCTAGG + Intronic
1195213881 X:102677322-102677344 CAGAGGTACAAAGAGGAGCTGGG - Intergenic
1195433250 X:104812966-104812988 AAGAATTAGCAAAATGAGCAAGG + Intronic
1196013156 X:110909738-110909760 CAGAGGTACAAAGAAGAGCTGGG + Intergenic
1196373251 X:115001906-115001928 CACTATCACCAAAATGAGCTTGG + Intergenic
1196688180 X:118530512-118530534 AGGAATGGCCAAGATGAGCTGGG - Intronic
1197266912 X:124384149-124384171 CAGTATTACTATGATGGGCTTGG - Exonic
1197947627 X:131857612-131857634 CAAAATTACAAAAATTAGCTGGG + Intergenic
1198236735 X:134742425-134742447 TAGAAATACAAAAATGAGCTGGG + Intronic
1198360672 X:135892552-135892574 CAGAGTTCCCAAGGTCAGCTGGG + Intronic
1198376013 X:136040958-136040980 CAAAATTACAAAAATTAGCTGGG + Intronic
1199008943 X:142736698-142736720 AAGAATTACAAATATGAGCCAGG + Intergenic
1199879269 X:151960179-151960201 CAGAAATACAGAGATGAGCAAGG + Intronic
1200214358 X:154360884-154360906 TAAAATTACCAAAATTAGCTGGG + Intronic
1201379185 Y:13354240-13354262 CAAAATTACAAAAATTAGCTAGG + Intronic
1201431049 Y:13902248-13902270 CAGAAATGCCACGATGCGCTTGG + Intergenic
1202042841 Y:20702818-20702840 CACAAGTACCAAGATGATCCAGG + Intergenic
1202380206 Y:24270293-24270315 AAAAATTACAAAAATGAGCTGGG + Intergenic
1202490577 Y:25399832-25399854 AAAAATTACAAAAATGAGCTGGG - Intergenic
1202577842 Y:26346380-26346402 CAAAAATACAAAAATGAGCTGGG + Intergenic