ID: 1087586999

View in Genome Browser
Species Human (GRCh38)
Location 11:100134415-100134437
Sequence CAAATTATGACACGGGTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 63}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087586994_1087586999 13 Left 1087586994 11:100134379-100134401 CCTTGGGCAAATTCACTTTTCTA 0: 1
1: 1
2: 5
3: 43
4: 338
Right 1087586999 11:100134415-100134437 CAAATTATGACACGGGTGGTAGG 0: 1
1: 0
2: 0
3: 4
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087586999 Original CRISPR CAAATTATGACACGGGTGGT AGG Intronic
903862891 1:26375647-26375669 CAAAATATGTCACTGGTGGGGGG + Intergenic
904298715 1:29540607-29540629 CAGAATTTGACATGGGTGGTTGG + Intergenic
909814807 1:79978285-79978307 CAAATTATGACAATTGTGCTTGG + Intergenic
912302813 1:108535299-108535321 CAAATGAGGACAAGAGTGGTAGG - Intergenic
914322385 1:146577714-146577736 TTTATTATGACACAGGTGGTAGG - Intergenic
918424128 1:184391158-184391180 GCAATTATGACAAGAGTGGTTGG + Intronic
921665614 1:217867333-217867355 CAAATGATGACACCAGTGCTGGG + Exonic
924953353 1:248906017-248906039 CAAAGTAGGACAGGGGTGGGAGG + Intergenic
1065530058 10:26660311-26660333 CTAATTATTTCACTGGTGGTGGG + Intergenic
1066501926 10:36003159-36003181 CAAATTAGGACAAGGGTGAGAGG - Intergenic
1071443592 10:85726055-85726077 CAACTCATGACACAGGTGGAGGG + Intronic
1072926478 10:99620966-99620988 CAAATTCTGAGACGCGTGGCTGG + Intergenic
1073708798 10:106016238-106016260 CAAATTATTACTAGGGTAGTGGG - Intergenic
1077393389 11:2309922-2309944 CAAATGATGCCAGGGGTGGGTGG - Intronic
1084690406 11:70721944-70721966 CAAATGATGCCACTGGTGGCAGG + Intronic
1087586999 11:100134415-100134437 CAAATTATGACACGGGTGGTAGG + Intronic
1087969009 11:104455821-104455843 CAATGTATGACAGAGGTGGTGGG - Intergenic
1090300181 11:125629279-125629301 CAACTCATGGCAGGGGTGGTAGG + Exonic
1092787235 12:12038181-12038203 CACATAATGACACTGGTTGTGGG - Intergenic
1110246770 13:73334488-73334510 CAAAATATGACACTGCTGGTTGG - Intergenic
1114912754 14:27220726-27220748 CAAAATATGTCACCGGTGGAGGG + Intergenic
1116726504 14:48566914-48566936 CAAAATAGGACACCGGTGGAGGG + Intergenic
1129004221 15:72358746-72358768 CAAATTATGAGAGGGATGTTTGG + Intronic
1131552367 15:93368455-93368477 CAAATAATGACAAGTATGGTTGG + Intergenic
1131819976 15:96262582-96262604 CAAATATTAACAAGGGTGGTGGG + Intergenic
1140011238 16:71133455-71133477 TTTATTATGACACAGGTGGTAGG + Intronic
1141537917 16:84696099-84696121 CTAATTATGACATGACTGGTGGG - Intergenic
1159691046 18:71487685-71487707 CAAATTAAGACACACTTGGTGGG - Intergenic
1162045792 19:7999472-7999494 CAAATAATGATAGGAGTGGTTGG - Intronic
1168122216 19:54257821-54257843 CAGATTAAGACAGGAGTGGTTGG + Intronic
925293293 2:2762569-2762591 CAGAGTATGACAGGGGTGCTTGG - Intergenic
929133168 2:38598397-38598419 CAAATTGTGACACTGGTTTTAGG - Intronic
931796747 2:65718160-65718182 CAAATTCTGACATGGTAGGTAGG + Intergenic
940721208 2:157284313-157284335 CACATGATGACACTGGTGGTTGG - Exonic
941460435 2:165764997-165765019 ACTATTATGACACTGGTGGTGGG + Exonic
943771023 2:191717170-191717192 CAAATAAGGTCAGGGGTGGTTGG - Intergenic
1170973321 20:21137320-21137342 CAAATTATGCCAAGTGTGGAGGG + Intronic
1172229746 20:33328715-33328737 CAAATCATCACATGGGTGGATGG - Intergenic
949185874 3:1190853-1190875 CAATTTATTACCCAGGTGGTGGG + Intronic
955553503 3:60110139-60110161 CATATGAGGACACGGGGGGTTGG + Intronic
965308637 3:167100227-167100249 CAATATATGAAACGGGTGGTGGG + Intergenic
969594728 4:8142564-8142586 GAAATTATGACAAGGGCTGTGGG + Intronic
975575393 4:75857595-75857617 GAAACTATGACACAGGTGATGGG - Intergenic
980021459 4:127714878-127714900 CAAAATGTGAAACTGGTGGTGGG + Intronic
984548785 4:181136589-181136611 CAAATTAGGACACAGGAGTTAGG + Intergenic
986260896 5:6145452-6145474 AAAATTAAGACAGGAGTGGTGGG - Intergenic
988556713 5:32242802-32242824 CAAATTATGAGACGTGTAGCAGG + Intronic
995022596 5:107382948-107382970 CTTATTGTGACACGTGTGGTAGG - Intronic
996832952 5:127759784-127759806 CAAGTTATGACAAGGGAGCTTGG - Intergenic
1003969819 6:11288438-11288460 CAAATTATCACAAGGTTGCTTGG + Intronic
1004632267 6:17433404-17433426 CCAATTACCACAAGGGTGGTGGG - Intronic
1008684407 6:53908925-53908947 CAAATTTTGGCAAGGGTGGAGGG + Intronic
1012881327 6:104794018-104794040 CTAAAAATGACAGGGGTGGTTGG - Intronic
1017031775 6:150230229-150230251 CAAAGTGTGAAGCGGGTGGTGGG - Intronic
1018898027 6:168034802-168034824 GAAATCATGACACGGGCAGTGGG - Intronic
1034301602 7:150020535-150020557 CAAATTATGACATGGATGGGGGG - Intergenic
1040723649 8:50355414-50355436 CAAATTTAGGCAGGGGTGGTAGG - Intronic
1046201048 8:110928284-110928306 CAAATGATGTCAAGGCTGGTGGG - Intergenic
1047810423 8:128402905-128402927 CAACTGATGACACTGGAGGTAGG + Intergenic
1050826769 9:9955950-9955972 TAAATTATAACAGGAGTGGTGGG + Intronic
1056435585 9:86572694-86572716 CAAAATATGCCAGGTGTGGTGGG + Intergenic
1056933419 9:90897434-90897456 AAAATTATGAAAGGAGTGGTTGG + Exonic
1058990433 9:110250454-110250476 CAAATTATGAGACCGCTTGTAGG - Intronic
1186393670 X:9186144-9186166 CAGCTTCTGACACGGGTGCTGGG - Intergenic
1187332983 X:18357359-18357381 CAATTGATGACAAGGGTGGAAGG - Intergenic
1190488524 X:50956679-50956701 CACATTATGAAACTGGGGGTGGG + Intergenic
1195989271 X:110666523-110666545 CAAGTTATAACACGTGTGATGGG - Intergenic
1198728281 X:139700297-139700319 CAAATTATCACAGGAGGGGTAGG - Intronic