ID: 1087590319

View in Genome Browser
Species Human (GRCh38)
Location 11:100178894-100178916
Sequence CGTCACTTGCTGAAGGTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 94}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087590311_1087590319 7 Left 1087590311 11:100178864-100178886 CCCCCAATGGGTGGCATCCCAAA 0: 1
1: 0
2: 0
3: 9
4: 95
Right 1087590319 11:100178894-100178916 CGTCACTTGCTGAAGGTGCTGGG 0: 1
1: 0
2: 1
3: 13
4: 94
1087590314_1087590319 4 Left 1087590314 11:100178867-100178889 CCAATGGGTGGCATCCCAAAGAT 0: 1
1: 0
2: 0
3: 6
4: 121
Right 1087590319 11:100178894-100178916 CGTCACTTGCTGAAGGTGCTGGG 0: 1
1: 0
2: 1
3: 13
4: 94
1087590310_1087590319 15 Left 1087590310 11:100178856-100178878 CCAGCTGACCCCCAATGGGTGGC 0: 1
1: 0
2: 0
3: 6
4: 98
Right 1087590319 11:100178894-100178916 CGTCACTTGCTGAAGGTGCTGGG 0: 1
1: 0
2: 1
3: 13
4: 94
1087590315_1087590319 -10 Left 1087590315 11:100178881-100178903 CCCAAAGATTCAACGTCACTTGC 0: 1
1: 0
2: 0
3: 5
4: 91
Right 1087590319 11:100178894-100178916 CGTCACTTGCTGAAGGTGCTGGG 0: 1
1: 0
2: 1
3: 13
4: 94
1087590312_1087590319 6 Left 1087590312 11:100178865-100178887 CCCCAATGGGTGGCATCCCAAAG 0: 1
1: 0
2: 2
3: 11
4: 127
Right 1087590319 11:100178894-100178916 CGTCACTTGCTGAAGGTGCTGGG 0: 1
1: 0
2: 1
3: 13
4: 94
1087590313_1087590319 5 Left 1087590313 11:100178866-100178888 CCCAATGGGTGGCATCCCAAAGA 0: 1
1: 0
2: 0
3: 9
4: 88
Right 1087590319 11:100178894-100178916 CGTCACTTGCTGAAGGTGCTGGG 0: 1
1: 0
2: 1
3: 13
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087590319 Original CRISPR CGTCACTTGCTGAAGGTGCT GGG Intronic
909385673 1:75053574-75053596 CCTCAATTGCTTAAGGAGCTGGG - Intergenic
914806798 1:150997684-150997706 CTCCTCTTGCTGAAGCTGCTGGG + Exonic
918265115 1:182835086-182835108 CCTCAGCTTCTGAAGGTGCTGGG - Intergenic
922820044 1:228478342-228478364 CGACAAGTGCTCAAGGTGCTCGG + Intergenic
1076314866 10:129532945-129532967 CGTCCCTTCCTGCAGCTGCTCGG + Intronic
1082798680 11:57397514-57397536 CACCACTTGCTGGAGGAGCTTGG - Intronic
1083870758 11:65487065-65487087 CGTGACCTGCTGAAGGTCCCAGG + Intergenic
1085144437 11:74180863-74180885 CTAAACTTGGTGAAGGTGCTTGG - Intronic
1085720666 11:78909853-78909875 GGTCACTTCCTGGAGGTGCCAGG + Intronic
1087011742 11:93520834-93520856 CGTGACATGCTGAAGGTGAAAGG - Intronic
1087418363 11:97887816-97887838 AGTCATTGGCTGAAGGTTCTTGG - Intergenic
1087590319 11:100178894-100178916 CGTCACTTGCTGAAGGTGCTGGG + Intronic
1091294647 11:134465088-134465110 GGCCTCTTGCTGAAGGTGCTCGG + Intergenic
1092851804 12:12635762-12635784 TCTCGCTTGCTGAAGGTGGTTGG + Exonic
1099094017 12:78350629-78350651 TCTCACATGCTGAAAGTGCTTGG + Intergenic
1103334476 12:120178913-120178935 CTGCTCTTGCTGGAGGTGCTGGG - Exonic
1103613702 12:122139221-122139243 AGCCACTTGCAGAAGGTGCAGGG + Intronic
1107677186 13:42809557-42809579 CGTCAGCTTCTGAAAGTGCTGGG - Intergenic
1114080509 14:19198944-19198966 TCTCACTTGCTGCAAGTGCTTGG - Intergenic
1114674944 14:24433663-24433685 CTTGCCTTGCTCAAGGTGCTAGG + Intronic
1119195656 14:72715158-72715180 CGTCACTGGCTGAAGGCCCAAGG - Intronic
1120803812 14:88723160-88723182 CCTCAGCTGCTGAAAGTGCTGGG - Intronic
1121315790 14:92960344-92960366 CGGTACTTGCTGAAGGGGATGGG - Intronic
1122859276 14:104575270-104575292 CCTGACCTGCTGAAGGTTCTGGG - Intronic
1125670236 15:41466803-41466825 CGTTATTTGCTGAAGGAACTGGG + Intronic
1127679015 15:61274833-61274855 GGTCACTTGCAGAAGGTTCTAGG - Intergenic
1131111319 15:89766882-89766904 CATCACTTGCTGAAGGTCCCTGG - Intronic
1136227811 16:28870797-28870819 CGTCAGCGGCTTAAGGTGCTGGG + Intronic
1138321135 16:56113086-56113108 GGCCACTTGGTGAAAGTGCTGGG - Intergenic
1139681818 16:68570938-68570960 CCTCAGATGCTGAAGGAGCTGGG + Intronic
1143355304 17:6323564-6323586 AGTCACTTGCTGAAGGTCACAGG + Intergenic
1143610447 17:8014900-8014922 TGTCACTTGCTCAAAGTACTCGG - Exonic
1151096364 17:71503658-71503680 CTTCAGTTTCTGAAAGTGCTGGG + Intergenic
1151654848 17:75491070-75491092 GGCCACTTCCTGAGGGTGCTCGG + Exonic
1151852153 17:76697376-76697398 CGTCTGTTGCTGAAGGTGCCCGG + Intronic
1154055925 18:11014112-11014134 CTCCACTTGCTGTAGGAGCTAGG + Intronic
1158904069 18:61994286-61994308 CCTCATTTGCTGAAAGCGCTGGG + Intergenic
1159007000 18:63022353-63022375 CGTCACCTGGAGCAGGTGCTTGG - Intergenic
1164249000 19:23460548-23460570 AGTCCCATGATGAAGGTGCTGGG - Intergenic
1165098907 19:33426781-33426803 CCTCGCTTCCTGCAGGTGCTGGG - Intronic
1165282110 19:34806450-34806472 TTTCACTTTCTGATGGTGCTTGG - Intergenic
925332585 2:3070561-3070583 CGTCACGTCCTGATTGTGCTAGG - Intergenic
927882118 2:26696221-26696243 CATGACTTGGTGAAGTTGCTGGG + Intronic
933179165 2:79210756-79210778 CCTCACTTGCTCCAGGTGATGGG - Intronic
933967863 2:87444681-87444703 CCTCACTGGCTGAGGGTGCTGGG + Intergenic
936325935 2:111505818-111505840 CCTCACTGGCTGAGGGTGCTGGG - Intergenic
943545022 2:189265432-189265454 CGTCACTTGATGATGGAGATTGG - Intergenic
948632171 2:239309410-239309432 GGGCATTTGCTGTAGGTGCTGGG - Intronic
1169858367 20:10127265-10127287 GGTCACTTGCTGAAGCTTCCAGG - Intergenic
1171464991 20:25321207-25321229 CGTCACATTTTGAAGGTGCTGGG + Intronic
1171490306 20:25512119-25512141 GGTCATTTGCTGCAGGTGCCTGG - Intronic
1172208934 20:33184134-33184156 CGACACGTGCTGAAGGTGATGGG + Intergenic
1173384509 20:42575205-42575227 CGTCCCTTGGTCAAGGTGATGGG + Intronic
1175342793 20:58245131-58245153 CATCACTTGCTGCTGTTGCTGGG - Intergenic
1175761266 20:61563421-61563443 CCTCACTTGCTCCAGGTGCTTGG + Intronic
1175984274 20:62756147-62756169 CATCACTGGCTGAAGGTGCCTGG - Intronic
1178499798 21:33116242-33116264 GGTCACTTTCTGCAGGTGTTCGG + Intergenic
1179786722 21:43734468-43734490 CGTCACTTGCATAAAATGCTTGG + Intronic
1180500270 22:15923740-15923762 TCTCACTTGCTGCAAGTGCTTGG + Intergenic
1181405396 22:22680901-22680923 CGTCACTTCCGGCAGGTGCCAGG - Intergenic
1183035375 22:35137090-35137112 CGTTACCTGTTGAAAGTGCTTGG - Intergenic
952007671 3:28860903-28860925 TATCATTTGCTGAAGTTGCTAGG - Intergenic
956693258 3:71897327-71897349 AGTCACTAGCTGAAGGAACTTGG + Intergenic
956811994 3:72872440-72872462 GGTCACATTCTGACGGTGCTGGG + Intergenic
957070936 3:75567425-75567447 GGTCCCTTGCAGAAGGAGCTGGG + Intergenic
957152252 3:76500500-76500522 GGTCACTTGCTGTTGGTCCTAGG - Intronic
961920180 3:130417365-130417387 GGTGACTTGCTGATGGTGCTTGG - Intronic
964727297 3:159826762-159826784 GTTCACTTGTTGAAAGTGCTGGG - Intronic
966806821 3:183814503-183814525 GGTCACTTGCTGAACATGTTAGG + Intergenic
968925863 4:3547699-3547721 CATCACGACCTGAAGGTGCTTGG + Intergenic
970454839 4:16212782-16212804 CGTCACTTGCTGAAGTTTTAGGG - Intronic
972696321 4:41450077-41450099 GGTCACATTCTGAAGGTACTGGG + Intronic
981412855 4:144453460-144453482 CGTCACTCACTGAAGGTGTTTGG - Intergenic
984881320 4:184412314-184412336 CTACACTTGCTGAATGGGCTTGG + Intronic
988726309 5:33929905-33929927 CTTCACTTGCAGAATGGGCTCGG + Intergenic
988838506 5:35059168-35059190 CTTCAGTTGCTGAAGGTTTTAGG + Exonic
989069054 5:37490993-37491015 CGTGCCATGCTGCAGGTGCTTGG + Intronic
991373049 5:65939473-65939495 CCTCTCTTGGTGAAGATGCTGGG - Intronic
993048194 5:82892970-82892992 CTTCACTAGCAGAATGTGCTGGG + Intergenic
995159851 5:108967032-108967054 CATCACTGGCTGAAGGTCCGTGG - Intronic
995624134 5:114058156-114058178 CATCACTAGCTCAAGGTGCCAGG - Intergenic
996718095 5:126603558-126603580 TTTCACTTGCAGAAAGTGCTAGG + Exonic
1001956822 5:175853467-175853489 TGTCACCTGCTGAAAGAGCTGGG + Intronic
1005351585 6:24941132-24941154 AGTCACTTACTGAAGGTGCTGGG + Intronic
1006822127 6:36905234-36905256 GGTCACTTGCTCAAGGTCCCAGG + Intronic
1016934677 6:149440943-149440965 AGTCACTTGCTGAAGGCACAGGG - Intergenic
1017957791 6:159193345-159193367 TGTCACTTGCTGGAGGTTCATGG + Intronic
1018928746 6:168225635-168225657 CTTCTGTTGTTGAAGGTGCTGGG + Intergenic
1018947203 6:168356255-168356277 TGTCATTTGCTGTAAGTGCTGGG - Intergenic
1023348926 7:39300099-39300121 CATCAGTGGCTGAAGGTGATTGG - Intronic
1028244354 7:88459034-88459056 TGACATTTGCTGAAGGTGCCAGG + Intergenic
1030323863 7:108199501-108199523 CGTCGCTTTCTGAAGGTTCTAGG + Intronic
1030820759 7:114087755-114087777 CCTCACTTGCTGTGGGTGTTGGG + Intronic
1032430156 7:131854531-131854553 CGTCGCTGGCTGGAGGTCCTTGG - Intergenic
1035745899 8:1961964-1961986 CTTCACTTTCTGAACCTGCTCGG - Intergenic
1036652320 8:10653057-10653079 TGTGGCTTGCTGGAGGTGCTGGG - Intronic
1040394696 8:46986111-46986133 GGTCACTTGCAGAAGATGATTGG + Intergenic
1043973577 8:86560450-86560472 AGTCACCTGCACAAGGTGCTTGG + Exonic
1048892890 8:138963654-138963676 CGACACGTGCTCAAGGTGGTCGG + Intergenic
1050014828 9:1222454-1222476 CCTCACTTGGTGAAGGTGGAAGG - Intergenic
1053800744 9:41762877-41762899 CATCACGACCTGAAGGTGCTTGG + Intergenic
1054144452 9:61551958-61551980 CATCACGACCTGAAGGTGCTTGG - Intergenic
1054189174 9:61975029-61975051 CATCACGACCTGAAGGTGCTTGG + Intergenic
1054464140 9:65482917-65482939 CATCACGACCTGAAGGTGCTTGG - Intergenic
1054649347 9:67613588-67613610 CATCACGACCTGAAGGTGCTTGG - Intergenic
1059969063 9:119645885-119645907 TGTCACTTGCTGATAGTGTTAGG - Intergenic
1062000046 9:134211369-134211391 CCTCCCTTGCTGGGGGTGCTGGG + Intergenic
1062725987 9:138073852-138073874 CATCACTTGGTGGAGGGGCTTGG + Intronic
1200088229 X:153621715-153621737 GGTCACTTGCAGAAGTTGTTGGG + Intergenic