ID: 1087591966

View in Genome Browser
Species Human (GRCh38)
Location 11:100201028-100201050
Sequence TGGAATGAAGTGCCTATTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 154}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087591964_1087591966 -1 Left 1087591964 11:100201006-100201028 CCAACAAAAACATGAATTTATCT 0: 1
1: 0
2: 1
3: 48
4: 598
Right 1087591966 11:100201028-100201050 TGGAATGAAGTGCCTATTATTGG 0: 1
1: 0
2: 0
3: 8
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087591966 Original CRISPR TGGAATGAAGTGCCTATTAT TGG Intronic
904552353 1:31329835-31329857 GGGAATGATGTGCATATTTTAGG + Intronic
904556215 1:31366495-31366517 TGGAATGAGGTGCCTAGCTTTGG - Intronic
907747522 1:57228091-57228113 CAGACTGAAGTGCCTATAATAGG + Intronic
909091351 1:71229607-71229629 TGGAATTAAGTACATATTCTGGG - Intergenic
909262590 1:73511916-73511938 TGGAAGGTAGTGCATATTTTTGG + Intergenic
910142659 1:84043264-84043286 TAGAATAAAGTGTTTATTATAGG - Intergenic
911250780 1:95574145-95574167 TGGAATGAATTGTCTATTGAAGG - Intergenic
911853243 1:102845212-102845234 TGAAATGTAATGCCTAATATTGG + Intergenic
913276182 1:117140421-117140443 GGAAATGGAGTGCCTCTTATGGG - Intergenic
913349432 1:117841837-117841859 TGGAAGGTAGTGCTTATAATGGG + Intergenic
916461051 1:165024842-165024864 TGGATTGACCTGCCTATTCTAGG - Intergenic
916856617 1:168756740-168756762 TGGAAAGAAGAGCCTCTCATGGG - Intergenic
920768318 1:208854782-208854804 TGGAATGAAGGGCTTAGTTTTGG + Intergenic
922229954 1:223677053-223677075 TGGAATGCAGTGCCTATTTATGG - Intergenic
1063749628 10:8928131-8928153 TTGAATAAAGTGCTTATTGTGGG - Intergenic
1066197316 10:33113222-33113244 TGGAATGAAATGCCTTTGTTAGG - Intergenic
1067152597 10:43749020-43749042 TGGGATGAAGTCCCTAGGATGGG + Intergenic
1068811173 10:61257389-61257411 TGGAATGAAGTGCCTGGGGTTGG - Intergenic
1068918497 10:62459293-62459315 TGGAAGGAAGTGCCTCTGAATGG - Intronic
1069161516 10:65099269-65099291 TGGAAAGAAGTCACTATTTTCGG + Intergenic
1069433485 10:68358342-68358364 TGGAATGAAGAGCATTTTATAGG - Intronic
1074294608 10:112172445-112172467 TTGAAGGAAGTTCCTATTATTGG - Intronic
1074425782 10:113349921-113349943 GGGACTGAATAGCCTATTATAGG + Intergenic
1075806482 10:125192763-125192785 TGGAATGTAGAGGCTGTTATTGG - Intergenic
1081338727 11:41901492-41901514 TGAAATAAAGAGCATATTATGGG - Intergenic
1083185104 11:61012923-61012945 GAGAATGAAGTGCCTTTTGTAGG + Intronic
1087591966 11:100201028-100201050 TGGAATGAAGTGCCTATTATTGG + Intronic
1087612155 11:100447592-100447614 GGAAATGAAGAACCTATTATTGG + Intergenic
1089088705 11:115847518-115847540 TGGAATAAAGTACCCATTAAGGG - Intergenic
1089517416 11:119042147-119042169 TGGTGTGAAGTGTTTATTATGGG - Intergenic
1090508035 11:127340554-127340576 TGGAAGGAAGTGGCTATGGTGGG + Intergenic
1093257295 12:16885703-16885725 TGCAATGAATTGTGTATTATAGG + Intergenic
1093830432 12:23749866-23749888 TGGAATGTAGTGCATATTTGAGG - Intronic
1094700498 12:32865842-32865864 TGGACTGAAGTTCCTTTTTTTGG - Intronic
1096376494 12:51115641-51115663 TCAAATTAAGTGCCTATCATGGG + Intronic
1099952139 12:89315591-89315613 TGGAAAGATGTACTTATTATGGG - Intergenic
1100061801 12:90588076-90588098 TAGCATAAAGTGCCTATTAGAGG + Intergenic
1104530684 12:129568061-129568083 TGGCATGAGGTGTCTATTACAGG + Intronic
1105270246 13:18866749-18866771 TGTAATGAACTGCCTTTAATGGG - Intergenic
1108781187 13:53836516-53836538 TTGTATGAAGTGTCTAATATAGG - Intergenic
1110318959 13:74138217-74138239 AGGAATGAAGTCCCTTTTAGAGG + Intergenic
1110325004 13:74203650-74203672 TGGCATGAAGTGACTCTTCTTGG + Intergenic
1111273929 13:85923520-85923542 TAGACTGAAGAGCCTTTTATTGG - Intergenic
1111826300 13:93272380-93272402 TCAAATGAAGTGACTATCATTGG - Intronic
1112690488 13:101888008-101888030 TGGAATGAAGTACCTTTTTCAGG + Intronic
1116867545 14:50043107-50043129 TTTAATGAGTTGCCTATTATTGG - Intergenic
1117585319 14:57196052-57196074 TGGTATCCAGTGGCTATTATTGG + Intergenic
1119135981 14:72220549-72220571 TGGAGTGAAGTGCCTACTGAAGG + Intronic
1119836880 14:77758535-77758557 TGGGGTGAAGTGGCTATTTTGGG - Intronic
1120636218 14:86954557-86954579 TGGAAAGAAGTGCCTGTTGATGG + Intergenic
1121981569 14:98459055-98459077 AGTAATGAAGTGGCAATTATTGG - Intergenic
1124341335 15:28891130-28891152 TGGAATGAAATGCACATCATTGG + Intronic
1125403224 15:39326417-39326439 TGGAAAGAAGTGTCTAATAAAGG + Intergenic
1125444512 15:39738881-39738903 GGAAATGATGTGCCAATTATGGG + Intronic
1126879130 15:53075785-53075807 AGGAATGAAATGTCAATTATGGG + Intergenic
1129174337 15:73829303-73829325 TGGAATGACCTTCCTATTACTGG - Intergenic
1129310243 15:74702574-74702596 TGGACTATAGTGCCCATTATTGG - Intergenic
1139104529 16:63811797-63811819 TGGAATTCAGAGCCCATTATGGG - Intergenic
1139199664 16:64961123-64961145 TGGAAAGAAGAGGCTATCATAGG + Intronic
1140289271 16:73635780-73635802 TCAAAGGAAGTGTCTATTATTGG - Intergenic
1140740238 16:77935087-77935109 TGGAATAAAGTGCATTTTGTGGG - Intronic
1144887841 17:18476023-18476045 TGGCATGAACTGCCTTTAATTGG - Intergenic
1145144372 17:20468278-20468300 TGGCATGAACTGCCTTTAATTGG + Intergenic
1145175819 17:20699681-20699703 TGGCATGAACTGCCTTTAATTGG + Intergenic
1150192893 17:63261618-63261640 TGGAATGAACTGCCAATGCTTGG + Intronic
1150662414 17:67094749-67094771 TGGAATGCAGTGGCTATTCATGG - Intronic
1154417790 18:14193216-14193238 TGTAATGAACTGCCTTTAATGGG + Intergenic
1156573850 18:38290162-38290184 TGGAATAAAGTGATCATTATGGG + Intergenic
1156874758 18:41995663-41995685 TGTAATGACGTGTGTATTATGGG + Intronic
1162890533 19:13729645-13729667 TGGAATTAAGAGCATATTGTGGG + Intergenic
1163608147 19:18287051-18287073 TGGACTTAATTGCCAATTATTGG + Intergenic
929199460 2:39219756-39219778 TGGAATAAAATGCCTATTCAAGG + Intronic
929942858 2:46348042-46348064 TGTTATGAAGTGGCTATTCTGGG + Intronic
940282032 2:151998695-151998717 TGGGATGACCAGCCTATTATTGG - Intronic
940624916 2:156162102-156162124 TGGAATTAAGAGCATATTGTTGG - Intergenic
942722948 2:178972927-178972949 TGAAATAAAGTGACTATTAGGGG + Intronic
943415669 2:187599827-187599849 TGCACTGAAGTACCTATTAGTGG + Intergenic
943655310 2:190502664-190502686 TGGAAGGAATTGCCAATTAGAGG - Intronic
948094595 2:235323756-235323778 ATGAAGGAAGTGCCAATTATGGG - Intergenic
1169493717 20:6093167-6093189 GGAAATGAAGGGCCTATTAGAGG + Intronic
1171890677 20:30710766-30710788 TGCAATGAACTGCCTTTAATGGG - Intergenic
1172267812 20:33632098-33632120 TGGAATGCAGTGCACATTCTTGG + Intronic
1175053155 20:56173484-56173506 TGGCATGATGTGCCTTTGATTGG - Intergenic
1176855514 21:13966056-13966078 TGTAATGAACTGCCTTTAATGGG - Intergenic
1178023598 21:28438100-28438122 TGGAATGAAGTAGCTATTCATGG + Intergenic
1180017627 21:45097651-45097673 TGGAAGGCAGTGCCTATGACTGG + Intronic
1180597622 22:16989028-16989050 GGCAAGGAAGTGCCTATGATGGG - Intronic
1182978096 22:34642202-34642224 TGGAATGAAGAGTCTATTGAAGG - Intergenic
949624190 3:5849170-5849192 TTGAATGAAGCTCCCATTATGGG - Intergenic
950826148 3:15823579-15823601 TGGTATGAAGTGTCTAGTTTTGG - Intronic
953830854 3:46296660-46296682 TGGTAGGAAGTGACCATTATTGG + Intergenic
954631175 3:52048340-52048362 TGGCATGAAGAGCACATTATTGG - Intergenic
955260378 3:57383482-57383504 TAGAATGGAGTGCCTCTTAAAGG + Intronic
956341414 3:68228291-68228313 TGGAGTGAAGTGGCTTTTACAGG + Intronic
957375673 3:79354312-79354334 TGAAATCAAGTGCCAAGTATAGG - Intronic
957710532 3:83852142-83852164 TGGAATGAAGTGCCAGCAATAGG - Intergenic
959605764 3:108240037-108240059 TGGAATGAAGTGAAAACTATGGG - Intergenic
964175320 3:153820793-153820815 TGAAATGAACTGACTATAATGGG - Intergenic
964971613 3:162570267-162570289 TGGAATGAAGTACCTATAGAAGG + Intergenic
966054629 3:175669895-175669917 TCAAATGAAGTGTCTATCATTGG - Intronic
966112774 3:176423430-176423452 AAGAAGGAAGTACCTATTATGGG + Intergenic
966404567 3:179583035-179583057 TGGAATGCAGTGGCTATTCACGG - Intronic
974415755 4:61604397-61604419 TGGAATAAAATGCCTATAAAAGG + Intronic
977222513 4:94354633-94354655 TAGAATGAACTGCCTCTTACAGG + Intergenic
977368935 4:96109649-96109671 TGGAAAGAAGTTTCTACTATTGG + Intergenic
978209417 4:106117619-106117641 TGTATTGCATTGCCTATTATGGG - Intronic
978661186 4:111128434-111128456 TGGAATACAGTACCTATTATGGG + Intergenic
980828137 4:138096439-138096461 TAGAATGAAATGCCTATTCAAGG - Intergenic
981399807 4:144301076-144301098 TAGAGTGAAGTGCTTGTTATTGG - Intergenic
981498584 4:145421404-145421426 AGTAATGAAGTCACTATTATTGG + Intergenic
982719708 4:158847433-158847455 TGTCATGAGGTGCCTATTCTAGG + Intronic
985198069 4:187453836-187453858 TGGAAGCATGTGCCTATAATCGG + Intergenic
986016498 5:3761916-3761938 TGGAATAACGTGCCTGATATTGG + Intergenic
987501379 5:18714187-18714209 TGTAATGAAGTGCTTTATATAGG + Intergenic
987831182 5:23097550-23097572 TGGAATGAAGTCCCAAATATTGG - Intergenic
988625001 5:32865487-32865509 TGGATTAATGTGACTATTATAGG - Intergenic
989684478 5:44069159-44069181 TGGAATCAAGTGGCTCTTCTGGG + Intergenic
991337180 5:65562399-65562421 TAAAATAAAGTGCCTACTATGGG + Intronic
992462515 5:76974593-76974615 TGGAAAGAAATGCCTATTGTAGG + Intronic
995950911 5:117712826-117712848 TAGCATGAAGTGCATATAATAGG - Intergenic
995984240 5:118148838-118148860 TGGAATGCAGTGGCTATTTAAGG - Intergenic
999046678 5:148477281-148477303 TGGAAGGAAAAGCCAATTATTGG - Intronic
1000182615 5:158826617-158826639 TGGAATGAAATTTCTATTAGGGG + Intronic
1001149612 5:169215818-169215840 TAGAATGAAATTCCTATTTTAGG + Intronic
1001393222 5:171397482-171397504 TGGTATGAAGTGCTGATTGTGGG + Intronic
1004459627 6:15823623-15823645 TGGAATGATGAGTCTGTTATGGG - Intergenic
1004495847 6:16161889-16161911 TGGAATGGACTGTCTATTAAGGG + Intergenic
1004602423 6:17163138-17163160 TGGAATGTAGTGGCTGTTCTTGG - Intergenic
1005064306 6:21803644-21803666 TGGAGTGCAGTGCCTATTCACGG + Intergenic
1006882194 6:37350232-37350254 TGGAATGAAGTCACTATTCCTGG - Intergenic
1007126947 6:39433437-39433459 TGGAATAAAGTACACATTATGGG + Intronic
1008021660 6:46585220-46585242 TGCAATGAAGTGTGTAGTATGGG - Intronic
1010763215 6:79748432-79748454 TGTAATGAAATGCCTGTGATTGG + Intergenic
1014821544 6:125993947-125993969 TGGAATAAAGTGGATATTTTTGG + Intronic
1017080981 6:150668488-150668510 TTAAATGTAGTGTCTATTATTGG + Intronic
1018814764 6:167322317-167322339 TGGCATGAAGTTCCTCTTAGAGG - Intergenic
1020177004 7:5890121-5890143 TGAAATGAAGTCCCTAAGATCGG - Intergenic
1027422567 7:78031759-78031781 TGGCAAGATGTGGCTATTATCGG - Intronic
1028884828 7:95919846-95919868 TGAAATGAATAGCGTATTATTGG + Intronic
1029081829 7:97980876-97980898 TGAAATGAAGTCCCTAAGATCGG + Intergenic
1029418191 7:100456680-100456702 TGGAATGAAGGGGCTGATATGGG + Exonic
1029559159 7:101290988-101291010 TGGAATGAAGTACCCATTGAAGG + Intergenic
1030954624 7:115837178-115837200 TGGAATAAAGTGCCTGTTAAAGG - Intergenic
1034022569 7:147661106-147661128 AGGAGGGAAGTGCATATTATAGG - Intronic
1034114336 7:148570342-148570364 AGGAATGAATTGGCTATTCTTGG - Intergenic
1041334313 8:56763051-56763073 TGGAATGAAGTGTGTCTTTTTGG + Intergenic
1041962900 8:63639873-63639895 TGGAATGAAGACCCTCTTCTGGG + Intergenic
1041971408 8:63747166-63747188 AGGAATGAAGTGACAATTAGGGG - Intergenic
1043693928 8:83194623-83194645 TTTAATCAAGTGCTTATTATGGG - Intergenic
1044413195 8:91907700-91907722 TTGAATTAAGTGTCTATTCTTGG - Intergenic
1046326393 8:112652856-112652878 TGGAATGCAGTGGCTAATCTTGG + Intronic
1050674280 9:8034392-8034414 TGAAGTGAAGTGCCTAGGATGGG - Intergenic
1051472135 9:17455925-17455947 TGGAATGAAGAACCTATGAAGGG + Intronic
1052494468 9:29210772-29210794 TGGAATGGATTGCCTATTGATGG - Intergenic
1057128094 9:92634977-92634999 TGGAATGTAGTGCCTTGTAAAGG - Intronic
1186887914 X:13933178-13933200 TGGAATGATTGGCATATTATAGG - Intronic
1188593125 X:31863381-31863403 TGGAATGAAGTGCCTACCACAGG - Intronic
1189066669 X:37817099-37817121 TGGAATGACGTGCTAGTTATTGG - Intronic
1189640554 X:43066164-43066186 TGGAGTGAAGAGGCTTTTATAGG - Intergenic
1194467846 X:94255445-94255467 TGGAATGGTGTGCCCACTATTGG + Intergenic
1194597393 X:95875365-95875387 TGGAGTGCAGTGGCTATCATGGG - Intergenic
1199199240 X:145067674-145067696 TGAAGTGAAGTGCCTAGCATGGG - Intergenic
1201113762 Y:10820054-10820076 TGGAATGAAGTGAGAATGATTGG - Intergenic