ID: 1087596907

View in Genome Browser
Species Human (GRCh38)
Location 11:100265452-100265474
Sequence GGCCCATGACCTAGTGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 140}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087596907 Original CRISPR GGCCCATGACCTAGTGGAGC TGG (reversed) Intronic
900031045 1:373524-373546 GGCCCATGGCCTTGGGAAGCAGG + Intergenic
900051618 1:601778-601800 GGCCCATGGCCTTGGGAAGCAGG + Intergenic
900412962 1:2521377-2521399 GCACCCTGCCCTAGTGGAGCTGG + Intronic
901139273 1:7017927-7017949 GGCCCATGGCCTGGAGGAGCAGG - Intronic
901770211 1:11526349-11526371 GGTCCCTGACCTCTTGGAGCTGG - Intronic
906495695 1:46302725-46302747 GGCCCCTGCCCTAGGGCAGCCGG + Intronic
912385464 1:109269147-109269169 GGCCCAGGAGCCAGAGGAGCTGG + Exonic
1064267075 10:13833824-13833846 CGGCTATGACATAGTGGAGCTGG + Intronic
1065786186 10:29217789-29217811 GGCCCCTGCCCTAACGGAGCTGG + Intergenic
1070279454 10:75038048-75038070 GGCCCATGACGCAGTGAACCAGG + Exonic
1070720318 10:78752462-78752484 GGACCATGACCAGGAGGAGCCGG + Intergenic
1070808832 10:79287044-79287066 GGCCCATGTCCTAGGTGTGCTGG - Intronic
1073420914 10:103423031-103423053 GTTCCTTGACCTAGTGGTGCAGG + Exonic
1074084614 10:110199339-110199361 GGCTGATGAGCTAGTGCAGCTGG - Intergenic
1075631586 10:124003889-124003911 GGCTCATGACCTGGGGGAGATGG + Intergenic
1076438979 10:130466448-130466470 GGCCCACGCCCTGGTGCAGCTGG - Intergenic
1077463870 11:2724299-2724321 GGGCCGTCACCTGGTGGAGCGGG - Intronic
1078055236 11:8003806-8003828 GGCCCATGGCTTAGTAGGGCAGG - Intergenic
1079840290 11:25388737-25388759 AGCTCATGATCTAGTGGAGGAGG - Intergenic
1083197686 11:61098905-61098927 GCCCCAGGCCCTAGTGGACCTGG + Intergenic
1083375038 11:62213235-62213257 GGCCTATGAAATATTGGAGCTGG - Intronic
1085709984 11:78820552-78820574 GGCCCAGGACCTGGCAGAGCTGG + Intronic
1087596907 11:100265452-100265474 GGCCCATGACCTAGTGGAGCTGG - Intronic
1090385806 11:126356915-126356937 GGGCCAGGACCTAGAGGAGGTGG - Intronic
1093977406 12:25438321-25438343 GGCCAATGGCCTAGTTGTGCAGG - Intronic
1098080610 12:66780951-66780973 GGCCCAAGACAGCGTGGAGCAGG + Intronic
1098529005 12:71519442-71519464 AGCCCCTGACCTCATGGAGCTGG - Intronic
1098741542 12:74179057-74179079 GGGGCATTGCCTAGTGGAGCTGG - Intergenic
1098812124 12:75108025-75108047 GGCCTATGACCTTTGGGAGCTGG + Intronic
1102534893 12:113574279-113574301 AGCCTCTGACCTTGTGGAGCTGG + Intergenic
1103046847 12:117743089-117743111 GGCCCTTGGCCTGGTGAAGCTGG - Intronic
1105543966 13:21338627-21338649 GGCTCATGTCCTTCTGGAGCTGG + Intergenic
1109517573 13:63464388-63464410 GGACCATGGCCAAGTGGAGCTGG - Intergenic
1113849162 13:113408087-113408109 GGCCCGTGACGTAGAGCAGCAGG + Intergenic
1114201480 14:20525108-20525130 GTCCCAGGACCATGTGGAGCTGG - Intergenic
1114680717 14:24481897-24481919 GTCCCATGACCTGGCTGAGCGGG - Intergenic
1118300004 14:64606789-64606811 TGCACATGACCTAGTGGAGGGGG + Intergenic
1119990444 14:79190991-79191013 TGACCATGACTTAGTGGAGATGG - Intronic
1120873146 14:89355933-89355955 GCCCCATGTCAAAGTGGAGCAGG + Intronic
1130316595 15:82801846-82801868 GGACCAAGACATGGTGGAGCTGG - Intronic
1130509402 15:84576347-84576369 GGTCCATGACATATTGTAGCAGG + Intergenic
1130871846 15:87978061-87978083 GCCCCATGGGCCAGTGGAGCTGG + Intronic
1132086425 15:98911908-98911930 GGCTCATGACCTAGAGCAGAGGG - Intronic
1132927604 16:2439373-2439395 GGCCCATGACCTGTTTGAGGAGG + Exonic
1136867266 16:33768218-33768240 GGACCATGAGCTAGGGGAGCGGG - Intergenic
1139432094 16:66916291-66916313 GGCCCTGGACCGAGAGGAGCAGG - Exonic
1140299685 16:73744837-73744859 GACCCATGAAATAGTGCAGCAGG + Intergenic
1140474010 16:75229576-75229598 GGCCCAGGACATGGTGGAGAGGG - Exonic
1140519097 16:75566591-75566613 GGCCCTGGGCCGAGTGGAGCGGG + Intronic
1142237323 16:88928329-88928351 GGCCGATGACCAGGTGGAGCGGG + Intronic
1142403617 16:89873894-89873916 GGCCCTTGACGTTGTGGGGCGGG + Intronic
1203104896 16_KI270728v1_random:1347985-1348007 GGACCATGAGCTAGGGGAGCGGG + Intergenic
1203128618 16_KI270728v1_random:1614383-1614405 GGACCATGAGCTAGGGGAGCGGG - Intergenic
1142848634 17:2693911-2693933 CGCCCATGATGTAGTGGAGGCGG + Exonic
1144671626 17:17136100-17136122 GGCCCCTGACATTGTGTAGCTGG + Intronic
1148358814 17:46995246-46995268 GCCCCAGGACCTAGGGCAGCAGG + Intronic
1148745181 17:49914107-49914129 GGCCCATGGGCTGGTGGAGAAGG - Intergenic
1150787804 17:68176894-68176916 GCCCCAGGACCTAGGGCAGCAGG - Intergenic
1151987882 17:77555809-77555831 GGCCCAGGACAGAGTGGAGGGGG - Intergenic
1152090195 17:78242238-78242260 GGCCCAGGACCTGGCGGAGCTGG - Intergenic
1152341839 17:79729931-79729953 GGACCATGAGCTAGGGGAGCGGG - Intergenic
1152948595 17:83212145-83212167 GGCCCATGGCCTTGGGAAGCAGG - Intergenic
1154166172 18:12015977-12015999 AGCCCTTGCCCTAGTGGAGTTGG - Intronic
1154313119 18:13282768-13282790 GGGGCATGGCCTAGTGGAGCTGG - Intronic
1155982661 18:32196855-32196877 TGCCCATGATGTAGTGGAGGCGG + Intronic
1156036054 18:32769760-32769782 GGCCCCGGAGCTGGTGGAGCGGG - Exonic
1159131184 18:64281712-64281734 GGGGCACGGCCTAGTGGAGCTGG + Intergenic
1159726889 18:71971982-71972004 GGCCCATCACATGGGGGAGCAGG + Intergenic
1160235014 18:77078851-77078873 TGCCTGTGACCCAGTGGAGCTGG + Intronic
1160691722 19:463485-463507 GATCCAGGCCCTAGTGGAGCTGG + Exonic
1160911139 19:1474324-1474346 GGCCCAGGACCTGCTGCAGCTGG + Exonic
1161865599 19:6829971-6829993 GGCACATGCCCAAGTGGAGAGGG - Intronic
1162578437 19:11513115-11513137 GCCCCAGGACCCTGTGGAGCTGG - Exonic
1164677450 19:30111380-30111402 GCCCCACGCCCTAGTGGAGGGGG - Intergenic
1166214044 19:41324268-41324290 GCCCCATGAACTAGTGAAGTGGG + Exonic
1168697214 19:58410307-58410329 GCCCCAGGAGCTAGTGGAGCAGG + Intronic
930352280 2:50272090-50272112 GGTCCCTGACCTTGGGGAGCAGG + Intronic
931881044 2:66571344-66571366 GGCCCATGACGCAGCTGAGCAGG - Exonic
933229829 2:79793736-79793758 GGCCCAAGACCTAATGGTGAAGG - Intronic
934136462 2:89000700-89000722 GGCCCATGATTTAGTGGAAATGG + Intergenic
934139890 2:89036260-89036282 GGCCCATGATTTAGTGGAAATGG + Intergenic
934229350 2:90164291-90164313 GGCCCATGATTTAGTGGAAATGG - Intergenic
935071599 2:99699328-99699350 TGCCCATGACCCAGTGGCCCAGG - Intronic
937098221 2:119249334-119249356 GCCCCATGAGCTTGTGGACCAGG - Intronic
939047871 2:137270623-137270645 GAGCCATGACCTAATGTAGCAGG + Intronic
939754159 2:146088996-146089018 AGCCCCTGACCTACAGGAGCTGG + Intergenic
944635524 2:201672780-201672802 AGCCCAGGACCAAATGGAGCTGG + Intronic
947826213 2:233107664-233107686 GGCCCTGGCACTAGTGGAGCTGG - Intronic
1168844956 20:938039-938061 GGCACATCACCTGGTGAAGCAGG - Intergenic
1174670043 20:52298615-52298637 TGCCCTTGACCCAGTGGAGCTGG + Intergenic
1175424738 20:58856052-58856074 GGCCCTTGGCCTGGGGGAGCGGG + Intronic
1175573344 20:60040696-60040718 GGCCCAGGACTCACTGGAGCTGG + Intergenic
1176613505 21:9008491-9008513 GGCCCTGGACCAAGTGGAACAGG - Intergenic
1178430709 21:32516542-32516564 GGGCCAGGATCAAGTGGAGCTGG + Intergenic
1179347001 21:40567699-40567721 AGCCCTTGACCTTGTGGAGCTGG - Intronic
1180761893 22:18216921-18216943 AGACCATGATCTAGTGGAGCTGG - Intergenic
1180773774 22:18407689-18407711 AGACCATGATCTAGTGGAGCTGG + Intergenic
1180805125 22:18657233-18657255 AGACCATGATCTAGTGGAGCTGG + Intergenic
1180805620 22:18712175-18712197 AGACCATGATCTAGTGGAGCTGG - Intergenic
1181069833 22:20326404-20326426 AGAACATGATCTAGTGGAGCTGG + Intergenic
1181192875 22:21154614-21154636 AGACCATGATCTAGTGGAGCTGG + Intergenic
1181216567 22:21337960-21337982 AGACCATGATCTAGTGGAGCTGG - Intergenic
1183259853 22:36787693-36787715 GGCCCAAGACCTGGAGAAGCTGG + Intergenic
1183290489 22:36999123-36999145 GGCCCAGGACCCAGTAGAACTGG - Intronic
1183342960 22:37292188-37292210 AGCCCATGAGCCAGTGGAGGAGG + Intronic
1184231205 22:43159367-43159389 GGCCCAGCACCCAGTGGGGCGGG - Exonic
1184468358 22:44682028-44682050 GGTCCATGGCCGCGTGGAGCAGG - Intronic
1203235606 22_KI270731v1_random:148663-148685 AGACCATGATCTAGTGGAGCTGG + Intergenic
952086841 3:29832822-29832844 TGCCCATGAGCTAGTTGAGGAGG - Intronic
953703836 3:45216521-45216543 GGCCAAAGACCTAATGGAGATGG - Intergenic
954958988 3:54548155-54548177 GGCCCATGACCTGCTGGGACTGG - Intronic
955542366 3:59991085-59991107 GGCCCTTGATCTCATGGAGCTGG - Intronic
956900713 3:73713237-73713259 AGCACATGAGCTAGTGGAGGTGG + Intergenic
961042945 3:123690135-123690157 GTCCCATCGCCTAGTGGAGATGG + Intronic
961367372 3:126408631-126408653 GCCTCATGACCAAGGGGAGCCGG - Intronic
965648353 3:170908370-170908392 GGCTCAGGCCCTAGTGGGGCCGG - Intronic
966234532 3:177686227-177686249 GGCCCCTGATCTGCTGGAGCTGG - Intergenic
968953334 4:3705993-3706015 GGCCTCTGTCCTAGTGGAGAGGG - Intergenic
971111616 4:23591991-23592013 GGGGCACTACCTAGTGGAGCTGG + Intergenic
982019689 4:151190816-151190838 GGGGCATCGCCTAGTGGAGCTGG + Intronic
985504347 5:270569-270591 GGCCCCTGACCCCGTGCAGCTGG - Intergenic
988444479 5:31270178-31270200 GTTTCCTGACCTAGTGGAGCTGG - Intronic
991109210 5:62879626-62879648 TGCCCAAGACCTGGTGGAGAAGG - Intergenic
992251046 5:74876285-74876307 GGCCCATGACCGGGTGTTGCTGG + Intergenic
999117302 5:149175198-149175220 AACCCATGACCAAGTGTAGCCGG + Intronic
1001793306 5:174480139-174480161 GGCCCAGGACCTATGGGAGGGGG + Intergenic
1002742775 5:181445344-181445366 GGCCCATGGCCTTGGGAAGCAGG - Intergenic
1003408118 6:5839754-5839776 GGCTCATGTCCTTCTGGAGCTGG - Intergenic
1005478614 6:26233769-26233791 GGCCCACGATCTTGTGCAGCTGG - Intergenic
1007612755 6:43160979-43161001 GGCCCCTGCCCTAGTGCAACAGG + Exonic
1011806072 6:91073954-91073976 GTCCCATGACCTAGTTTGGCTGG + Intergenic
1011981660 6:93386590-93386612 GGGGCATTGCCTAGTGGAGCTGG - Intronic
1018766151 6:166934401-166934423 GGGCCACCACCGAGTGGAGCTGG + Intronic
1019247906 6:170721083-170721105 GGCCCATGGCCTTGGGAAGCAGG - Intergenic
1029524774 7:101087981-101088003 GGACAATAACCTGGTGGAGCTGG + Exonic
1033544666 7:142389186-142389208 GGCCCATGGCACAGTGGGGCAGG - Intergenic
1033552809 7:142463101-142463123 GGCCCATGGCACAGTGGGGCAGG - Intergenic
1033555134 7:142482539-142482561 GGCCCATGGCACAGTGGGGCAGG - Intergenic
1033559736 7:142520074-142520096 GGCCCATGGCACAGTGGGGCAGG - Intergenic
1035500207 8:86781-86803 GGCCCATGGCCTTGGGAAGCAGG + Intergenic
1036616541 8:10392169-10392191 TGCCCCTGACCTAGTCTAGCAGG - Intronic
1038567754 8:28634100-28634122 GGGCCAGAACTTAGTGGAGCAGG + Intronic
1039079717 8:33722730-33722752 GGCCCAGGTCCTGGTGGTGCTGG + Intergenic
1040467047 8:47704973-47704995 GGCCCATGACCCAGAAGAGCAGG - Intronic
1040899438 8:52403059-52403081 GACCCAAGGCCCAGTGGAGCAGG - Intronic
1043257104 8:78150575-78150597 GGCCAATCACCCAGTGGGGCTGG + Intergenic
1044401244 8:91774872-91774894 TGACCATGTCCTAGTGGAGGAGG + Intergenic
1044538204 8:93381545-93381567 GGGGCACCACCTAGTGGAGCTGG - Intergenic
1048279607 8:133095316-133095338 GGCTGATGACCAACTGGAGCTGG + Intronic
1049171889 8:141166776-141166798 TGCCCCTGCCCTCGTGGAGCTGG + Intronic
1049368606 8:142252881-142252903 GGCCACTGCCCTAGTGGGGCAGG + Intronic
1049999636 9:1063445-1063467 TGCACATGACTGAGTGGAGCAGG + Intergenic
1050358450 9:4804799-4804821 GTCCCATGACCTCATGGACCAGG - Intronic
1056796170 9:89660278-89660300 GGCCCAGGAGCCAGTGGACCTGG + Intergenic
1057915478 9:99052167-99052189 GACCCATGATGTAGTTGAGCTGG - Intronic
1059344197 9:113617019-113617041 GGCCCTTCACCTTGTGGGGCTGG - Intergenic
1062073611 9:134572516-134572538 GGTCCATGACCTAGTAGAGTGGG - Intergenic
1062439822 9:136564661-136564683 GGGCCCTGACCTGGTTGAGCTGG - Intergenic
1062479458 9:136744686-136744708 GGCTCTTCACCAAGTGGAGCAGG - Exonic
1062651509 9:137580127-137580149 GGGCCCTGACCCAGAGGAGCAGG + Intergenic
1203608678 Un_KI270748v1:76562-76584 GGCCCATGGCCTTGGGAAGCAGG - Intergenic
1190092262 X:47449863-47449885 GGCCTCTTACATAGTGGAGCTGG - Intronic
1190136001 X:47798581-47798603 GCCCCATGGCCTAGAGGAGAAGG - Intergenic