ID: 1087602807

View in Genome Browser
Species Human (GRCh38)
Location 11:100338231-100338253
Sequence TTAAGGTTCTTAATATGTCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 126}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087602802_1087602807 7 Left 1087602802 11:100338201-100338223 CCTTTTGCTTTCAGCCAGCACTG 0: 1
1: 1
2: 12
3: 87
4: 951
Right 1087602807 11:100338231-100338253 TTAAGGTTCTTAATATGTCGTGG 0: 1
1: 0
2: 0
3: 7
4: 126
1087602799_1087602807 26 Left 1087602799 11:100338182-100338204 CCTCCTTCCATTTCTTGTTCCTT 0: 1
1: 1
2: 8
3: 149
4: 1437
Right 1087602807 11:100338231-100338253 TTAAGGTTCTTAATATGTCGTGG 0: 1
1: 0
2: 0
3: 7
4: 126
1087602800_1087602807 23 Left 1087602800 11:100338185-100338207 CCTTCCATTTCTTGTTCCTTTTG 0: 1
1: 0
2: 5
3: 109
4: 1059
Right 1087602807 11:100338231-100338253 TTAAGGTTCTTAATATGTCGTGG 0: 1
1: 0
2: 0
3: 7
4: 126
1087602806_1087602807 -7 Left 1087602806 11:100338215-100338237 CCAGCACTGAGGTTGGTTAAGGT 0: 1
1: 0
2: 0
3: 9
4: 305
Right 1087602807 11:100338231-100338253 TTAAGGTTCTTAATATGTCGTGG 0: 1
1: 0
2: 0
3: 7
4: 126
1087602801_1087602807 19 Left 1087602801 11:100338189-100338211 CCATTTCTTGTTCCTTTTGCTTT 0: 1
1: 2
2: 24
3: 446
4: 3182
Right 1087602807 11:100338231-100338253 TTAAGGTTCTTAATATGTCGTGG 0: 1
1: 0
2: 0
3: 7
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087602807 Original CRISPR TTAAGGTTCTTAATATGTCG TGG Intronic
904916911 1:33976899-33976921 TTTAGGTTCTTCAAGTGTCGTGG + Intronic
910230315 1:84979672-84979694 ATATGGTTCTTATTATGTTGAGG - Intronic
911305765 1:96230258-96230280 TTAAGGTTCATAATATTTCCAGG + Intergenic
915642732 1:157241716-157241738 CCAAGGTTCTTATTATGTTGAGG - Intergenic
916263351 1:162864887-162864909 TTATGGTTCTTAATATATTTGGG - Intronic
916377835 1:164175398-164175420 TTAAGGTTCTTAATACATATGGG + Intergenic
919396033 1:197048974-197048996 TTAAAGTTCTGAATATTTAGGGG - Intronic
919507247 1:198414732-198414754 TTAAGGTTCTTCAAATTTCAAGG + Intergenic
1065038679 10:21667345-21667367 TTGAGGTTCTTAAACTGTGGGGG + Intronic
1065126480 10:22579040-22579062 GTAAAGTTCTTCATTTGTCGTGG - Intronic
1066094692 10:32060931-32060953 TTAATGTTCTTAATCTGTATAGG - Intergenic
1077449078 11:2624290-2624312 TTAAGGTTCTTTATATATTTTGG + Intronic
1079584129 11:22104553-22104575 TTAAGGTTCTAATTTTGTGGTGG - Intergenic
1080019859 11:27549098-27549120 TTAAGGTTCCCAATCTGTTGAGG - Intergenic
1085834021 11:79933093-79933115 TTAAGCTTCTTAATATAAAGTGG + Intergenic
1087602807 11:100338231-100338253 TTAAGGTTCTTAATATGTCGTGG + Intronic
1087875207 11:103347666-103347688 TAAAAGTTTTTAAAATGTCGTGG + Intronic
1090584686 11:128198645-128198667 TAAAGGTTGTTAAAATGTGGCGG + Intergenic
1091355817 11:134936883-134936905 TTAAGGTTATTAAGCTGTCATGG - Intergenic
1098073800 12:66704666-66704688 TTAAGGTTCTTAAGCTCTCTGGG - Intronic
1098128088 12:67320834-67320856 TTAACCTTCTTAGTATGTTGGGG - Intergenic
1099114117 12:78602620-78602642 ATATGGTTCTTAATATTTTGTGG - Intergenic
1099174295 12:79402827-79402849 TTCAGGTCCTTAATATGCTGAGG - Intronic
1100299140 12:93291235-93291257 CCAAGGTTCTTATTATGTAGAGG - Intergenic
1105568106 13:21572075-21572097 TTAATGTTTTTAATATGGCAGGG - Intronic
1106291198 13:28364098-28364120 TTAGGGTTCTTTATATGTTTGGG + Intronic
1106530505 13:30586342-30586364 TTAATGTTCTTAACATTTAGAGG - Intronic
1107317846 13:39152833-39152855 TTAAGGATCTTAAGATGAGGTGG + Intergenic
1109946379 13:69437691-69437713 TTTATGTTCTAAATATGTCAGGG + Intergenic
1109958841 13:69604724-69604746 TTAAGGATCTTGAGATGTGGAGG - Intergenic
1111754713 13:92378753-92378775 TTAGGGTGCTTAAAATGTAGAGG - Intronic
1111793949 13:92893922-92893944 TTTAGGTTCTTGCTATGTCCAGG - Intergenic
1112137069 13:96591839-96591861 GTAAGGTTTTTATTATGTTGAGG + Intronic
1112832790 13:103473846-103473868 TTAATGTTCTTAACATGTAGTGG + Intergenic
1112880403 13:104100239-104100261 TTGAGGTTCTGAATAAGTGGAGG - Intergenic
1113261440 13:108568555-108568577 TGAAAGTTCTTTATATGTCCTGG + Intergenic
1115948171 14:38688112-38688134 ATAAGGTTCTTTATATGAAGTGG + Intergenic
1118476821 14:66125244-66125266 TTAAGGATCTTAATATGCACTGG + Intergenic
1126112552 15:45184362-45184384 TTAAAGTTCTTAATATTTTGGGG + Intronic
1129662382 15:77560399-77560421 TTACGGTTCATAATATCCCGGGG + Intergenic
1131102079 15:89700453-89700475 TTAAGGTGCTTAATATATAGTGG - Intronic
1133137008 16:3719095-3719117 CCAAGGTTCTTATTATGTAGAGG + Intergenic
1137066278 16:35847954-35847976 TTATGGTCTTTAATATGTTGAGG + Intergenic
1137758465 16:50920984-50921006 TTAAGATTCTGAATATGATGAGG - Intergenic
1143040196 17:4029326-4029348 TTTAGTTTCTTAATATTTGGGGG - Intronic
1146121921 17:30203354-30203376 TTAAGGTTTTTAATGTTTCTTGG - Intronic
1150486862 17:65550092-65550114 TTTAGGTACTTAAGATGTCTTGG - Intronic
1156979432 18:43266839-43266861 TTAAAGTTTTGAAAATGTCGAGG - Intergenic
1157007398 18:43600436-43600458 TTTAGGTTCTAAATATTTAGGGG - Intergenic
1157185335 18:45535712-45535734 TCATGGTTCTTAATCTTTCGGGG + Intronic
1157232316 18:45929376-45929398 TTAGGGTTCTTATTCTGTAGGGG - Intronic
1158618107 18:59006152-59006174 TTAAGGATCTTAAAATGTGGGGG + Intergenic
1160941595 19:1622580-1622602 TTGAGGTTCTTATGATGTCCTGG + Intronic
927627261 2:24734926-24734948 TTAAGTCTCTCAATATGTCTGGG - Intronic
929734412 2:44531426-44531448 TTAAGGTTCTTTAAATATCCTGG + Intronic
929951911 2:46418120-46418142 ATAAGGTCCTTATTATGTTGTGG - Intergenic
932962096 2:76425068-76425090 ATAGAGTTCTTAATATGTCCTGG + Intergenic
933025598 2:77253547-77253569 TTCTGGTTCTCAATATGTCAAGG - Intronic
933434992 2:82237648-82237670 TTAAAGTTCTTAAAATGACAGGG - Intergenic
936244483 2:110814880-110814902 TTAAGGTTTTTAGTTTGTCCTGG + Intronic
937958659 2:127438219-127438241 TGAAGGTTCTCAATATGGCCTGG - Intronic
939240863 2:139558547-139558569 TTTAGGTTCTTTAGATGTCTGGG + Intergenic
944449885 2:199831874-199831896 GTGAGTTTCTTAATGTGTCGAGG + Intronic
944637703 2:201690724-201690746 TGAAGGTTCTGAATAAGTGGTGG + Intronic
947510665 2:230751124-230751146 TTAAGGTTCTTAAGCAGTCATGG - Intronic
948587889 2:239031327-239031349 TGAAAGTTCTTTATATGTCCTGG + Intergenic
1175049289 20:56139068-56139090 TAAAGGTTTTCAATATGTCTGGG + Intergenic
1178100326 21:29261161-29261183 TGAAGGTTTTTAATATGTGCTGG + Intronic
950697027 3:14709510-14709532 ATATGGCTCTTAATATGTTGTGG + Intronic
955392041 3:58529016-58529038 TTAAGGTTTTTATGGTGTCGGGG - Intronic
956101527 3:65773220-65773242 TTAAGGTTGTTAATCTTTTGGGG - Intronic
957577173 3:82023605-82023627 TTAATGTACTTAATAGGTAGAGG - Intergenic
957915618 3:86684652-86684674 TCAAAGTTCTTATTATGACGTGG + Intergenic
958630816 3:96681218-96681240 ATAAGGTTTTTATTATGTTGAGG + Intergenic
959927767 3:111943508-111943530 TACAGGTTCTTAATATGTTGTGG - Intronic
963764074 3:149315695-149315717 TTAAGGATCTTAAAATGGGGGGG - Intergenic
964897090 3:161611780-161611802 TTAAGGTTCTTGAGATGGGGAGG - Intergenic
972369923 4:38413321-38413343 TTAAGGTTTTTAAAATGTTAGGG - Intergenic
973758762 4:54099155-54099177 TTTAGGTTCTTAAGATGCAGAGG + Intronic
974708332 4:65553085-65553107 TTAATTTTATTAATATGTCTGGG - Intronic
975338100 4:73204759-73204781 GTAAGGTTCTTAATATTTTCGGG + Intronic
975415266 4:74098440-74098462 TTAAGGTTATTAATCTGTTCTGG - Intronic
975771321 4:77726041-77726063 TTTAGATTCTTAAAATGTCTAGG - Intronic
977911766 4:102545487-102545509 TTAAGCTTCTTAATTTCTCTAGG - Intronic
984993944 4:185409741-185409763 TTAAGGATCTTAAGATGGGGAGG + Intronic
987633128 5:20502854-20502876 TTAAGGTTCTGAACTTGTCATGG - Intronic
988866338 5:35339058-35339080 TTAAGGATCTTAAAATGAGGAGG + Intergenic
991112125 5:62912824-62912846 AGAAGGTTCTTAATATTTTGAGG + Intergenic
991486899 5:67146265-67146287 TTAAGGAGCTTAATATATCATGG + Intronic
993148595 5:84129952-84129974 TTAAGAATCTTAATATTTAGTGG - Intronic
993802688 5:92363239-92363261 TTAAGGATCTGAATATTTCATGG - Intergenic
993847209 5:92959014-92959036 ATAAGGTTTTTAGTATGTCATGG - Intergenic
994226580 5:97258592-97258614 TTAAGGCTGTTATTATGTTGAGG - Intergenic
998837668 5:146218746-146218768 TTGAGGTTCTAAATATATCAAGG - Intronic
999690616 5:154142966-154142988 TTAAGGATCTTGAGATGTGGAGG - Intronic
1007505198 6:42330077-42330099 TTAAGGATATTAATATGCAGAGG - Intronic
1007985007 6:46198653-46198675 TTAAGGATCTTGAGATGGCGAGG + Intergenic
1008902355 6:56635297-56635319 TTTAAGTTCTTAATATATCCTGG - Intronic
1009047512 6:58248319-58248341 ATATGGTTCATAATATCTCGGGG + Intergenic
1010357960 6:74957306-74957328 TAAAGTTTCTAAATATCTCGCGG + Intergenic
1010946210 6:81976227-81976249 TAAAGGTTATTAATTTGTCTTGG - Intergenic
1012323943 6:97890018-97890040 TTAAGCTTCATAATATGTGAGGG + Intergenic
1013644274 6:112120721-112120743 TTAAGGATCTTACTGTGTCTTGG + Intronic
1015964575 6:138685076-138685098 TTGAGTTTCTTAATATTTTGGGG - Intronic
1021032680 7:15757452-15757474 TTAAGAGTCTTAAAATGTGGTGG - Intergenic
1023364094 7:39445807-39445829 TCAAAGTTCTTATTATGTCTGGG + Intronic
1025974573 7:66359486-66359508 CTAAGGTTCTTAAAGTGTCCAGG - Intronic
1028388625 7:90289496-90289518 TTAGAGTTCTTTATATGTCCTGG + Intronic
1028513872 7:91655128-91655150 TGAAGGTTGTTATTATGTCTTGG - Intergenic
1028585743 7:92449192-92449214 TTATGGTTCTTGATATGGCCAGG + Intronic
1028633789 7:92964541-92964563 TCCAGGTTCTTAATTTGTGGAGG + Intergenic
1028765725 7:94557081-94557103 TTAAATTGCTTAATATGTAGGGG + Intergenic
1031545084 7:123042063-123042085 TTAAGCATCTTAATATATCTTGG - Intergenic
1034311669 7:150094366-150094388 TCAAGGTTTTTATTATGTCTAGG - Intergenic
1034795182 7:154006288-154006310 TCAAGGTTTTTATTATGTCTAGG + Intronic
1039517450 8:38145731-38145753 TTAAGGTTCTTAAACTTTCTGGG + Intronic
1043506362 8:80907037-80907059 TAAAGGTGCTGATTATGTCGTGG - Intergenic
1043790547 8:84462309-84462331 TAAAGGTTCTCAATATGTTTTGG + Intronic
1046767290 8:118083646-118083668 TTGAGCTTCTTACTATGTCCTGG - Intronic
1051256360 9:15217805-15217827 TTTAGGTTCTTAATCTGAGGAGG - Intronic
1052595236 9:30549385-30549407 TTAAGCTTCTTGATATTTGGAGG + Intergenic
1054761651 9:69010337-69010359 TAAAGGTTCTTAACATTTCTTGG - Intergenic
1054802803 9:69368338-69368360 TTATGGTCCTTATTATGTTGAGG + Intronic
1055837217 9:80457689-80457711 TTAAAATTCTTTATATGTCTTGG + Intergenic
1056035437 9:82600200-82600222 TTAAGGTTCTTATTCTGTCCAGG - Intergenic
1059611694 9:115904288-115904310 TTAAGGTTCTTCATATATTATGG + Intergenic
1185787260 X:2901284-2901306 TTAAGTGTCTTAATATGGGGAGG - Intergenic
1185839675 X:3376904-3376926 CTAAGGTCCTTAAAATGTTGCGG - Intergenic
1190015880 X:46826792-46826814 TTGAGGTTTTTAATAAGTTGTGG + Intergenic
1194520460 X:94912615-94912637 TTAAAGTCCTTATTATGTTGAGG + Intergenic
1194915416 X:99701305-99701327 TGAAGGTTCTAAGTATATCGAGG + Intergenic
1198038902 X:132829640-132829662 TTAAGGCCCTTGATATGTAGTGG - Intronic
1198736472 X:139791045-139791067 TTAAGGTTTTTATTATGTAAGGG + Intronic
1202093965 Y:21224992-21225014 ATAAGGTTTTTATTATGTTGAGG + Intergenic